Kangen Water Intensive Scientific and Clinical Research Part 1

Enagic® – Kangen Scientific/Clinical Research
&
Alkaline Water Scientific/Clinical Research
Enagic Certifications - http://www.enagic.com/technology_certificates.php

DOCUMENTATION BEATS CONVERSATION!
You want SCIENTIFIC & CLINICAL RESEACH?
Well….Here it is, about 140 PAGES worth of scientific & clinical research.
Read all of 140 pages and if you want more email me and I’ll provide you more information.
Email at [email protected]
Brief FYI
The Enagic® – LevelLuk SD501 is recognized as a Medical Device according to The Health, Labour
and Welfare Government of Japan.
• A non-profit organization (The Association of Preventative Medicine in Japan) whose members
include over 6,500 Doctors and Surgeons, enodorse the Enagic® LevelLuk SD501.
• On April 18, 2004 Enagic® received the International Earth Environment University (IEEU)
achievement for outstanding Achievement in the environmental sciences and the Linus Pauling
International Earth Environmental Roundtable (IEER).
• Enagic® has been awarded Certificate # ISO 9001 and ISO 14001 for its most environmentally
friendly products. These are prestigious awards that recognize Enagic as a leader in REDUCING
MEDICAL COSTS IN JAPAN.
Dr. Hiromi Shinya, Inventor of the Colonascope and Non-Invasive Colon Surgery, is the
the leading Gastrointerologist in the world. Currently, he is the Chief of Endoscopy at the Beth
Israel Medical Center, NY, and the Clinical Professor of Surgery at the Albert Einstein College
of Medicine. An advisor for Maeda Hospital and Hanzomon Gastrointestinal Clinic in Japan.
Dr. Shinya prescribes Kangen Water® to ALL of his patients. Having worked with over
370,000 patients in his career (the ―hard cases‖), his patients have had a 0% recurrence of
cancer, and he dually believes that Kangen Water should be a foundational element in EVERY
HUMAN‘S DIET. Read more about this ground breaking study in his best selling book The
Enzyme Factor.
Dr. Shinya, now past 70, continues an active daily practice of medicine, spending half of each
year in New York City and the other half in Tokyo. He is Japan‘s most famous doctor and treats
members of Japan‘s royal family and top government officials. His practice in the United States
also includes celebrities and Presidents. He is Vice Chairman of the Japanese Medical
Association in the USA, and much in demand as a speaker internationally.
Nobel Prize Winner Dr. Otto – ―Cancerous tissues are acidic, whereas healthy tissues are
alkaline. Water splits into H+ and OH- ions, if there is an excess of H+, it is acidic; if there is an
excess of OH-ions, then it is alkaline.‖
Enagic® USA is now the ONLY water ionizer manufacturer on the market to receive the
exclusive Gold Seal Certification from the WQA! For info go to www.wqa.org
Enagic® Certifications - http://www.enagic.com/technology_certificates.php
Here is a quick list of topics in this intensive research
Chronic Disease And Detoxification

