Received: 24 September 2018 

|  Revised: 25 October 2018 

|  Accepted: 28 December 2018

DOI: 10.1002/mgg3.578

ORIGINAL ARTICLE

Association between polymorphisms in CXCR2 gene and

preeclampsia

Hongqin Chen1*  | Yanping Zhang1*  | Li Dai1  | Yaping Song2  | 

Yanyun Wang2  | Bin Zhou2  | Rong Zhou1

1
Department of Obstetrics and
Gynecology, West China Second University
Abstract
Hospital, Sichuan University, Key Background: Preeclampsia is a serious pregnancy‐specific syndrome with incompletely
Laboratory of Birth Defects and Related understood pathogenesis. Previous study has demonstrated that the decreased CXCR2 in
Diseases of Women and Children (Sichuan
University) of Ministry of Education, preeclamptic placentas may contribute to the development of preeclampsia. The role of
Chengdu, Sichuan, PR China single nucleotide polymorphisms (SNPs) of CXCR2 gene in the pathogenesis of preec-
2
Laboratory of Molecular and Translational lampsia remains largely unexplored. Thus, we aimed to investigate the association be-
Medicine, West China Second University
tween polymorphisms of CXCR2 gene and preeclampsia in Han Chinese women.
Hospital, Sichuan University, Key
Laboratory of Birth Defects and Related Methods: Totally 481 pregnant women, including 243 controls and 238 patients
Diseases of Women and Children (Sichuan with preeclampsia were recruited. The rs1126579 and rs2230054 polymorphisms in
University) of Ministry of Education,
Chengdu, Sichuan, PR China
CXCR2 gene were tested using polymerase chain reaction‐restriction fragment length
polymorphism method.
Correspondence
Results: Significantly increased risk of preeclampsia was observed in the rs1126579
Rong Zhou, Department of Obstetrics and
Gynecology, West China Second University CC or TC/CC genotypes when compared with TT genotype (CC vs. TT: odss ratio
Hospital, Sichuan University, Chengdu, [OR] = 2.11, 95% confidence interval [CI] = 1.18–3.76, p = 0.039; TC/CC vs. TT:
Sichuan, China.
OR = 1.89, 95% CI = 1.29–2.78, p = 0.001). Markedly higher risk of preeclampsia
Email: [email protected]
was found to be associated with rs1126579 TC genotype (TC vs. TT/CC: OR = 1.48,
Funding information
National Natural Science Foundation of
95% CI = 1.04–2.12, p = 0.031). After stratification analysis, the different distribu-
China, Grant/Award Number: 81571465; tion of TC/CC genotypes was particularly significant in the severe preeclampsia
Sichuan Science and Technology Agency, group (OR = 2.15, 95% CI = 1.42–3.24, p < 0.01), the early‐onset severe preec-
Grant/Award Number: 2017FZ0067
lampsia group (OR = 1.97, 95% CI = 1.14–3.42, p = 0.013), and the late‐onset se-
vere preeclampsia group (OR = 2.29, 95% CI = 1.39–3.78, p < 0.01). Besides, TC
genotype carriers had a 1.55 fold increased risk of severe preeclampsia (95%
CI = 1.06–2.27, p = 0.022) and a 1.80 fold increased risk of late onset severe preec-
lampsia (95% CI = 1.14–2.83, p = 0.01) than those of TT/CC genotype carriers.
Conclusions: Our study suggests a genetic association between rs1126579 polymor-
phism in CXCR2 gene and increased risk of preeclampsia. These data provide a new
clue for future investigation.

KEYWORDS
CXCR2, polymorphisms, preeclampsia

*Hongqin Chen and Yanping Zhang contributed equally to this study.

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original
work is properly cited.
© 2019 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Mol Genet Genomic Med. 2019;7:e578.  |

wileyonlinelibrary.com/journal/mgg3    1 of 8
https://doi.org/10.1002/mgg3.578
 |
2 of 8       CHEN et al.

