Materials Today: Proceedings xxx (xxxx) xxx

Contents lists available at ScienceDirect

Materials Today: Proceedings

journal homepage: www.elsevier.com/locate/matpr

Copper nanoparticles green synthesis and characterization as anticancer

potential in breast cancer cells (MCF7) derived from Prunus nepalensis
phytochemicals
Samuel Shiferaw Biresaw ⇑, Pankaj Taneja
Sharda University, Biotechnology, plot No. 32-34, knowledge park III, Greater Noida, Uttar Pradesh 201310, India

a r t i c l e i n f o a b s t r a c t

Article history: The green synthesis of nanoparticles from bioactive compounds have attracted a wide range of applica-
Received 24 November 2020 tion, due to increased drug efficacy and less toxicity in the nanosized mediated drug delivery model. In
Received in revised form 14 June 2021 this study, we have fabricated copper nanoparticles (CuNPs) from the fruits of Prunus nepalensis (P.
Accepted 6 July 2021
nepalensis) extract. Therefore, the aim of present study was to investigate the anticancer ability of P.
Available online xxxx
nepalensis fruit phytochemical copper nanoaprticles (PNFPCuNP) on cancerous human breast cell line
(MCF-7) and healthy (MCFA10) cell lines. Crystalline CuNPs of P. nepalensis synthesis was confirmed
Keywords:
by different physicochemical analytical techniques such as UV–Visible Spectroscopy (UV–Vis); Fourier-
Copper nanoparticles
Phytochemicals
Transform Infrared Spectroscopy (FT-IR); Scanning Electron Microscopy (SEM); and Transmission
Gene expression Electron Microscopy (TEM). Nanoparticle Size was found to be ranging from 35 to 50 nm with the average
Characterization size of 42.5 nm. Further, after synthesized compounds were tested anticancer activity on human breast
Breast cancer cancer cell lines. Following 72 h treatment to PNFPCuNP, the expression of apoptotic marker genes
(P21, p53, P14/P19, Caspase-3) were studied in MCF-7 cells treated at 100 to 200 lg of PNFP-CuNP.
Our results showed that PNFP-CuNP increased the gene expression of apoptotic genes in a dose-
dependent manner. The real-time PCR data showed a significant upregulation in p53, Bax, caspase-3,
and caspase-9 and down regulation in the mRNA expression of Ras and Myc genes in MCF-7 cells exposed
to PNFP-CuNP. Collectively, the data from this study stated that P. nepalennsis fruit extract phytochem-
ical derived nanoparticles induced apoptosis via the up regulation of tumour suppressor genes and down
regulation of oncogenes in MCF-7 cells. Finally, our study confirmed the CuNPs synthesis from P. nepalen-
sis fruit phytochemical, which showed environmental friendly anticancer activity.
Ó 2021 Elsevier Ltd. All rights reserved.
Selection and peer-review under responsibility of the scientific committee of the National Conference on
Functional Materials: Emerging Technologies and Applications in Materials Science.

1. Introduction The leading cause of cancer death in women worldwide is breast

cancer. Even if there is advancement in detection and chemother-
Phytochemicals from medicinal plant parts are believed much apy, still it is the main cause for dying of many women worldwide
safer and easier to metabolize than other synthetic medicinal com- especially in developed world [8].
posites [1,2]. The bioactive compounds obtained from the plant Alkylating agents, antimetabolites and other different cancer
parts lead towards synthesis of drugs [3]. Developed countries therapy methods have side effects without discriminating the
used almost quarter of the total medicinal bioactive compounds cancerous cells and normal cells [9]. Using of nanomaterials in
from natural compounds [4–6]. the cancer therapy has been found as an important means for dis-
As of WHO each year 1.3 million women developing breast can- covery of the modern cancer drugs [10,11]. Nanoparticles are
cer disease. And this cancer is a problem of global issue since its sometimes referred to as structured contemporary pharmaceuti-
incidence. But effective therapeutic options are quite limited [7]. cals that are particularly useful in the treatment of cancer due to
their nanoscale sized nature, which allows for improved medica-
tion efficacy and long-term drug release [12,13].
⇑ Corresponding author.
E-mail address: [email protected] (S.S. Biresaw).

https://doi.org/10.1016/j.matpr.2021.07.149
2214-7853/Ó 2021 Elsevier Ltd. All rights reserved.
Selection and peer-review under responsibility of the scientific committee of the National Conference on Functional Materials: Emerging Technologies and Applications in
Materials Science.

Please cite this article as: Samuel Shiferaw Biresaw and P. Taneja, Copper nanoparticles green synthesis and characterization as anticancer potential in
breast cancer cells (MCF7) derived from Prunus nepalensis phytochemicals, Materials Today: Proceedings, https://doi.org/10.1016/j.matpr.2021.07.149
Samuel Shiferaw Biresaw and P. Taneja Materials Today: Proceedings xxx (xxxx) xxx