Anticancer Effect of Alkaline Reduced Water
Effect of Electrolyzed Water on Wound Healing
Inhibitory Effect of Electrolyzed Reduced Water on Tumor Angiogenesis
Efficacy of Electrolyzed Oxidizing Water for Inactivating Escherichia coli O157:H7, Salmonella
enteritidis, and Listeria monocytogenes
Antioxidant effects against superoxide anion radicals of reduced water produced by electrolysis
Electrolyzed–Reduced Water Scavenges Active Oxygen Species and Protects DNA from Oxidative
Damage
Preservative Effect of Electrolyzed Reduced Water on Pancreatic b –Cell Mass in Diabetic db/db Mice
Sterilization effect of electrolyzed water on rice food
Application of electrolyzed water in the food industry
Various Clinical Studies and Research on Electrolyzed-Reduced Water
Fluid replacement promotes optimal physical performance:
Electrolyzed-reduced water scavenges active oxygen species and protects DNA from
oxidative damage.
The mechanism of the enhanced antioxidant effects against superoxide anion radicals
of reduced water produced by electrolysis.
Oxygen Radical Absorbance Capacity--High- ORAC Foods May Slow Aging
Use of Ionized water in hypochlorhydria or achlorhydria
Use of Ionized water for gynecological conditions
CLINICAL Improvements Obtained From The Intake Of Reduced Water
Toxin Neutralization
Eczema
Allergies
Digestive problems
Effects of Alkaline Ionized Water on Spontaneously diabetic GK-rats fed Sucrose
Use of Ionized water in treating Acidosis
REDUCED WATER FOR PREVENTION OF DISEASES
Clinical evaluation of alkaline ionized water for abdominal complaints: Placebo
controlled double blind tests
Selective stimulation of the growth of anaerobic microflora in the human intestinal
tract by electrolyzed reducing water
Physiological effects of alkaline ionized water: Effects on metabolites produced by
intestinal fermentation
Effects of alkaline ionized water on formation & maintenance of osseous tissues
Magnesium and calcium in drinking water and cardiovascular
mortality
Evaluation of ionized calcium as a nutrient
Reduced hemodialysis-induced oxidative stress in end stage renal disease patients
by electrolyzed reduced water
Table of Contents
1. Enagic – Kangen Proof Book & Water Scientific & Clinical Research …….…. pg 6-88
2. Clinical Studies & Research on Electrolyzed Reduced Water………..………….pg 89-104
3. Clinical Studies of Alkaline Water …………………………………………..… pg 105-129
4. Clinical Studies - Clinical Reports on the Effects of Ionized Water……………..pg 130-142
5. 25th General Assembly of Japan Medical Congress –
Theme: Function of Ionized Water in Medical Treatment…………………..…..pg 143-145
Kangen Water Proof Book
Table of Contents:
Acid-Alkaline Balance: Role In Chronic

Disease And Detoxification…….……………….…………………………………………………………………………….………Page 2
Anticancer Effect of Alkaline Reduced Water……………….……………………………………………………………….Page 6
Effect of Electrolyzed Water on

Wound Healing……………….…………………………………………………………………………….……………………………...Page 9
Inhibitory Effect of Electrolyzed Reduced

Water on Tumor Angiogenesis….…………………………………………………………………….……………………..…….Page 13
Efficacy of Electrolyzed Oxidizing Water for Inactivating

Escherichia coli O157:H7, Salmonella enteritidis,
and Listeria monocytogenes………………………………………………………………………………………………………...Page 21
The mechanism of the enhanced antioxidant effects against superoxide anion radicals of reduced water produced
by electrolysis…………………………………………………………………………………………………………………………………...Page 25
Electrolyzed–Reduced Water Scavenges Active Oxygen

Species and Protects DNA from Oxidative Damage……………………………………………………………………...Page 37
Preservative Effect of Electrolyzed Reduced Water on Pancreatic b -Cell

Mass in Diabetic db/db Mice…………………………………………………………………………………………………………Page 43
Citrate therapy for polycystic kidney

disease in rats……………………………………………………………………….………………………………………………………Page 46
Sterilization effect of electrolyzed

water on rice food…………………………………………………………………….……………………………………….………...Page 57
Application of electrolyzed water

in the food industry…………………………………………………………………….……………………………………….…….…Page 60
Various Clinical Studies and Research on

Electrolyzed-Reduced Water…………………………………………………….…………………………………….….……..…Page 77
review article
ACID-ALKALINE BALANCE: ROLE IN CHRONIC