1  |   IN TRO D U C T ION between polymorphisms of CXCR2 gene and preeclampsia

in Han Chinese women.
Preeclampsia is a multisystem pregnancy‐specific disease,
affecting 5%–8% of pregnancies (Gathiram & Moodley,
2016). It is a major cause of perinatal morbidity and mor-
2  |  M ATERIAL S AND M ETHOD S
tality worldwide. Moreover, women suffered preeclampsia 2.1  | Subjects
and their offspring showed increased risk for cardiovascular
events, metabolic and mental disorders in the future (Souza The case‐control study was approved by the ethics com-
et al., 2013). The causes and pathogenic mechanisms of pre- mittee of West China Second University Hospital, Sichuan
eclampsia remain poorly defined and thereby no effective University. All the participants provided written informed
method for prevention and treatment is available. Genetic consent. Totally 481 participants were recruited from West
predisposition is thought to be an important etiological fac- China Second University Hospital during September 2010
tor. Single nucleotide polymorphisms (SNPs) in genes have and March 2015. Preeclampsia was diagnosed as systolic
been discussed, and various genes were found to be associ- blood pressure ≥140 mmHg and/or diastolic blood pres-
ated with the risk of preeclampsia (Giannakou, Evangelou, sure ≥90 mmHg on at least two occasions after 20 weeks
& Papatheodorou, 2018). It is likely that multiple genes or of gestation, association with proteinuria (>300 mg/24 hr
SNPs may contribute to the development of preeclampsia and/or 1 + on dipstick testing) (Brown, Lindheimer, Swiet,
(Giannakou et al., 2018). To fully elucidate the role of genetic Assche, & Moutquin, 2001). Severe preeclampsia was de-
factors in the pathogenesis of preeclampsia, more genetic re- fined as systolic blood pressure ≥160 mmHg and/or dias-
searches are needed. tolic blood pressure ≥110 mmHg, along with significant
Chemokines exert various pathophysiological functions proteinuria (>2 g/24 hr and/or 2 + on dipstick testing) or
via binding to their receptors. The chemokine superfamily evidence of multiorgan problems including pulmonary
is categorized into four subgroups based on the positions edema, seizures, oliguria, thrombocytopenia, liver dys-
of conserved cysteine amino acids in the N‐terminal region function, or central nervous system perturbations (Brown
(CXC, CC, CX3C and C) (Vandercappellen, Van Damme, et al., 2001). Preeclampsia was divided into early‐onset
& Struyf, 2008). CXCR2 is the receptor of the Glu‐Leu‐ disease (<34 weeks) and late‐onset disease (≥34 weeks)
Arg+ (ELR+) CXC chemokines, including CXCL1‐3 and (von Dadelszen, Magee, & Roberts, 2003). A total of
CXCL5‐8 (Vandercappellen, Van Damme, & Struyf, 2008). 238 preeclampsia patients ranging in age from 19 to 45
Importantly, CXCR2 plays critical roles in inflammation (mean ± SD, 30.26 ± 5.79) were divided into two groups,
(Boro & Balaji, 2017), immunity (Kang et al., 2016), oxi- including 197 severe cases and 41 mild cases. And 243
dative stress (Shen et al., 2013), vascularization (Strieter, normal pregnant women ranging in age from 18 to 42
Burdick, Gomperts, Belperio, & Keane, 2005), and tum- (mean ± SD, 30.42 ± 4.89) were recruited, which uncom-
origenesis (Jamieson et al., 2012). Moreover, the SNPs in plicated with gestational hypertension and proteinuria dur-
CXCR2 gene have been reported to be associated with the ing the same period.
risk of various diseases, such as acute pyelonephritis (Javor et Exclusion criteria included diabetes, heart diseases,
al., 2012), autoimmune rheumatic diseases (Salim & Xavier, chronic hypertension, kidney diseases, autoimmune diseases,
2014), coronary atherosclerosis (Nasibullin et al., 2016), and thrombophilia, multiple pregnancy, and fetal malformation.
prostate cancer (Franz et al., 2017). Gestational age was confirmed by last menstrual period and/
Previous reports have noted that CXCR2 affects im- or routine ultrasound measurements in the first trimester.
mune tolerance at the maternal fetal interface and decidual
spiral artery remodeling, and therefore may contribute to
2.2  |  DNA extraction and genotyping
preeclampsia and miscarriage (Kang et al., 2016; Pitman,
Innes, Robson, Bulmer, & Lash, 2013). Furthermore, a re- Two SNPs (rs1126579 and rs2230054) in CXCR2 gene
cent study has demonstrated that the decreased CXCR2 in (NG_052975.1) were genotyped in the present study. Genomic
preeclamptic placentas may contribute to the development DNA was extracted from 2 ml EDTA anticoagulated periph-
of preeclampsia through impairing trophoblast invasion by eral blood using DNA extraction kit (Bioteke, China) accord-
down‐regulating MMP‐2 and MMP‐9 via the Akt signaling ing to the instruction manual. Briefly, all PCR amplification
pathway (Wu et al., 2016). These findings provide direct systems were performed in a total volume of 25 μl, including
evidences that CXCR2 may be involved in the pathogenesis 2.5 μl 10 × PCR buffer, 1.5 mmol/L MgCl2, 0.15 mmol/L
of preeclampsia. However, the role of CXCR2 gene poly- dNTPs, 0.5 mmol/L each primer, 100 ng of genomic DNA,
morphism in the development of preeclampsia remains and 1U of Taq DNA polymerase. The investigated DNA se-
unexplored. Thus, we aimed to investigate the association quences were amplified by the following primers: forward
CHEN et al.   
|
    3 of 8