Green synthesis of nanoparticles (NPs) is one of the technology k is the wavelength, K is a Scherrer constant having value of 0.94, b
branches that are rapidly developing in the field of bionanotech- is a half width maximum and h is the diffraction angle. FTIR tech-
nology [14,15]. Particular emphasis has been placed on investigat- nique used to identify functional groups present in the fruit extract
ing different controlled shape, size, and dispersion degree of NPs and synthesized CuNPs between the wave number of 450 cm
1 to
using bio-inspired methods [16]. 4000 cm
1. Scanning Electron Microscope (SEM) (LeoSupra55,
Edible fruits have attracted the scientific community in recent CarlZeiss, Germany) also used to determine the shape of synthe-
times because they contain many antioxidants and bioactive phy- sized CuNPs. Moreover, TEM was used to confirm the size of
tochemicals that can serve as potential remedial agents. The plant nanoparticles.
of interest in this study is P. nepalensis, which is commonly used to
make different juice drinks and other wines. Furthermore, P. 2.5. Cell culture
nepalensis fruits are used as an astringent. The leaves are also used
as a diuretic and to treat edema [17,18]. Moreover, also used as Human breast carcinoma cells (MCF7) and human normal cell
antioxidant and scavenging agent [17]. Several bioactive com- line MCF10A were obtained from Pune. MCF7 and MCF10A cells
pounds like quinic acid, quercetin, rutin, scopoletin, palmitoleic were grown in DMEM, complemented with fetal bovine serum
acid, and naringenin have been found in Prunus species [18,19]. (10%) in a CO2 incubator (5% CO2, 95% air) at 37 °C.
However, there is no work has done that P. nepalensis fruit extract
can be used to make copper nanoparticles for the cancer cell treat- 2.6. RNA extraction and CDNA synthesis
ments. As a result, the current study was the first to use P. nepalen-
sis fruit extract to synthesise copper nanoparticles with anticancer In accordance with the manufacturer instructions, Total RNA
properties. was extracted from the cells through the use of RNXTM-Plus
Thermo scientific solution. Thermo Scientific NanoDropTM 1000
2. Material & method Spectrophotometer (Thermo Scientific, Germany) has determined
the purity and concentration of the extracted RNA and confirma-
2.1. material, collection of plant material tion of its integrity by gel electrophoresis. The DNaseI therapy fol-
lowed the RNA extraction step (EN0521, Fermentas, Germany).
P. nepalensis fruits were purchased from market, India. This Random hexamers were also used as primers and Prime
fruits were washed clearly and cut into uniform pieces then sub- ScriptTM-RT kits for synthesis of CDNA, using 1 lg of RNA (TaKaRa,
jected to freeze drying. Those freeze dried sample was kept under Japan).
4 °C.
Then dried fruits made into powder. 10 g of dried fruit powder 2.7. Quantitative RT-PCR
was mixed with 1L of deionized water. Solution is heated in a
water bath to 80° for 1 h. then, the P. nepalensis fruit extract fil- Both MCF7 and MCF10A cell lines were used to extract total
tered and made ready for subsequent experiments. RNA by using the RNeasy mini test kit (Qiagen, Hilden, Germany)
according to the manufacturer’s instructions. Quantitative Real-
Time PCR used to measure the expression of mRNA of Ras, p21,
2.2. Reagents
p53, Myc, P14/P19 and Caspas3 present in both MCF-10 and
MCF7 cells.
Copper sulfate, starch, sodium hydroxide and CV dye used for
At 260 nm we measured optical density to analyse spectromat-
the nanoparticles synthesis were of analytical grades and they pur-
ically for purification and quantification of RNA.
chased from Hi Media Laboratories Pvt. Ltd. Mumbai, India. MTT
DCt = Ct values of interest genes – Ct values of GAPDH gene
test assay was obtained from Invitrogen, USA and acridine orange,
DDCt – DCt of control – DCt of sample
ethidium bromide and all other fine chemicals were obtained from
RQ = 2 – DDCt
Sigma Aldrich, St. Louis, USA.
Quantitative RT-PCR was performed using the manufacturer’s
instructions using specific primers (Table 1) and the SYBRÒPremix
2.3. Nanoparticles synthesis Ex TaqTM II (TaKaRa, Japan). Initial activation at 95 °C for 5 min, 40
cycles of 95 °C for 15 s and 60 °C for 1 min. The thermal cycling
1 mM of aqueous copper sulphate solution incubated at room condition is as follows. Each run did not include template controls.
temperature for overnight under dark condition mixing with water Standard curves were prepared using data from serial diluted sam-
in 1:9 ratio and then fruit extracts given synthesis of copper ples to verify the reaction efficiencies for each primary set. For each
nanoparticles (PNFECuNP). After incubation, the reaction mixture primary set, melting curve analyses were also done. PCR products
color changed from light green to brown then to pink, indicating were electrophoresed to check their product size. GAPDH gene was
the formation of nanoparticles. Subsequently, the nanoparticle used as normalizer.
reaction mixture was removed and transferred into falcon tube, Relative expressions were calculated using 2
DDCt method
centrifuged at 10,000 rpm for 10 min. After centrifugation, the [20], the qPCR assays were performed in duplicate and the data
nanoparticle pellet washed with sterile distilled water for 3 times were presented as the mean ± standard error of the mean.
to remove impurities. Then it dried and stored at
4°C for further
characterization and cancer therapy experimental study. 2.8. MTT assay

2.4. Characterizations of P. neplensis fruit extract CuNPs Cytotoxicity of copper nanoparticles determined using MTT
assay on cancerous MCF-7 cell lines, as described by Mosmann
The formation of Prunus nepalensis fruit extract mediated [21]. The cells (5x105 cells per well) were plated for 24 h in
CuNPs confirmed with processing by various analytical techniques 200 mL of DMEM supplemented with 10% FBS in 24-well plates.
like UV–Visible Spectroscopy (Shimadzu UV-1800 PC, Japan) To avoid nanoparticle agglomeration, different concentrations of
between the wavelengths of 450–700 nm. the samples (control, 100 g/ml, and 200 g/ml) in 0.1 percent DMSO
The Scherrer formula used to calculate the particle size determi- were sonicated for 15 min at room temperature using a sonicator
nation using the formula, D = Kk/bCosh where D is the particle size, bath and incubated for 48 h at 37C° in an incubator under 5%
2
Samuel Shiferaw Biresaw and P. Taneja Materials Today: Proceedings xxx (xxxx) xxx

Table 1
Primers sequence of gene mRNA.