DISEASE AND DETOXIFICATION
Deanna M. Minich, Jeffrey S. Bland, PhD, FACN, CNS; PhD, FACN
Deanna M. Minich, PhD, FACN, CNS, is the Director of Over time, ingestion of a high dietary acid load can prog-
Information Integration and Innovation at Metagenics, Inc, ress to a chronic low-grade level of metabolic acidosis. The inci-
and a clinical nutritionist at the Functional Medicine dence of low-grade acidosis resulting from our modern diet has
Research Center in Gig Harbor, Wash. Jeffrey S. Bland, PhD, been well documented.1-3,6 A chronic acidic load can cause a
FACN, serves as the chief science officer of Metagenics, Inc, number of health conditions such as osteoporosis, kidney dis-
and is president of the MetaProteomics Nutrigenomics ease, and muscle wasting.1,7 Sebastian et al articulates this cause
Research Center. and effect relationship eloquently: ―Increasing evidence . . . sug-
S
gests that such persisting, albeit low-grade, acidosis, and the
everal researchers have noted that the contemporary relentless operation of responding homeostatic mechanisms,
Western diet has increased in net acid load relative to result in numerous injurious effects on the body including disso-
diets of the ancestral pre-agricultural Homo sapiens.1-3 lution to bone, muscle wasting, kidney stone formation, and
Quite possibly, this shift occurred because of the agri- damage to the kidney.‖1(p1308)
cultural revolution and the ubiquity of processed In order to maintain acid-alkaline balance throughout the
grains and shelf-stable food products devoid of essential nutri- various body systems, one system may be required to support
tional components. In addition to this underlying another. For example, the bone matrix contains a
foundational change in diet, there is the overlay of various substantial alkaline reserve such as calcium and magnesium
nutritional fads that have risen and fallen over the past few cations that are released from the bone to balance an overly
decades. Most recently, the latest diet trend has been an acidic dietary load in the event of inadequate buffering capacity
interest in high-protein foods accompanied by a compensatory in the blood. However, repeated borrowing of the body‘s alkaline
decrease in the phytochemical load from fresh fruits and reserve in response to a consistent increased (dietary) acid load
vegetables. Indeed, high-protein diets increase net dietary can be potentially detrimental. In humans, hypercalciuria and
acid load and acidify the urine pH. 2-5 negative calcium balance due to calcium efflux from bone may
Conversely, diets high in fruits and vegetables have been pro- lead to metabolic bone disease and calcium nephrolithiasis. 2,8,9
posed to be associated with a greater degree of alkalinity. 4,6 In the chapter titled ―Potassium‖ of its report Dietary
Remer and Manz calculated the potential renal acid loads of cer- Reference Intakes for Water, Potassium, Sodium, Chloride, and
tain food groups and reported that alkaline-forming foods were Sulfate, the Institute of Medicine Food and Nutrition Board states
primarily vegetable and fruits, whereas acid-forming foods were the following:
derived from cheese, meat, fish, and grain products (Table 1).4
In the setting of an inadequate intake of bicarbonate
TABLE 1 Average Potential Renal Acid Loads (PRAL) of Specified Foods4 precursors, buffers in the bone matrix neutralize the
Food PRAL* (mEq) excess diet-derived acid, and in the process, bone
Fats and oils 0
becomes demineralized. Excess diet-derived acid titrates
Fish 7.9 bone and leads to increased urinar y calcium and
Fruits and fruit juices -3.1 reduced urinary citrate excretion. The resultant adverse
Grain products 3.5-7.0 clinical consequences are possibly increased bone
Meat and meat products 9.5 demineralization and increased risk of calcium-
Milk and dairy products 1.0-23.6 containing kidney stones.7(p187)
Vegetables -2.8
Conversely, dietary modification can positively influence
*PRAL = mEq of Cl + PO4 + SO4 – Na – K – Ca – Mg) bone metabolism. A diet favoring neutralization of net
endogenous acid production increases calcium and
phosphate reten- tion, reduces bone resorption markers, and
increases markers of
Acid-Alkaline Balance ALTERNATIVE THERAPIES, jul/aug 2007, VOL. 13, NO. 4 62