5′‐CAAGATTCTAGCTATACATGGCTTG‐3′ and reverse a case‐control pattern, assuming codominant, dominant, re-

5′‐AAGAACGTGGCCTC GTCT‐3′ for rs1126579; for- cessive, overdominant, or log‐additive genetic models were
ward 5′‐TACTCATCCAATGTTAGCCC‐3′ and reverse 5′‐ performed using SNPstats online software (www.snpstats.
CCAGGTTGTAGGGCAGCCTGC‐3′ for rs2230054. net/start.htm) (Sole, Guino, Valls, Iniesta, & Moreno, 2006).
The PCR conditions were initial denaturation at 94°C Chi‐square test was performed to evaluate the differences of
for 4 min, 33 circles for denaturation of 30 s at 94°C, fol- the allele and genotype frequencies. Odds ratio (OR) and re-
lowed by annealing 30 s at 57°C for rs1126579 and 60°C spective 95% confidence intervals were reported to evaluate
for rs2230054, with a final elongation at 72°C for 10 min. the effects of any difference between alleles and genotypes. p
PCR products were digested by specific restriction enzymes values less than 0.05 were considered statistically significant.
(ACCI for rs1126579 and PSTI for rs2230054) at 37°C for
overnight in a reaction volume of 10 μl.
3  |  RESULTS
2.3  |  Restriction fragment length
The two entire SNPs in our study were successfully geno-
polymorphism analysis
typed in 238 patients with preeclampsia and 243 control
Digested products were separated by a 6% polyacrylamide subjects. Genotype distributions of the two polymorphisms
gel and stained with 1.5 g/L argent nitrate: for rs1126579, were consistent with Hardy–Weinberg equilibrium in control
allele T is cuttable, emerging two fragments of 18 bp and group (p = 0.67 for rs1126579; p = 0.053 for rs2230054). As
233 bp, allele C is uncuttable and the fragment is still 251 bp shown in Table 1, significantly increased risk of preeclamp-
(Figure 1). For rs2230054, allele C is cuttable, yielding two sia was observed to be associated with C allele of rs1126579
fragments of 18 bp and 229 bp, allele T is uncuttable and the polymorphism (p = 0.03, OR = 1.48, 95% CI = 1.14–1.92).
fragment is still 247 bp (Figure 2). For quality control, about Women with preeclampsia were further divided into
10% of the samples were randomly selected to perform re- four subgroups: severe preeclampsia (197 cases), mild pre-
peated assays and the results were 100% concordant. eclampsia (41 cases), early‐onset severe preeclampsia (83
cases), and late‐onset preeclampsia (114 cases). Relative to
the controls, an association with rs1126579 polymorphism
2.4  |  Statistical analysis
was observed in women with severe preeclampsia (p = 0.03,
All data were analyzed using SPSS 19.0 (SPSS Inc, Chicago, OR = 1.48, 95% CI = 1.14–1.92), but not mild preeclampsia
IL). Allele and genotype frequencies of rs1126579 and (p = 0.95, OR = 1.02, 95% CI = 0.62–1.66). Significantly
rs2230054 polymorphisms were obtained by direct com- increased risk of early‐onset preeclampsia was also identified
puting and the Pearson's chi‐square test was used to test to be associated with C allele of rs1126579 polymorphism
Hardy–Weinberg equilibrium. Genotypic association tests in (p = 0.006, OR = 1.65, 95% CI = 1.15–2.36), while the
difference was also found between late‐onset preeclampsia

F I G U R E 1   Polymerase chain reaction‐restriction fragment F I G U R E 2   Polymerase chain reaction‐restriction fragment

length polymorphism analysis of rs1126579 polymorphism of the length polymorphism analysis of rs2230054 polymorphism of the
CXCR2 gene. Lane M shows the size markers. 1, 3, 7: TT genotype CXCR2 gene. Lane M shows the size markers. 1, 2, 6: CC genotype
(233 bp); 2, 8: CC genotype (251 bp); 4, 5, 6, 9, 10: TC genotype (229 bp); 7: TT genotype (247 bp); 3, 4, 5, 8, 9, 10: TC genotype
(251/233 bp) (247/229 bp)
 |
4 of 8       CHEN et al.