Gene-mRNA/primers Primer Sequence F&R Temp Size of PCR product (in bp)
Ras TTGCCTTCTAGAACAGTAGACACG F 60 250
TGTCTTTGCTGAGGTCTCAATG R 61
Caspase 3 TAAGCCATGGTGATGAAGGG F 60 300
GGCAGTAGTCGCCTCTGAAG R 61
Myc CCTGACGACGAGACCTTCAT F 59 400
GCTTCTCCGAGACCAGCTT R 60
GADPH CAATGCCTCCTGCACCACCA F 60 250
TCCACCACTGACACGTTGGC R 60
P53 TGTGCACGTACTCTCCTCCC F 61 250
CTTCTGTACGGCGGTCTCTC R 60
P21 (CDKN2a) ACTGGAGGGTGACTTCGCCT F 60 250
TCCACCTGGGGACCCTTCAG R 60
P14/P19 GGGGTCGGGTAGAGGAGGTG F 60 250
CCACCAGCGTGTCCAGGAAG R 60

CO2. After treatment, the cells were incubated with MTT (100L) for 3. Results & discussion
4 h at 37°Celsius, and the formazan crystals that formed were dis-
solved in 100 mL dimethylsulfoxide (DMSO). 3.1. Synthesis of copper nanoparticles
Viability of the cells was determined by measuring the absor-
bance at 570 nm in a multiwell ELISA plate reader. The % cell via- Using green route method, copper nanoparticles were made
bility was evaluated using the following equation: from an aqueous extract of prunus nepalensis fruit. The colour
changes before and after incubation demonstrated the formation
of copper nanoparticles in the reaction medium.
A570nm of exposed cells Copper sulphate (CuSO4).H2O and extract from Prunus
Cell viability ¼  100
A570nm of control cells nepalensis fruits used for synthesis of Cu-NPs. The change in colour
The experiment was carried out in triplicate and the half max- of the mixture from light pink to (Fig. 1f) to intense pink was
imal inhibitory concentration (IC50) for MCF-7 and CuNPs was cal- absorbed in the first 20 min, indicating the formation of NPs. Cu-
culated from a dose response curve (log concentration versus NPs exhibit characteristic surface plasmon resonance (SPR), which
absorbance at 570 nm) using nonlinear regression with GraphPad results in this changing process. The pick absorptivity at 580 nm
Prism 7.04 (GraphPad Inc.) observed in the UV–Vis spectroscopy record confirmed the
extract’s reduction (Fig. 2) [22].

4. Characterization of Cu nanoparticles from P. nepalensis fruit

2.9. Statistical analysis extract

‘‘Results expressed as mean standard deviation (SD) of three 4.1. UV–Vis spectra analysis
replicates and were subjected to analysis of variance (ANOVA).
The data were analysed using GraphPad Prism version 7.04 on The UV–Vis spectroscopy reading recorded from the Prunus
the basis of one-way ANOVA after a Dunn post hoc analysis nepalensis fruit extract nanoparticle solution showed the charac-
(GraphPad Software, La Jolla, CA, USA). Mean results ± SE have been teristic surface plasmon resonance (SPR) spectra with absorbance
expressed. Significant differences at P < 0.05 have been at 450–700 nm and peak maximum at 580 nm (Fig. 2) which is
considered.” attributed to the formation of Cu nanoparticles. The formation of

Fig. 1. Graphical presentation of CuNP synthesis from P. nepalensis fruit extract; (a) P. nepalensis fruit, (b) fruit powder and (c) aqueous solution of synthesized fruit extract,
(d) Copper sulphate (e) aqueous solution of CuSO4H2O (f) synthesized CuNP.

3
Samuel Shiferaw Biresaw and P. Taneja Materials Today: Proceedings xxx (xxxx) xxx

the copper nanoparticle was considered successful by initial The FTIR spectrum of P. nepalensis fruit extract showed the
change in colour. CuNPs exhibited pink colour in the solution bands at 3403.92, 1593.71, 1384.69, 1126.67 and 1046.56 cm
1
due to excitation of surface plasmon vibration in CuNPs. The exact and synthesized nanoparticles at 3424.94, 2918.51, 2849.8,
position of the SPR band may shift depending on the individual 1654.94, 1106.04 and 617.43 cm
1 (Fig. 3, a &b).
particle properties including size, shape, and capping agents. The FT-IR spectra showed the presence of different functional
Fig. 2 shows the results. groups like Alkane (CAH stretch, ACAH bending), alcohol (OH
stretch H-bonded, free), Alkene (@CH bending, C@C stretch) Amine
4.2. Fourier Transform InfraRed (FT-IR) spectrum analysis (CAN, stretch) Nitro-compounds (N-O stretch) Acid (OH, stretch)
and Ester (CO, stretch). These functional groups contribute for
FT-IR used to investigate the interaction between copper salt the synthesis of copper nanoparticles formation.
and phytochemicals of P. nepalensis. This method of characteriza- Stretching another band at 1126 cm
1 was attributed to SO2
tion is used to know the bioactive compounds which accounts for absorption of sulfones and 1046 cm
1 was assigned as absorption
the reduction, coating of and stabilization of the copper peaks of ACAOACA or ACAOA. Band at 617 cm
1 for CAH bend
nanoparticles. of alkynes, while band at 1106.04 cm
1, indicated the presence of
Characterization of FT-IR is used to find the molecules and their amine groups. 2850 cm
1 assigned to asymmetric stretching vibra-
functional group present in the samples. FT-IR spectra of the P. tion of CAH bond. After synthesis of copper nanoparticles by
nepalensis fruit extract and nanoparticle prepared by drying exposing the copper sulphate and P. nepalensis fruit extract there
20 mL of P. nepalensis over water bath and the synthesized was increase in the intensity at 3424 cm
1 which may be due to
nanoparticles was analysed. binding of [Cu(SO4)2]+ to AOH groups (Fig. 3).