bone formation in postmenopausal women.10 Furthermore, stud- dietary intervention in as little as 2 hours. Additionally, the fact
ies have demonstrated a positive association between a high that the urine pH range spans a greater continuum (4.5-8.0) indi-
intake of alkali-rich fruits and vegetables with preservation of cates that it has more potential to reflect systemic pH changes.
bone mineral density.6,11,12 From our testing, it was determined that due to the wide pH
range of the urine, it is important to take a fasting urine sample
PHYSIOLOGY OF ACID-ALKALINE BALANCE and to control for water intake during the fasting period. Intra-
From a physiological perspective, the body has compart- and inter-individual variability can be further reduced if the
mentalized organ systems operating within specific pH ranges same person is determining the pH readings consistently.
(Table 2).13 The ―potential of hydrogen,‖ or ―pH,‖ is based on a
logarithmic scale, meaning that there is a 10-fold difference URINARY ALKALINIZATION
between each number going from 1 to 14. The lower numbers The concept of acid-alkaline balance in the field of medicine
(1-6.99) represent the acid (or H+ donating) range, and the high- is not entirely novel, as it has been embraced by several groups
er numbers (7.01-14) represent the alkaline (or H+ accepting) within the medical community. Naturopathic medicine has used
range. For the most part, body tissues remain within the neutral the acid-alkaline balance as a theoretical model to explain the
pH of 7. Some body systems such as the blood (7.35-7.45) are foundation of many diseases. Allopathic medicine has examined
more tightly regulated than others (eg, urine pH ranges from 4.5- pH modulation in specific organ systems such as the kidney to
8.0), and any extended disturbance in acid-alkaline balance may control the formation of stones and the elimination of toxins. For
upset cell functioning via its transport and signaling processes.14- example, urine alkalinization has been part of the medical proto-
16
The human body has several means whereby it is able to regu- col for the management and prevention of uric acid stones.18,19
late acid-alkaline balance, including the following: (1) at the Another aspect of the acid-alkaline balance is its role in
cellular level via chemical reactions generating or consuming H+; detoxification, via either the acute removal of a drug or poison
(2) in the blood with the assistance of bicarbonate, amino acids, due to overdose or a nutritional protocol to support metabolic
albumin, globulin, and hemoglobin; and (3) systemically through detoxification and decrease dietary toxins. Urinary pH alkaliniza-
the release of carbon dioxide from the lungs and hydrogen ions tion is a method employed under acute medical settings for the
from the kidney.17 enhanced elimination of toxins in the event of a severe overdose.
Conversely, acidification of urine also increases the elimination