T A B L E 1   Allele frequencies of these two SNPs in women with and without preeclampsia
Allele

T (%) C (%) OR (95% CI) p Value

rs1126579
Control 316 (65.0) 170 (35.0)
PE 265 (55.7) 211 (44.3) 1.48 (1.14–1.92) 0.03
PE
SPE 212 (53.8) 182 (46.2) 1.60 (1.22–2.10) 0.001
MPE 53 (64.6) 29 (35.4) 1.02 (0.62–1.66) 0.95
SPE
Early‐onset 88 (53.0) 78 (47.0) 1.65 (1.15–2.36) 0.006
Late‐onset 124 (54.4) 104 (45.6) 1.56 (1.32–2.15) 0.006
rs2230054
Control 134 (28) 352 (72)
PE 147 (31) 329 (69) 1.17 (0.84–1.55) 0.26
PE
SPE 122 (31.0) 272 (69.0) 1.18 (0.88–1.58) 0.27
MPE 25 (30.5) 57 (69.5) 1.15 (0.69–1.92) 0.58
SPE
Early‐onset 51 (30.7) 115 (69.3) 1.17 (0.79–1.71) 0.44
Late‐onset 71 (31.1) 157 (68.9) 1.19 (0.84–1.68) 0.33
Note. Bold faced values indicate a significant difference at the 5% level.
PE: preeclampsia; MPE: mild preeclampsia; SPE: severe preeclampsia.

and controls (p = 0.006, OR = 1.56, 95% CI = 1.32–2.15). polymorphism has been detected between patients and con-
However, our data indicated no significant difference in the trol (p > 0.05, Table 4).
allele frequencies of rs2230054 polymorphism between pa-
tients and control (Table 1).
As shown in Table 2, significantly increased risk of pre- 4  |  DISCUSSION
eclampsia was found to be associated with the CC genotype of
rs1126579 polymorphism in a codominant model, compared Preeclampsia is a complex pregnancy‐specific hyperten-
with TT genotype (p = 0.0039, OR = 2.11, 95%CI = 1.18– sive syndrome and poses a serious threat to maternal and
3.76). Compared with TT genotype, markedly increased fetal health. Genetic factors are believed to be involved
risk of preeclampsia was associated with the TC/CC gen- in the development of preeclampsia (Chesley & Cooper,
otypes in a dominant model (p = 0.001, OR = 1.89, 95% 1986; Morgan, 2013). CXCR2, the receptor of the CXC
CI = 1.29–2.78). Moreover, TC genotype carriers had a 1.48 chemokines, is identified to contribute to the pathogenesis
fold increased risk of preeclampsia (95% CI = 1.04–2.12, of preeclampsia. However, little is known about the possible
p = 0.031) than that of TT/CC genotypes carriers. There impact of CXCR2 gene polymorphism on the development of
were no significant differences observed between rs2230054 preeclampsia.
polymorphism and risk of preeclampsia (p > 0.05, Table 2). Our study aimed to analyze the influence of CXCR2
As shown in Table 3, significant differences were iden- polymorphisms on the predisposition of preeclampsia. Two
tified between severe preeclampsia and the controls under possible variation sites of CXCR2 were identified, includ-
dominant (p < 0.01) and overdominant (p = 0.022) model. ing one 3′ untranslated region (rs1126579) and one exon
Similar results were observed in the late‐onset group under (rs2230054) sequence. The rs1126579 polymorphism has
dominant (p < 0.01), and overdominant (p = 0.022) models. been reported to be associated with the susceptibility of
Significantly increased risk of early‐onset preeclampsia was lung cancer (Wang et al., 2017), septic shock (Cardoso et
also identified to be associated with the TC/CC genotypes al., 2015), colorectal cancer (Slattery & Lundgreen, 2014),
in a recessive model (p = 0.013, OR = 1.97, 95% CI = 1.14– and biliary tract cancers and stones (Hsing et al., 2008),
3.42) compared with the TT genotype. However, no sig- and the rs2230054 polymorphism has been reported to be
nificant association in genotype frequencies of rs2230054 associated with the risk for colorectal cancer (Gerger et
CHEN et al.   
|
    5 of 8

T A B L E 2   Genotype frequencies of SNPs in CXCR2 between patients and controls and their association with preeclampsia risk