4.3. Scanning electron microscopy

The surface morphology of P. nepalensis fruit extract nanopar-

ticle is observed using SEM (LeoSupra55, CarlZeiss, Germany) and
transmission electron microscope (TEM) (JEOLJEM2010). TEM sam-
ples are prepared on the 400 mesh copper grid coated with carbon
and the shape was shown as face centred cubic (Fig. 4A). And Par-
ticle Size is ranging from 35 to 50 nm with the average size of
42.5 nm as shown in Fig. 4B.

5. Gene expression studies with quantitative reverse

transcriptase-PCR studies

5.1. P. nepalensis fruit phytochemicals copper nanoparticels

(PNFPCuNP) induced inhibition of Ras gene expression

Cancerous cell inhibition of PNFPCuNP was evaluated on two

breast cell lines of normal and tumor i.e. MCF10 and MCF7. Both
cell lines treated with three concentration of PNFPCuNP (controlled
Fig. 2. UV –Visible analysis of Prunus nepalensis fruit extract Copper nanoparticles. 100 mg/mL and 200 mg/mL). QRT-PCR was used to measure relative

Fig. 3. FT-IR Analysis; a) FT-IR of Prunus nepalensis fruit phytochemical extracts and b) FT-IR analysis of Prunus nepalensis fruit phytochemical extracts copper nanoaprticles.

4
Samuel Shiferaw Biresaw and P. Taneja Materials Today: Proceedings xxx (xxxx) xxx

Fig. 4. Scanning Elecgtron Microscopy a) Prunus nepalensis fruit extract copper nanoparticle SEM/TEM analysis and b) Copper nanoparticles size of prunus nepalensis from
fruit extract.

gene expression of the Ras gene. As shown in Fig. 5a PNFPCuNP and disruption of this mechanism may promote proliferation of
down regulated the expression of ras gene of MCF-7 cell lines in tumors and chemoresistance [23].
dose-dependent manner. PNFPCuNP significantly inhibited prolif- Gene expression profiling is a useful tool for figuring out how
eration of MCF-7 tumor cell line at concentrations (100 mg/mL cells respond to PNFPCuNP treatment. RNA sequencing was used
and 200 mg/mL) after 72 h (P < 0.05). to examine the gene expression profiles of MCF-7 cells treated with
PNFPCuNP. When compared to the control, the PNFPCuNP showed
5.2. PNFPCuNP effect on Myc gene in MCF-7 breast cancer cells significantly higher activity in terms of gene regulation (Fig. 5).
PNFPCuNP has exhibited up-regulation of p53 apoptotic gene mar-
Copper nanoparticles have shown inhibition on Myc gene in ker (Fig. 5d) [23].
cancerous cells (MCF-7) while the normal cells were not affected P53 gene has shown higher expression in MCF-7 breast cancer
significantly. Therefore Myc genes treated with this nanoparticle cells compared to controlled cells (P < 0.05). Expression of P53
down regulated in its expression when compared to untreated gene significantly higher at 200 mg than at 100 ml (P < 0.01), this
group. PNFPCuNP showed down regulation of Myc gene expres- result showed that CuNP has effect in the dose dependent manner.
sion in MCF-7 breast cancer cells at 100 mg/mL (P < 0.05) also sig- Our results revealed that over expression of P53 gene in treated
nificantly inhibited at 200 mg/mL of PNFPCuNP at 72 h. As groups compared to normal cells treated with 100 ml and 200 mg
indicated from Fig; 5b down regulation of Myc was not going as at 72 h (P < 0.01). Fig. 5d gives an overview of the PNFPCuNP effect
per the dose – dependent manner. Actually At 200 mg/mL there on P53 gene expression in MCF7 breast cancer cells.
was a little increase of Myc gene expression.
C-Myc plays an important role in the progression of breast can- 5.5. PNFPCuNP effect on P21 gene in MCF-7 cells
cer. Our findings show that PNFPCuNP inhibited tumour growth in
MCF-7 cells by lowering the c-Myc protein level, implying that P21 gene was upregulated in treated MCF7 breast cancer cell
PNFPCuNP has therapeutic potential in the treatment of breast lines as compared to normal cells which were treated at 100 mg/
cancer. mL and 200 mg/mL PNFP-CuNP (P < 0.05) (Fig. 5e). On the other
hand, P21 was not shown any change on normal (MCF10A) human
5.3. PNFPCuNP effect on P14/P19 gene in MCF-7 breast cancer cells mammary epithelial cell line treated cell groups compared to trea-
ted cancerous cell lines (MCF-7) (Fig. 5e).
P14/P19 gene was significantly increased in MCF7 breast cancer P21gene expression showed overexpression in MCF-7 breast
cells at 100 ml and 200 mg of CuNP at 72 h (P < 0.05) with its expres- cancer cells with 100 mg/mL PNFP-CuNP at 72 h (P < 0.05), also
sion as of untreated one was not changed. It is clearly that the shown upregulation at 200 mg/mL PNFP-CuNP at 72 h (P < 0.05).
expression of P14/P19 gene significantly higher at 200 mg than at P21 gene upregulation was seen in cancerous treated cells but
100 ml (P < 0.01) CuNP in the dose dependent manner. Our results not in controlled cells. The result of PNFP-CuNP effect on P21 in
revealed over expression of P14/P19 gene in treated groups com- MCF7 breast cancer cells is shown in Fig. 5e.
pared to normal cells treated with 100 ml and 200 mg at 72 h
(P < 0.01).Fig. 5c gives an overview of the PNFPCuNP effect on 5.6. PNFPCuNP effect on Caspase 3 gene in MCF-7 breast cancer cells
P14/P19 gene regulation in MCF7 breast cancer cells.
To test the expression of caspase 3 in MCF-7 cells, 100 lg/mL
5.4. PNFPCuNP effect on P53 gene and 200 lg/mL concentrations of the PNFP-CuNP after 72 h
involved. Both concentrations led to upregulation in the expression
The tumor suppressor p53 works to incorporate several stress of caspases 3 in MCF-7 breast cancer cell lines compared to the
signals into a number of anti-proliferative responses. One of the control group and untreated group. The highest activation of mRNA
most important functions of p53 is its ability to cause apoptosis, levels of the genes observed at the 200 mg/mL concentration of
5
Samuel Shiferaw Biresaw and P. Taneja Materials Today: Proceedings xxx (xxxx) xxx