TABLE 2 pH of Selected Body Tissues13,17 of specific toxins, although to a seemingly lesser degree.20,21 The
Body Tissue pH method by which urine alkalinization works to enhance toxin
Blood 7.35-7.45
elimination is by the medically recognized process of ―ion trap-
ping,‖ which is the ability to enhance urinary excretion of weak
Muscle 6.1
acids in alkaline urine, preventing the reabsorption of xenobiot-
Liver 6.9
ics by renal tubules. 22,23 Proudfoot et al published a position
Gastric juice 1.2-3.0 paper on urine alkalinization, approved by the American
Saliva 6.35-6.85 Academy of Clinical Toxicology, which describes the use of urine
Urine 4.5-8.0 alkalinization to ≥7.5 via intravenous sodium bicarbonate admin-
Pancreatic juice 7.8-8.0 istration for acute poisoning and toxicity. 22 In this extensive
review, the effect of urine alkalinization on the excretion of vari-
CLINICAL DETERMINATION OF ACID-ALKALINE BALANCE ous pharmaceuticals and environmental toxins is elucidated.
Although it is not common, blood pH levels can shift to the This report states that ―urine alkalinization increases the urine
side of excessive acidity or alkalinity, in which case several clini- elimination of chlorpropamide, 2,4-dichlorophenoxyacetic acid,
cal symptoms will appear. Acidosis can lead to symptoms of leth- diflunisal, fluoride, mecoprop, methotrexate, phenobarbital, and
argy, progressing to stupor and coma, while alkalosis can lead to salicylate.‖22 The potential of urine alkalinization to enhance
a host of nervous conditions such as cramps, muscle spasms, irri- toxin excretion is exemplified by the work of Blank and Wolffram,
tability, and hyperexcitability. Clinical determination of a high wherein they modulated urine pH in pigs with 2% dietary sodium
systemic acid load can be accomplished by a number of methods, bicarbonate, changing the urine pH from 5.7 ± 0.2 to 8.3 ± 0.1,
including a review of the diet diary for at least 3 to 7 days to and favorably impacted the excretion of ochratoxin A, a myco-
gauge the degree of processed food and animal protein intake toxin, from 9.3 ± 1.9% to 22.2 ± 4.3% of the dose.24 Also, experi-
relative to fruit and vegetable consumption and a measurement mental and clinical studies confirm that urine alkalinization is
of urine pH using narrow-range indicator paper. Urine pH is a effective for salicylate poisoning. 23,25,26 Garrettson and
good indicator of the net dietary acid load, as reported by Remer Geller showed in humans that an increase in urine pH from
and Manz, who observed an inverse relationship between the 6.1 to 8.1 changed the renal clearance of salicylate from 0.08 ±
two variables.4 The urine compartment appears to be well suited 0.08 L/h to
for measuring the effect of acute and chronic factors. In our clini- 1.41 ± 0.82 L/h.23
cal experience, we have noted that the urine pH responds to a Therefore, if the rapid removal of toxins can be achieved to
a large extent with increasing urine pH 2 points on the pH scale