Patients control Logistic regression

Genetic model Genotype N = 238 (%) N = 243 (%) OR (95% CI) p Value
rs1126579
Codominant TT 65 (27.3%) 101 (41.6%) 1.00 (reference)
TC 135 (56.7%) 114 (46.9%) 1.84 (1.23–2.74)
CC 38 (16%) 28 (11.5%) 2.11 (1.18–3.76) 0.0039
Dominant TT 65 (27.3%) 101 (41.6%) 1.00 (reference)
TC/CC 173 (72.7%) 142 (58.4%) 1.89 (1.29–2.78) 0.001
Recessive TT/TC 200 (84%) 215 (88.5%) 1.00 (reference)
CC 38 (16%) 28 (11.5%) 1.46 (0.86–2.47) 0.16
Overdominant TT/CC 103 (43.3%) 129 (53.1%) 1.00 (reference)
TC 135 (56.7%) 114 (46.9%) 1.48 (1.04–2.12) 0.031
Log‐additive — — — 1.54 (1.17–2.03) 0.0019
rs2230054
Codominant CC 101 (42.4%) 121 (49.8%) 1.00 (reference)
TC 127 (53.4%) 110 (45.3%) 1.38 (0.96–2.00)
TT 10 (4.2%) 12 (4.9%) 1.00 (0.42–2.41) 0.21
Dominant CC 101 (42.4%) 121 (49.8%) 1.00 (reference)
TC/TT 137 (57.6%) 122 (50.2%) 1.35 (0.94–1.93) 0.11
Recessive CC/TC 228 (95.8%) 231 (95.1%) 1.00 (reference)
TT 10 (4.2%) 12 (4.9%) 0.84 (0.36–1.99) 0.7
Overdominant CC/TT 111 (46.6%) 133 (54.7%) 1.00 (reference)
TC 127 (53.4%) 110 (45.3%) 1.38 (0.97–1.98) 0.076
Log‐additive — — — 1.22 (0.89–1.66) 0.21
Note. Bold faced values indicate a significant difference at the 5% level.
CXCR2 gene version number: NG_052975.1.

al., 2011) and biliary tract cancers and stones (Hsing et al., American and Japanese populations (Ryan et al., 2015)
2008). To the best of our knowledge, no studies have exam- and biliary tract cancers and stones in Chinese population
ined the role of CXCR2 polymorphisms in the development (Hsing et al., 2008). Cardoso et al. (2015) also proposed
of preeclampsia before. that the C allele of rs1126579 polymorphism was found to
Our study found that significantly increased risk of pre- be associated with higher risk of septic shock. However,
eclampsia was identified to be associated with C allele of some studies suggested that CC genotype carriers of
rs1126579 polymorphism. We provided primary evidences rs1126579 polymorphism displayed decreased risk of col-
that CC and TC/CC genotypes (compared with TT gen- orectal cancer (Slattery & Lundgreen, 2014; Bondurant et
otypes) of rs1126579 polymorphism were more frequent al., 2013), hepatitis C virus infection (Zang et al., 2018),
in patients with severe preeclampsia. Moreover, TC/CC and stroke (Timasheva, Nasibullin, & Mustafina, 2015).
genotypes (compared with TT genotype) and TC genotype Ni et al. (2017) showed that rs1126579 polymorphism was
(compared with TT/CC genotypes) were more frequent not associated with periodontitis susceptibility in Chinese
in patients with severe preeclampsia or late onset severe population. These inconsistent findings are possibly due to
preeclampsia. Similar, TC/CC genotypes (compared with ethnic difference and different types of diseases. Further
TT genotype) were more frequent in patients with early studies are necessary to verify this genetic association.
onset severe preeclampsia. These findings suggested that Our study did not show any differences in the allele
rs1126579 polymorphism turned out to be a risk factor for and genotype frequencies of the rs2230054 polymor-
severe preeclampsia, which has not been reported before. phism between patients and controls. Current researches
Furthermore, previous studies demonstrated that CC gen- on the relationship between rs2230054 polymorphism and
otype carriers of rs1126579 polymorphism were associ- diseases are controversial. Our data were in agreement
ated with increased risk of lung cancer in both European with the studies reporting that rs2230054 polymorphism
T A B L E 3   Genotype frequencies of rs1126579 in women with and without preeclampsia
|

Rs1126579
6 of 8      

Genetic model

Dominant Recessive Overdominant

Genotype TT VS TC/CC TT/TC VS CC TT/CC VS TC

TT TC CC OR (95% CI) p Value OR (95% CI) p Value OR (95% CI) p Value

PE
SPE 49 (24.9%) 114 (57.9%) 34 (17.3%) 2.15 (1.42–3.24) <0.01 1.60 (0.93–2.75) 0.086 1.55 (1.06–2.27) 0.022
MPE 16 (39.0%) 21 (51.2%) 4 (9.8%) 1.11 (0.56–2.19) 0.76 0.83 (0.28–2.50) 0.74 1.19 (0.61–2.30) 0.61
SPE
Early‐onset 22 (26.5%) 44 (53.0%) 17 (20.5%) 1.97 (1.14–3.42) 0.013 1.98 (1.02–3.84) 0.049 1.28 (0.77–2.10) 0.34
Late‐onset 27 (23.7%) 70 (61.4%) 17 (11.9%) 2.29 (1.39–3.78) <0.01 1.35 (0.70–2.57) 0.37 1.80 (1.14–2.83) 0.01
Control 101 (41.6%) 114 (46.9%) 28 (11.5%)
Note. PE: preeclampsia; MPE: mild preeclampsia; SPE: severe preeclampsia.
Bold faced values indicate a significant difference at the 5% level.