Fig. 5. Relative gene expression of a; Ras gene; Myc, p14/P19, P53, P21 and Caspase-3 treated with CuNP; Fold change effects of PNFPCuNP on both MCF-7 and MCF10A
analysed by QRT-PCR. The cells were exposed to different concentrations of CuNP for 72 h. Data are presented as the means ± SE of two different experiments. ⁄ p < 0.05,
⁄⁄p < 0.01, and ⁄⁄⁄p < 0.001 compared to control.

nanoparticles after 72 h (Fig. 5f). As we have seen from (Fig. 5f) the of P. nepalensis prevents oxidation of copper. P. nepalensis was
fold change at 200 mg/mL increased significantly as compared to reported to have weak ascorbic acid since it possesses ascorbic
the fold change at 100 mg/mL and untreated groups respectively acid, saponins and flavonoids.
(P < 0.01; P < 0.001). Because all protons present in the medium interfere with cop-
per electro-deposition at low pH ranges, P. nepalensis’ antioxidant
6. MTT assay nature prevents copper oxidation. P. nepalensis (acts as a capping
agent) was found to contain weak acidic constituents such as
6.1. Cytotoxicity analysis ascorbic acid, saponins, and flavonoids [18,25].
The fruit extract of P. nepanesis is rich in polyphenolic com-
Cytotoxicity actions of the CuNPs were studied against the MCF- pounds [17–19,26–28] has potential of antioxidant activity, so as
7 (Fig. 6) through MTT assay. Cytotoxicity activity on tumor cells to determine the role in reducing and stabilizing copper nanopar-
studied with in two concentrations (control, 100 mg/mL and ticles. Fig. 2 shows the UV–vis absorption spectrum of PNFP-
200 lg/mL) and normal cells. IC50 of the phytoconstituted CuNPs CuNPs, maximum absorbance was observed at 580 nm. SEM
observed at concentration of 158.5 lg/mL against MCF-7 cell line. images (Fig. 4A) represents cubic morphology of the particles with
This result shows that the minimum dose showed good cytotoxic average estimated particle size of 42.5 nm. FTIR analysis of P.
activity. The bar diagram of efficacy of biosynthesized copper nepalensis fruit extract showed the signals at 3403.92, 1593.71,
nanoparticles against MCF-7 (Fig. 7) cells at different 1384.69, 1126.67 and 1046.56 cm
1 while synthesized nanoparti-
concentration. cles (PNFP-CuNP) at 3424.94, 2918.51, 2849.8, 1654.94, 1106.04
and 617.43 cm
1 (Fig. 3 (A&B).
The anticancer effect of copper nanoparticles against MCF-7 cell
7. Discussion lines was performed. The results show the good cytotoxic activity
against the cancer cells (Fig. 7). The concentration of copper
In this report, the characteristic peak of UV-spec absorption was nanoparticles plays an important role in the anticancer activity.
observed at 580 nm and could be the reason formation of non- Copper nanoparticles exhibited better activity against MCF-7 in
oxidized CuNPs by the surface plasmon band of Copper colloids. that 200 mg/mL except at 100 mg/mL on Myc gene alone.
The big size distribution of CuNPs might result in the diameter of Similarly, the copper nanoparticles synthesized by broccoli had
the absorption band. P. nepalensis fruit extract was combined with shown good anticancer activity against prostate cancer cells [29],
Cu (SO4); the solution’s color gradually turned to dark pink, indi- copper nanoparticles synthesized from Quisqualis indica shown
cating that CuNPs synthesized [22,24]. promising inhibition on B16F10 melanoma cells [30]. Recently,
Because all protons present in the medium interfere with cop- [1] synthesized the copper oxide nanoparticles and reported their
per electro-deposition at low pH ranges, the antioxidant nature
6
Samuel Shiferaw Biresaw and P. Taneja Materials Today: Proceedings xxx (xxxx) xxx

Fig. 6. IC50 vale calculated from MCF-7 cell line treated with PNFE-CuNP of MTT Assay absorbance reading.