(which corresponds to a 100-fold decrease in H+ ions), it would ALKALIZING AGENTS
follow that smaller quantities of toxins may be removed on a pro- In addition to dietary changes, nutritional supplementation
longed basis if there were a subtle increase of urine pH in the for a short-term course of 3 to 4 weeks with select botanicals can
alkaline direction. Due to the logarithmic pH scale, a small facilitate metabolic detoxification. It would be appropriate to
change in urine pH could have a disproportionately large include specific alkalizing agents, such as potassium, within this
effect on drug and xenobiotic clearance.22 The concept of nutritional regimen (Table 3). Unfortunately, the
―progressive‖ versus rapid alkalinization of urine may be useful mainstream American diet is poor in potassium, as it often
as an adjunct for integrative health approaches employing lacks sufficient fruits and vegetables. The adequate intake
metabolic detoxification using specific (nutritional) protocols. (AI) established by the Food and Nutrition Board of the
Traditionally, functional medicine has addressed Institute of Medicine for potassium is 4.7 g daily,7 which is
detoxification or the removal of harmful endo- or exogenous the same amount that is encouraged by the Dietary
substances, from the aspect of upregulating hepatic phase I Approaches to Stop Hypertension (DASH) diet to maintain
and phase II enzymes to enable the chemical biotransformation lower blood pressure levels, decrease the effects of salt intake,
of toxins into water-soluble metabolites for excretion in the decrease the risk of kidney stones, and possibly reduce the
urine. With the added clinical procedure of urine alkalinization, incidence of bone loss. Current median intakes of potassium
the removal of these compounds from the body is accelerated. in the United States are roughly 35% and
There are many dietary agents to assist in progressive 50% below the AI for men and women, respectively.7
alkalinization. Foods that are high in potassium are noteworthy African Americans would particularly benefit from increased
(Table 3).27 One approach to clinically implementing these potassium intakes due to their relatively low potassium
strategies for metabolic detoxification involves initiating the intakes and high prevalence of elevated blood pressure and salt
patient on an elimination diet high in whole fruits and crucif- sensitivity.7 For the healthy population, intake of potassium at
erous vegetables and low in animal protein. In addition to potas- levels higher than the AI is not of particular high risk due to the
sium, cruciferous vegetables contain myriad phytochemicals, ability of the kidney to excrete excess amounts.7 However,
such as indole-3-carbinol and sulforaphane, which are essential potassium intakes should be closely monitored for patients with
for facilitating toxin biotransformation. 28-30 Additionally, these acute or chronic renal failure and pre-existing heart disease and
vegetables can favorably alkalize urine pH. In a pilot trial with 5 for those on medications that increase potassium reserves in
volunteers, we found that a 200 g serving of cooked broccoli, car- the body, such as potassium- sparing medications.7
rots, and cauliflower (with broccoli as the predominant vegeta- Various potassium salts are available to alter urine pH.
ble) resulted in an increase in urine alkalinization for up to 4 Studies using sodium bicarbonate administration reveal little
hours afterwards (baseline pH = 6.20 ± 0.51; after vegetables = effect on urinary calcium excretion in contrast to studies that
6.91 ± 0.45, P=.01). Thus, the simple instruction to alter diet to used potassium bicarbonate or potassium citrate supplementa-
include cruciferous vegetables can promote detoxification by tion and found significant reductions.33,34 Potassium citrate, a
upregulating phase II enzymes and by alkalizing urine, resulting therapeutic regimen to prevent kidney stones, can effectively
in enhanced excretion of toxins. alkalize urine. Doses of 4 to 8 g daily for 2 weeks in patients with
homozygous cystinuria have effectively alkalized urine. 35
TABLE 3 Potassium Content of Selected Foods27 Additionally, there are a number of studies on the use of potassi-
Food Serving Potassium (mg) um citrate to counteract bone resorption caused by chronic aci-
Potato, baked with skin 1 medium 721 demia of protein-rich diets.36-38
Prunes, dried ½ cup 633 The effects of potassium depend on its accompanying
anion.7 Potassium chloride, commonly used in processed food
Raisins ½ cup 598
products, does not appear to have the same alkalizing ability as
Prune juice 6 fl oz 530
potassium citrate.7 In a recent study, Jehle et al demonstrated
Lima beans, cooked ½ cup 478 that potassium citrate was more efficacious than potassium chlo-
Banana 1 medium 467 ride in increasing bone mineral density in postmenopausal
Acorn squash, cooked ½ cup (cubes) 448 women with osteopenia.39 Furthermore, potassium chloride led
Tomato juice 6 fl oz 400 to decreased bone mineral density in the lumbar spine.
Orange 1 medium 237 Potassium citrate supplementation in these subjects resulted in a
sustained and significant reduction in urinary calcium
Moreover, alkalinization during metabolic detoxification excretion and an increase in urinary citrate excretion, indicating
may be particularly useful, as it is believed that cellular pH and that alkalinization had occurred.39,40
the blood buffering system shift to the acid side of ideal pH Additionally, the citrate anion may be especially relevant for
reserve during detoxification due to increased circulation of xen- detoxification since it is an intermediate of the Krebs cycle and
obiotics and organic acids (eg, glucuronic acid). Furthermore, can potentially play a role in energy production. As many clini-
organic cation transporters that are responsible for the transport cians acknowledge from their experience, lack of energy is a com-
of xenobiotics in and out of the cell are pH-sensitive.31,32 mon side effect of the first stages of metabolic detoxification.