T A B L E 4   Genotype frequencies of rs2230054 in women with and without preeclampsia

rs2230054

Genetic model

Dominant Recessive Overdominant

Genotype CC VS TC/TT CC/TC VS TT CC/TT VS TC

CC TC TT OR (95% CI) p Value OR (95% CI) p Value OR (95% CI) p Value

PE
SPE 84 (42.6%) 104 (52. 8%) 9 (4.6%) 1.33 (0.91–1.95) 0.13 0.92 (0.38–2.23) 0.86 1.35 (0.93–1.97) 0.12
MPE 17 (41.5%) 23 (56.1%) 1 (2.4%) 1.40 (0.72–2.74) 0.32 0.48 (0.06–3.80) 0.44 1.54 (0.79–3.01) 0.2
SPE
Early‐onset 35 (42.2%) 45 (54.2%) 3 (3.6%) 1.36 (0.82–2.25) 0.23 0.72 (0.20–2.62) 0.61 1.43 (0.87–2.36) 0.16
Late‐onset 49 (43.0%) 59 (51.8%) 6 (5.2%) 1.32 (0.84–2.06) 0.23 1.07 (0.39–2.93) 0.9 1.30 (0.83–2.03) 0.25
Control 121 (49.8%) 110 (45.3%) 12 (4.9%)
PE: preeclampsia; MPE: mild preeclampsia; SPE: severe preeclampsia.
CHEN et al.
CHEN et al.   
|
    7 of 8