Fig. 7. Cell viability percentage of normal and tumor cell lines treated by PNFE-CuNP from MTT Assay Optical density reading.

great potential to inhibit the cell viability of human colon cancer critical. Copper nanoparticles were synthesised to meet the need
cell lines (HCT-116). for a new therapeutic treatment.
Copper nanoparticles’ cytotoxicity is caused by active physico- Cancer is known throughout the world as one of the key causes
chemical interactions of copper atoms with intracellular protein of death. Current drug-targeted therapy strategy has undeniably
functional groups, as well as nitrogen bases and phosphate groups improved the care of patients with cancer. Nevertheless, advanced
in DNA [31]. Nanoparticles with anticancer properties are known metastatic cancer remains untreatable. Therefore, safe and efficient
for their potential ability to slow down the activities of abnormally drugs for the creation of facilities and reducing costs in cancer
expressed signalling proteins, such as Akt and Ras, cytokine-based treatment must definitely be actively pursued. Cancer therapy
therapies, DNA- or protein-based vaccines against specific tumour using natural bioactive compounds is a novel way to prevent and
markers, and tyrosine kinase inhibitors that have a consistent anti- treat cancer [34,35]. In our study P. nepalensis fruit extract copper
tumor effect [32], according to a previous study [33]. nanoparticles used to elucidate expression of breast cancer cells
PNFP-CuNPs showed a clear cytotoxic effect on MCF-7 cells and through QRT-PCR analysis method of oncogenes (Ras, Myc genes)
a clear concentration response relationship (Fig. 6). 100 mg/mL and and tumour suppressor genes (P14/P19, P53, P21 and Caspase 3)
200 mg/mL of PNFP-CuNPs could inhibit the growth of MCF-7 cells. expression in MCF7, human breast carcinoma cells and MCF10A
And there were no side effect seen on mamary epitelial cells human mammary epithelial cell line.
(MCF10A). Due to this reason, 100 and 200 mg/mL of CuNPs was Copper nanoparticles characterization was carried out through
used for further study. UV–Vis spectroscopy. In our study, Copper nanoparticles formation
In this study, anticancer activity was observed and the synthe- was confirmed at 580 nm absorption band same result has been
sised copper nanoparticles inhibited breast cancer cells in a dose- seen in this study [36] and this nanoparticles used in all
dependent manner. Side effects and a high cast were reported with experiments.
some of the approved chemotherapeutic agents. As a result, devel- FTIR revealed that there was no interaction between the chem-
oping alternative medicines to combat this deadly disease is icals used in the nanoparticle preparation and the extract. The

