Scribd Logo
Upload

Welcome to Scribd!

  • 47 views

    Lecture 3.1 (Capillary Sequencing

    Uploaded by

    eva marie
    The document provides instructions to download files related to capillary sequencing from a website. It includes 5 files under Lecture 3.1 and 3.3 that cover topics like Sanger sequencing overview, video, and illustrations. It also includes a workshop on capillary sequencing with 2 SEQ files and 2 ABI files to open and assemble in the GeneStudio software program. The document guides how to view the aligned sequences, change display settings, highlight positions, and export the consensus sequence file.

    Copyright:

    © All Rights Reserved
    Download as PPTX, PDF, TXT or read online from Scribd

    Lecture 3.1 (Capillary Sequencing

    Uploaded by

    eva marie
    47 views19 pages
    The document provides instructions to download files related to capillary sequencing from a website. It includes 5 files under Lecture 3.1 and 3.3 that cover topics like Sanger sequencing overview, video, and illustrations. It also includes a workshop on capillary sequencing with 2 SEQ files and 2 ABI files to open and assemble in the GeneStudio software program. The document guides how to view the aligned sequences, change display settings, highlight positions, and export the consensus sequence file.

    Original Description:

    capillary

    Copyright

    © © All Rights Reserved

    Available Formats

    PPTX, PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    The document provides instructions to download files related to capillary sequencing from a website. It includes 5 files under Lecture 3.1 and 3.3 that cover topics like Sanger sequencing overview, video, and illustrations. It also includes a workshop on capillary sequencing with 2 SEQ files and 2 ABI files to open and assemble in the GeneStudio software program. The document guides how to view the aligned sequences, change display settings, highlight positions, and export the consensus sequence file.

    Copyright:

    © All Rights Reserved
    Download as PPTX, PDF, TXT or read online from Scribd
    Download as pptx, pdf, or txt
    47 views19 pages

    Lecture 3.1 (Capillary Sequencing

    Uploaded by

    eva marie
    The document provides instructions to download files related to capillary sequencing from a website. It includes 5 files under Lecture 3.1 and 3.3 that cover topics like Sanger sequencing overview, video, and illustrations. It also includes a workshop on capillary sequencing with 2 SEQ files and 2 ABI files to open and assemble in the GeneStudio software program. The document guides how to view the aligned sequences, change display settings, highlight positions, and export the consensus sequence file.

    Copyright:

    © All Rights Reserved
    Download as PPTX, PDF, TXT or read online from Scribd
    Download as pptx, pdf, or txt
    of 19

    Please go to:

    https://is.gd/molbiotraining2018

    Download files under Lecture 3.1 and 3.3


    (5 files total)(click each)
    Lecture 3.1
    Capillary Sequencing
    Sanger Sequencing: Overview
    •Modern technology has advanced genetic
    studies into a new level, with the ability to
    determine the actual sequence of
    nucleotides in a DNA/RNA

    •Knowing the sequence of a DNA/RNA


    strand opens up a broad field of knowledge
    with various applications.

    • The Sanger Sequencing (also known as


    Chain-Termination Sequencing) is one of
    the earliest form of DNA sequencing
    methods, based on modified PCR and Gel
    Electrophoresis.
    Sanger Sequencing: Video
    Capillary Sequencing: Overview
    • DNA sequencing technology has
    advanced from the two-dimensional
    chromatography methods from the
    1970’s, to powerful microchip-based
    technologies in the late 2000’s.

    •Sanger Sequencing has been largely


    automated by machines, using capillary
    tubes, fluorescent tags, and advanced
    software to decrease running cost and
    increase throughput and accuracy.
    Capillary Sequencing: Illustration
    Capillary Sequencing
    • ADVANTAGES
    • Long read lengths – up to 900 base pairs, which is currently the
    3rd longest read length among current sequencing technologies.
    • Cost (up-front) – Sanger sequencing is capable of sequencing
    single PCR reactions, which is economically advantageous for
    small sequencing projects. Other sequencing methods may have
    lower cost per base, but require a large minimum number of
    bases for sequencing.

    • DISADVANTAGES
    • Cost (per base) – Although Sanger Sequencing is relatively cheap
    for small sequencing projects, the current cost per base is more
    expensive than most sequencing methods
    • Sample requirement – requires a large amount of DNA, which
    must be attained either via PCR or plasmid cloning.
    Workshop 3.1
    Capillary Sequencing
    Capillary Sequencing: Workshop
    • Go to: https://is.gd/molbiotraining2018
    • Download Workshop files 1-4 under
    Lecture 1.3
    Capillary Sequencing: Workshop
    • You will get 2 SEQ files and 2 ABI Files
    • Try opening the 2 SEQ files. What do you see?

    >PSV.PS_PSF_070.ab1
    CCARRAMTTTTGCATCATTCATGATCATTCTTTTGTTATATTACTGTCTCTGCGGCTTT
    TGGTGGTCATAGTGGTGCCAA
    CCTCATTGCATCTGACACTACTATCAATGGGTTTAGTTCTTTCTGTGTTGACACTAGA
    CAATTTACCATTACACTGTTTT
    ATAACGTTACAAACAGTTATGGTTATGTGTCTAAGTCACAGGATAGTAATTGCCCTTT
    CACCTTGCAATCTGTTAATGAT
    TACCTGTCTTTTAGCAAATTTTGTGTTTCAACCAGCCTTTTGGCTGGWGCTTGTACC
    ATAGATCTTTTTGGTTACCCTGA
    Capillary Sequencing: Workshop
    • Open GeneStudio
    • Go to Contig Editor (Left Pane under Components)
    • Click File  Import Sequences
    • Choose the 2 .ab1 files
    • PSV.PS_PSF_070.ab1
    • PSV.PS_PSR_093.ab1
    • Click Open
    • A window will appear asking if you want to assemble
    the sequence. Choose Yes  OK
    • An edit contig window will appear. Click Cancel
    Try browsing through the sequences
    Note: you are seeing an alignment of 2 sequences
    -coding strand
    -template strand
    Change Enable
    Height, Show all
    Y Scale, Enable
    X Scale Quality
    Highlight and
    change positions
    26 and 27
    …..
    •Click File Export Current Consensus
    •Name it as Psv corrected
    •Save to Desktop
    • Open your output file
    GeneStudio Sequence output (fasta file)

    You might also like