was not associated with susceptibility of periodontitis Journal of Cancer, 132(4), 905–915. https://doi.org/10.1002/
in Chinese population and prosthetic joint infection in ijc.27660
Czech population (Ni et al., 2017; Navratilova, Gallo, Boro, M., & Balaji, K. N. (2017). CXCL1 and CXCL2 Regulate
NLRP3 inflammasome activation via G‐protein‐coupled receptor
Mrazek, & Petrek, 2012). However, Hsing et al. (2008)
CXCR1. Journal of Immunology, 199(5), 1660–1671. https://doi.
discovered that TT genotype carriers of rs2230054 poly- org/10.4049/jimmunol.1700129
morphism showed increased risk of biliary tract cancers Brown, M. A., Lindheimer, M. D., Swiet, M. D., Assche, A. V., &
and stones in Chinese population. Some reasons referring Moutquin, J. M. (2001). The classification and diagnosis of the hy-
ethnic difference and different types of diseases may con- pertensive disorders of pregnancy: statement from the International
tribute to the inconsistent results. Further investigation Society for the Study of Hypertension in Pregnancy (ISSHP).
is required. Hypertension in Pregnancy, 20(1), IX–XIV. https://doi.org/10.1081/
We should point out that one strength of the present study PRG-100104165
Cardoso, C. P., de Oliveira, A. J., Botoni, F. A., Rezende, I. C.
is its genetic homogeneity of the study population, including
P., Alves‐Filho, J. C., Cunha, F., … Rios‐Santos, F. (2015).
individuals only from the Sichuan province with the same
Interleukin‐10 rs2227307 and CXCR5 rs1126579 polymor-
genetic background of Han Chinese. However, some limita- phisms modulate the predisposition to septic shock. Memórias
tions deserve our consideration. We were unable to measure do Instituto Oswaldo Cruz, 110(4), 453–460. https://doi.
the plasma CXCR2 protein levels for its nonsecretion into org/10.1590/0074-02760150003
the blood circulation. Hence, there is a lack of direct bio- Chesley, L. C., & Cooper, D. W. (1986). Genetics of hypertension in preg-
chemical/functional evidence of CXCR2 polymorphism with nancy: Possible single gene control of pre‐eclampsia and eclamp-
altered protein levels. No genotyping was performed in the sia in the descendants of eclamptic women. Bjogan International
placentas of these participants. Besides, the relatively small Journal of Obstetrics & Gynaecology, 93(9), 898–908. https://doi.
org/10.1111/j.1471-0528.1986.tb08006.x
study sample size should be recognized. Thus, further inves-
Franz, J. M., Portela, P., Salim, P. H., Berger, M., Fernando Jobim, L.,
tigations are warranted to complement our results and illumi-
Roesler, R., … Schwartsmann, G. (2017). CXCR6 +1208 CT gen-
nate the relationship between CXCR2 gene variation and the otype may predict earlier clinical stage at diagnosis in patients with
development of preeclampsia. prostate cancer. Cytokine, 97, 193–200. https://doi.org/10.1016/j.
In conclusion, we firstly described the genetic association cyto.2017.06.001
between rs1126579 polymorphism in CXCR2 gene and in- Gathiram, P., & Moodley, J. (2016). Pre‐eclampsia: Its pathogenesis and
creased risk of preeclampsia, while there is no association pathophysiolgy. Cardiovascular Journal of Africa, 27(2), 71–78.
between rs2230054 polymorphism and the disorder. Whether https://doi.org/10.5830/CVJA-2016-009
the rs1126579 variation has a possible link with potential Gerger, A., El‐khoueiry, A., Zhang, W., Yang, D., Singh, H., Bohanes,
P., … Lenz, H. J. (2011). Pharmacogenetic angiogenesis profiling for
changes in the function of CXCR2‐associated pathways in pa-
first‐line bevacizumab plus oxaliplatin‐based chemotherapy in patients
tients with preeclampsia remains to be explored in the future. with metastatic colorectal cancer. Clinical Cancer Research, 17(17),
5783–5792. https://doi.org/10.1158/1078-0432.CCR-11-1115
ACKNOWLEDGMENTS Giannakou, K., Evangelou, E., & Papatheodorou, S. I. (2018). Genetic
and non‐genetic risk factors for pre‐eclampsia: Umbrella review
This work was supported by the National Natural Science of systematic reviews and meta‐analyses of observational studies.
Foundation of China (NO. 81571465), Key Research and Ultrasound in Obstetrics & Gynecology, 51(6), 720–730. https://
Development Program of Sichuan Science and Technology doi.org/10.1002/uog.18959
Agency (NO. 2017FZ0067). The authors have nothing to Hsing, A. W., Sakoda, L. C., Rashid, A., Andreotti, G., Chen, J., Wang,
B. S., … Chanock, S. J. (2008). Variants in inflammation genes
disclose.
and the risk of biliary tract cancers and stones: A population‐based
study in china. Cancer Research, 68(15), 6442–6452. https://doi.
CONFLICT OF INTEREST org/10.1158/0008-5472.CAN-08-0444
Jamieson, T., Clarke, M., Steele, C. W., Samuel, M. S., Neumann, J.,
The authors declare that they have no competing interests. Jung, A., Sansom, O. J. (2012). Inhibition of CXCR11 profoundly
suppresses inflammation‐driven and spontaneous tumorigenesis.
Journal of Clinical Investigation, 122(9), 3127–3144. https://doi.
ORCID org/10.1172/JCI61067
Javor, J., Bucova, M., Cervenova, O., Kralinsky, K., Sadova, E.,
Rong Zhou  https://orcid.org/0000-0002-6236-7049
Suchankova, M., & Liptakova, A. (2012). Genetic variations of in-
terleukin‐8, CXCR12 and CXCR12 genes and risk of acute pyelone-
phritis in children. International Journal of Immunogenetics, 39(4),
R E F E R E NC E S
338–345. https://doi.org/10.1111/j.1744-313X.2012.01096.x
Bondurant, K. L., Lundgreen, A., Herrick, J. S., Kadlubar, S., Wolff, Kang, X., Zhang, X., Liu, Z., Xu, H., Wang, T., He, L., & Zhao, A.
R. K., & Slattery, M. L. (2013). Interleukin genes and associations (2016). CXCR13‐mediated granulocytic myeloid‐derived sup-
with colon and rectal cancer risk and overall survival. International pressor cells' functional characterization and their role in maternal
 |
8 of 8       CHEN et al.