7
Samuel Shiferaw Biresaw and P. Taneja Materials Today: Proceedings xxx (xxxx) xxx

functional groups present in the copper nanoparticles that were sity, Ethiopia for offering scholar ship and making this research to
incorporated on the p. nepalensis fruit were found to be responsi- be happened.
ble for stabilising the copper nanoparticles. The surfactants in the
solution were used to obtain the CuNPs as capping agent. The par-
ticle size would fall within the micron, without the presence of References
capping agents, which may be due to the agglomeration or forma-
[1] V. Gnanavel, V. Palanichamy, S.M. Roopan, Biosynthesis and characterization of
tion of copper nanoparticles aggregates [25]. copper oxide nanoparticles and its anticancer activity on human colon cancer
Given the increasing importance of environmental protection in cell lines (HCT-116), J. Photochem. Photobiol. B 171 (2017) 133–138.
recent years, the development of green nanoparticle synthesis [2] A. Altemimi, N. Lakhssassi, A. Baharlouei, D.G. Watson, D.A. Lightfoot,
Phytochemicals: Extraction, Isolation, and Identification of Bioactive
techniques is critical. For this purpose, bacteria, fungi, and plant
Compounds from Plant Extracts, Plants (Basel) 6(4) (2017).
extracts were used to make nanoparticles [37]. [3] R.A. Hussein, A.A. El-Anssary, Plants Secondary Metabolites: The Key Drivers of
A small change in the absorption frequencies of copper the Pharmacological Actions of Medicinal Plants, Herbal Medicine 2019.
[4] H. Yuan, Q. Ma, L.i. Ye, G. Piao, The traditional medicine and modern medicine
nanoparticles spectra has indicated an association between copper
from natural products, Molecules 21 (5) (2016) 559, https://doi.org/
and alcoholic, carboxylic groups, so it can be inferred that phenolic, 10.3390/molecules21050559.
aromatic, and acidic fruit extract is responsible for oxidising and [5] R.C.D.a.C.S.M. Akshada Amit Koparde, Natural Products in Drug Discovery,
stabilising CuNPs. The mechanism of plant extract nanoparticles 2019.
[6] J.B. Calixto, The role of natural products in modern drug discovery, An. Acad.
(CuNPs) synthesis is still fully unknown. Phenolic compounds, gly- Bras Cienc. 91 (Suppl 3) (2019) e20190105.
cosides, flavonoids, amino acids, alkaloids, saccharides, and tannins [7] R. Khateef, H. Khadri, A. Almatroudi, S.A. Alsuhaibani, S.A. Mobeen, R.A. Khan,
are likely to be involved in this process, which may reduce Cu Potential in-vitro anti-breast cancer activity of green-synthesized silver
nanoparticles preparation against human MCF-7 cell-lines, Adv. Nat. Sci.:
metal to CuNPs [38]. Nanosci. Nanotechnol. 10 (4) (2019) 045012.
CuNPs stop cells from growing by interacting with membrane [8] Y.-H. Wang, S. Liu, G. Zhang, C.-Q. Zhou, H.-X. Zhu, X.-B. Zhou, L.-P. Quan, J.-F.
proteins and triggering signalling pathways. These nanoparticles Bai, N.-Z. Xu, Knockdown of c-Myc expression by RNAi inhibits MCF-7 breast
tumor cells growth in vitro and in vivo, Breast Cancer Res. 7 (2) (2004) R220.
can also enter cells via diffusion or endocytosis, accumulating in [9] C.-Y. Huang, D.-T. Ju, C.-F. Chang, P. Muralidhar Reddy, B.K. Velmurugan, A
the mitochondria, where they cause mitochondrial dysfunction review on the effects of current chemotherapy drugs and natural agents in
and trigger apoptosis [39,40]. treating non-small cell lung cancer, Biomedicine (Taipei) 7 (4) (2017), 23 23.
[10] M. Arruebo, N. Vilaboa, B. Sáez-Gutierrez, J. Lambea, A. Tres, M. Valladares, A.
The in vitro cytotoxic activity against the MCF-7 cell line was González-Fernández, Assessment of the evolution of cancer treatment
assessed at various concentrations and compared to the untreated therapies, Cancers (Basel) 3 (3) (2011) 3279–3330.
and normal cell lines (McF10A). Copper nanoparticles were tested [11] J.B. Vines, J.-H. Yoon, N.-E. Ryu, D.-J. Lim, H. Park, Gold nanoparticles for
photothermal cancer, Therapy 7 (2019) 167.
for anticancer activity at three different concentrations: control,
[12] J.K. Patra, G. Das, L.F. Fraceto, E.V.R. Campos, M.D.P. Rodriguez-Torres, L.S.
100 g, and 200 g. Copper nanoparticles’ anticancer activity against Acosta-Torres, L.A. Diaz-Torres, R. Grillo, M.K. Swamy, S. Sharma, S.
MCF-7 increased as the concentration of copper nanoparticles Habtemariam, H.-S. Shin, Nano based drug delivery systems: recent
increased (Fig. 6). When compared to control and normal mam- developments and future prospects, J. Nanobiotechnol. 16 (1) (2018), 71 71.
[13] A.H. Azandaryani, S. Kashanian, T. Jamshidnejad-Tosaramandani, Recent
mary epithelial cells, copper nanoparticles show promising results. insights into effective nanomaterials and biomacromolecules conjugation in
Copper nanoparticles’ anticancer activity has previously been advanced drug targeting, Curr. Pharm. Biotechnol. 20 (7) (2019) 526–541.
investigated in prostate cancer cell line, human cervical carcinoma [14] S. Hashemi, Z. Asrar, S. Pourseyedi, N. Nadernejad, Green synthesis of ZnO
nanoparticles by Olive (Olea europaea), IET Nanobiotechnol. 10 (6) (2016)
cells, and B16F10 melanoma cells [1,29,30]. 400–404.
[15] M.H.S. Poor, M. Khatami, H. Azizi, Y. Abazari, Cytotoxic activity of
biosynthesized Ag nanoparticles by Plantago major towards a human breast
8. Conclusion cancer cell line, Rendiconti Lincei 28 (4) (2017) 693–699.
[16] H. Shimoshige, Y. Nakajima, H. Kobayashi, K. Yanagisawa, Y. Nagaoka, S.
Shimamura, T. Mizuki, A. Inoue, T. Maekawa, B. Xu, Formation of core-shell
The importance of green synthesised CuNPs using phytochemi- nanoparticles composed of magnetite and samarium oxide in
cals from P. nepalensis fruit extract was highlighted in this study. Magnetospirillum magneticum strain RSS-1, PLoS ONE 12 (1) (2017)
e0170932.
The method could be considered as an environmentally friendly [17] D. Chaudhuri, N.B. Ghate, S. Panja, A. Das, N. Mandal, J. Kim, Wild edible fruit of
and cost-effective approach because no reducing or capping agents Prunus nepalensis Ser. (Steud), a potential source of antioxidants, ameliorates
are required for the biosynthesis of nanoparticles. The speed of the iron overload-induced hepatotoxicity and liver fibrosis in mice, PLoS ONE 10
(12) (2015) e0144280.
reaction process, low cost, and ease of access are all advantages of
[18] T.L. Swer, K. Chauhan, Stability studies of enzyme aided anthocyanin extracts
this method. In other words, green synthesised CuNPs with an from Prunus nepalensis L, LWT 102 (2019) 181–189.
average size of 42.5 nm have the ability to inhibit cell proliferation [19] K. Vivek, S. Mishra, R.C.J.J.o.F.M. Pradhan, Characterization, Physicochemical
and induce apoptosis in MCF-7 cancer cells while having no side characterization and mass modelling of Sohiong (Prunus nepalensis L.) fruit,
12(2) (2018) 923–936.
effects in the MCF10A human mammary epithelial cell line. [20] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
This is the first study to document these findings. As a result, time quantitative PCR and the 2(-Delta Delta C(T)) method, Methods 25 (4)
following confirmation by additional tests and in vivo studies, (2001) 402–408.
[21] T. Mosmann, Rapid colorimetric assay for cellular growth and survival:
the synthesised nanoparticles could be used as a potential cancer application to proliferation and cytotoxicity assays, J. Immunol. Methods 65
treatment tool. (1) (1983) 55–63.
[22] M. Thiruvengadam, I.-M. Chung, T. Gomathi, M.A. Ansari, V. Gopiesh Khanna,
V. Babu, G. Rajakumar, Synthesis, characterization and pharmacological
Declaration of Competing Interest potential of green synthesized copper nanoparticles, Bioprocess. Biosyst.
Eng. 42 (11) (2019) 1769–1777.
[23] J.S. Fridman, S.W. Lowe, Control of apoptosis by p53, Oncogene 22 (56) (2003)
The authors declare that they have no known competing finan- 9030–9040.
cial interests or personal relationships that could have appeared [24] S. Yallappa, J. Manjanna, M.A. Sindhe, N.D. Satyanarayan, S.N. Pramod, K.
Nagaraja, Microwave assisted rapid synthesis and biological evaluation of
to influence the work reported in this paper. stable copper nanoparticles using T. arjuna bark extract, Spectrochim. Acta A
Mol. Biomol. Spectrosc. 110 (2013) 108–115.
[25] S. Shende, A.P. Ingle, A. Gade, M. Rai, Green synthesis of copper nanoparticles
Acknowledgements by Citrus medica Linn. (Idilimbu) juice and its antimicrobial activity, World J.
Microbiol. Biotechnol. 31 (6) (2015) 865–873.
[26] K. Vivek, S. Mishra, R.C. Pradhan, R. Jayabalan, Effect of probiotification with
Pankaj Taneja would like to thank Sahrda University, India and Lactobacillus plantarum MCC 2974 on quality of Sohiong juice, LWT 108
Samuel Shiferaw thanks both Sharda University and Wollo Univer- (2019) 55–60.