fetal interface. DNA and Cell Biology, 35(7), 358–365. https://doi. Sole, X., Guino, E., Valls, J., Iniesta, R., & Moreno, V. (2006). SNPStats:
org/10.1089/dna.2015.2962 A web tool for the analysis of association studies. Bioinformatics,
Morgan, L. (2013). Update on genetics of pre‐eclampsia. 22(15), 1928–1929. https://doi.org/10.1093/bioinformatics/btl268
Pregnancy Hypertension, 3(2), 59–60. https://doi.org/10.1016/j. Souza, J. P., Gülmezoglu, A. M., Vogel, J., Carroli, G., Lumbiganon, P., &
preghy.2013.04.009 Qureshi, Z.,…Say, L., (2013). Moving beyond essential interventions
Nasibullin, T. R., Yagafarova, L. F., Yagafarov, I. R., Timasheva, for reduction of maternal mortality (the WHO Multicountry Survey
Y. R., Erdman, V. V., Tuktarova, I. A., & Mustafina, O. E. on Maternal and Newborn Health): A cross‐sectional study. Lancet,
(2016). Association of polymorphic markers of chemokine 381(9879), 1747–1755. https://doi.org/10.1016/S0140-6736(13)60686-8
genes, their receptors, and CD14 gene with coronary athero- Strieter, R. M., Burdick, M. D., Gomperts, B. N., Belperio, J. A., &
sclerosis. Genetika, 52(8), 966–974. https://doi.org/10.1134/ Keane, M. P. (2005). CXC chemokines in angiogenesis. Cytokine &
S1022795416060090 Growth Factor Reviews, 16(6), 593–609. https://doi.org/10.1016/j.
Navratilova, Z., Gallo, J., Mrazek, F., & Petrek, M. (2012). Genetic cytogfr.2005.04.007
variation in key molecules of the Th‐17 immune response is not Timasheva, Y. R., Nasibullin, T. R., & Mustafina, O. E. (2015). The
associated with risk for prosthetic joint infection in a Czech popu- CXCR26 gene polymorphism is associated with stroke in patients
lation. Biomedical Papers of the Medical Faculty of the University with essential hypertension. Cerebrovascular Diseases Extra, 5(3),
Palacký, Olomouc, Czechoslovakia, 156(3), 248–252. https://doi. 124–131. https://doi.org/10.1159/000441529
org/10.5507/bp.2012.023 Vandercappellen, J., Van Damme, J., & Struyf, S. (2008). The role of
Ni, X. B., Jia, C., Yu, H. D., Li, Y. Q., Zeng, X. T., & Leng, W. D. CXC chemokines and their receptors in cancer. Cancer Letters,
(2017). Comprehensive analysis of interleukin‐8 gene polymor- 267(2), 226–244. https://doi.org/10.1016/j.canlet.2008.04.050
phisms and periodontitis susceptibility. Oncotarget, 8(30), 48996– Von, D. P., Magee, L. A., & Roberts, J. M. (2003). Subclassification of
49004. https://doi.org/10.18632/oncotarget.16922 preeclampsia. Hypertension in Pregnancy, 22(2), 143–148. https://
Pitman, H., Innes, B. A., Robson, S. C., Bulmer, J. N., & Lash, G. E. (2013). doi.org/10.1081/PRG-120021060
Altered expression of interleukin‐6, interleukin‐8 and their receptors in Wang, J., Liu, Q., Yuan, S., Xie, W., Liu, Y., Xiang, Y., … Li, Y. (2017).
decidua of women with sporadic miscarriage. Human Reproduction, Genetic predisposition to lung cancer: Comprehensive literature in-
28(8), 2075–2086. https://doi.org/10.1093/humrep/det233 tegration, meta‐analysis, and multiple evidence assessment of candi-
Ryan, B. M., Robles, A. I., McClary, A. C., Haznadar, M., Bowman, date‐gene association studies. Scientific Reports, 7(1), 8371. https://
E. D., Pine, S. R., … Harris, C. C. (2015). Identification of a func- doi.org/10.1038/s41598-017-07737-0
tional SNP in the 3' UTR of CXCR19 that is associated with reduced Wu, D., Hong, H., Huang, X., Huang, L., He, Z., Fang, Q., & Luo, Y.
risk of lung cancer. Cancer Research, 75(3), 566–575. https://doi. (2016). CXCR29 is decreased in preeclamptic placentas and pro-
org/10.1158/0008-5472.CAN-14-2101 motes human trophoblast invasion through the Akt signaling pathway.
Salim, P. H., & Xavier, R. M. (2014). Influence of genetic polymorphisms Placenta, 43, 17–25. https://doi.org/10.1016/j.placenta.2016.04.016
(IL‐10/CXCL8/CXCR23/NFkappaB) on the susceptibility of auto- Zang, F., Yue, M., Zhuo, L., Wu, J., Liu, M., Yao, Y., … Yu, R. (2018).
immune rheumatic diseases. Revista Brasileira De Reumatologia, Association of CXCR31 genotype variations with HCV clearance
54(4), 301–310. https://doi.org/10.1016/j.rbre.2013.10.005 in a Chinese population. Archives of Virology, 163(10), 2711–2718.
Shen, X. H., Xu, S. J., Jin, C. Y., Ding, F., Zhou, Y. C., & Fu, G. S. https://doi.org/10.1007/s00705-018-3872-0
(2013). Interleukin‐8 prevents oxidative stress‐induced human en-
dothelial cell senescence via telomerase activation. International
Immunopharmacology, 16(2), 261–267. https://doi.org/10.1016/j. How to cite this article: Chen H, Zhang Y, Dai L, et al.
intimp.2013.04.003 Association between polymorphisms in CXCR2 gene
Slattery, M. L., & Lundgreen, A. (2014). The influence of the CHIEF and preeclampsia. Mol Genet Genomic Med.
pathway on colorectal cancer‐specific mortality. PLoS ONE, 9(12),
2019;7:e578. https://doi.org/10.1002/mgg3.578
e116169. https://doi.org/10.1371/journal.pone.0116169