8
Samuel Shiferaw Biresaw and P. Taneja Materials Today: Proceedings xxx (xxxx) xxx

[27] T.L. Swer, K. Chauhan, C. Mukhim, K. Bashir, A. Kumar, Application of phytochemicals in preventing and treating cancers and their druggability,
anthocyanins extracted from Sohiong (Prunus nepalensis L.) in food (2012).
processing, Lwt 114 (2019) 108360, https://doi.org/10.1016/j. [35] H. Zubair, S. Azim, A. Ahmad, M.A. Khan, G.K. Patel, S. Singh, A.P. Singh, Cancer
lwt.2019.108360. chemoprevention by phytochemicals: nature’s healing touch, Molecules (Basel
[28] D. Agrahar-Murugkar, G. Subbulakshmi, Nutritive values of wild edible fruits, Switzerland) 22 (3) (2017) 395.
berries, nuts, roots and spices consumed by the Khasi tribes of India, Ecol. Food [36] A. Amorim, A.C. Mafud, S. Nogueira, J.R. Jesus, A.R.d. Araújo, A. Plácido, M. Brito
Nutrit. 44 (3) (2005) 207–223. Neta, M.M.M. Alves, F.A.A. Carvalho, D.D. Rufino Arcanjo, S. Braun, M.S.-P.
[29] P.R. Prasad, S. Kanchi, E.B. Naidoo, In-vitro evaluation of copper nanoparticles López, B. López-Ruiz, C. Delerue-Matos, Y. Mascarenhas, D. Silva, P. Eaton, J.R.S.
cytotoxicity on prostate cancer cell lines and their antioxidant, sensing and Almeida Leite, Copper nanoparticles stabilized with cashew gum:
catalytic activity: one-pot green approach, J. Photochem. Photobiol. B 161 Antimicrobial activity and cytotoxicity against 4T1 mouse mammary tumor
(2016) 375–382. cell line, J. Biomater. Appl. 34 (2) (2019) 188–197.
[30] R. Mukhopadhyay, J. Kazi, M.C. Debnath, Synthesis and characterization of [37] S. Ahmad, S. Munir, N. Zeb, A. Ullah, B. Khan, J. Ali, M. Bilal, M. Omer, M.
copper nanoparticles stabilized with Quisqualis indica extract: Evaluation of Alamzeb, S.M. Salman, S. Ali, Green nanotechnology: a review on green
its cytotoxicity and apoptosis in B16F10 melanoma cells, Biomed. synthesis of silver nanoparticles - an ecofriendly approach, Int. J. Nanomed. 14
Pharmacother. 97 (2018) 1373–1385. (2019) 5087–5107.
[31] E.V. Hackl, V.L. Galkin, Y.P. Blagoi, DNA interaction with biologically active [38] G. Marslin, K. Siram, Q. Maqbool, R. Selvakesavan, D. Kruszka, P. Kachlicki, G.
divalent metal ions: binding constants calculation, Int. J. Biol. Macromol. 34 (5) Franklin, Secondary metabolites in the green synthesis of metallic
(2004) 303–308. nanoparticles, Materials (Basel) 11 (6) (2018) 940, https://doi.org/
[32] D. Martins, L. Frungillo, M.C. Anazzetti, P.S. Melo, N. Durán, Antitumoral 10.3390/ma11060940.
activity of L-ascorbic acid-poly- D, L-(lactide-co-glycolide) nanoparticles [39] D.-D. Ma, W.-X. Yang, Engineered nanoparticles induce cell apoptosis:
containing violacein, Int. J. Nanomedicine 5 (2010) 77–85. potential for cancer therapy, Oncotarget 7 (26) (2016) 40882–40903.
[33] J.L. Bos, ras oncogenes in human cancer: a review, Cancer Res. 49 (1989) 4682– [40] R. Chakraborty, T. Basu, Metallic copper nanoparticles induce apoptosis in a
4689. human skin melanoma A-375 cell line, Nanotechnology 28 (10) (2017)
[34] T.O.K. Hu Wanga, Limin Shub, Zhengyuen Sub, Francisco Fuentesb, Jong-Hun 105101.
Leeb, and Ah-Ng Tony Kong,a,b, Plants against cancer: a review on natural