Therefore, eating foods that are high in citrate, such as certain rate therapy versus conservative management in nephrolithiasis of mild to moderate
severity. J Urol. 1985;134(4):658-661.
fruits and vegetables, may be beneficial. It is also worth noting 19. Pak CY, Sakhaee K, Fuller CJ. Physiological and physiochemical correction and preven-
that citrate is metabolized to bicarbonate in the body, thereby tion of calcium stone formation by potassium citrate therapy. Trans Assoc Am
Physicians. 1983;96:294-305.
further adding to the buffering potential.7 20. Simpson GM, Khajawall AM. Urinary acidifiers in phencyclidine detoxification.
Hillside J Clin Psychiatry. 1983;5(2):161-168.
21. Nahata MC, Cummins BA, McLeod DC, Schondelmeyer SW, Butler R. Effect of urinary
SUMMARY acidifiers on formaldehyde concentration and efficacy with methenamine therapy. Eur
In conclusion, the increasing dietary acid load in the con- J Clin Pharmacol. 1982;22(3):281-284.
22. Proudfoot AT, Krenzelok EP, Vale JA. Position Paper on urine alkalinization. J Toxicol
temporary diet can lead to a disruption in acid-alkaline homeo- Clin Toxicol. 2004;42(1):1-26.
stasis in various body compartments and eventually result in 23. Garrettson LK, Geller RJ. Acid and alkaline diuresis: When are they of value in the
treatment of poisoning? Drug Saf. 1990;5(3):220-232.
chronic disease through repeated borrowing of the body‘s alka- 24. Blank R, Wolffram S. Alkalinization of urinary pH accelerates renal excretion of ochra-
line reserves. Adjustment of tissue alkalinity, particularly within toxin A in pigs. J Nutr. 2004;134(9):2355-2358.
25. Vree TB, Van Ewijk-Beneken Kolmer EW, Verwey-Van Wissen CP, Hekster YA. Effect of
the kidney proximal tubules, can lead to the more effective excre- urinary pH on the pharmacokinetics of salicylic acid, with its glycine and glucuronide
tion of toxins from the body. Metabolic detoxification using a conjugates in human. Int J Clin Pharmacol Ther. 1994; 32(10):550-558.
26. Proudfoot AT, Krenzelok EP, Brent J, Vale JA. Does urine alkalinization increase salicy-
high vegetable diet in conjunction with supplementation of an late elimination? If so, why? Toxicol Rev. 2003;22(3):129-136.
effective alkalizing compound, such as potassium citrate, may 27. USDA/ARS Nutrient Data Laboratory Food Database. Available at: http://www.nal.
usda.gov/fnic/foodcomp/search/. Accessed June 1, 2007.
shift the body‘s reserves to become more alkaline. 28. Nho CW, Jeffery E. The synergistic upregulation of phase II detoxification enzymes by
glucosinolate breakdown products in cruciferous vegetables. Toxicol Appl Pharmacol.
2001;174(2):146-152.
Acknowledgments 29. Steinkellner H, Rabot S, Freywald C, et al. Effects of cruciferous vegetables and their
Special thanks to those individuals who reviewed this manuscript, including Gary Darland, constituents on drug metabolizing enzymes involved in the bioactivation of DNA-
PhD; Bhaskar Shenai, PhD; Robert Lerman, MD, PhD; and Barbara Schiltz, MS, RN, CN. reactive dietary carcinogens. Mutat Res. 2001;480-481:285-297.
30. Fahey JW, Talalay P. Antioxidant enzymes of sulforaphane: a potent inducer of Phase II
detoxification enzymes. Food Chem Toxicol. 1999;37(9-10):973-979.
REFERENCES 31. Sweet DH, Pritchard JB. rOCT2 is a basolateral potential-driven carrier, not an organic
1. Sebastian A, Frassetto LA, Sellmeyer DE, Merriam RL, Morris RC Jr. Estimation of the cation/proton exchanger. Am J Physiol. 1999;277 (6 Pt 2):F890-F898.
net acid load of the diet of ancestral preagricultural Homo sapiens and their hominid 32. Fujita T, Urban TJ, Leabman MK, Fujita K, Giacomini KM. Transport of drugs in the
ancestors. Am J Clin Nutr. 2002;76(6):1308-1316. kidney by the human organic cation transporter, OCT2 and its genetic variants. J
2. Maurer M, Riesen W, Muser J, Hulter HN, Krapf R. Neutralization of Western diet Pharm Sci. 2006;95(1):25-36.
inhibits bone resorption independently of K intake and reduces cortisol secretion in 33. Lemann J Jr, Gray RW, Pleuss JA. Potassium bicarbonate, but not sodium bicarbonate,
humans. Am J Physiol Renal Physiol. 2003;284(1):F32-40. reduces urinary calcium excretion and improves calcium balance in healthy mean.
3. Frassetto LA, Todd KM, Morris RC Jr, Sebastian A. Estimation of net endogenous non- Kidney Int. 1989;35(2):688-695.
carbonic acid production in humans from diet potassium and protein contents. Am J 34. Sakhaee K, Nicar M, Hill K, Pak CY. Contrasting effects of potassium citrate and sodi-
Clin Nutr. 1998;68(3):576-583. um citrate therapies on urinary chemistries and crystallization of stone-forming salts.
4. Remer T, Manz F. Potential renal acid load of foods and its influence on urine pH. J Am Kidney Int. 1983;24(3):348-352.
Diet Assoc. 1995;95(7):791-797. 35. Fjellstedt E, Denneberg T, Jeppsson JO, Tiselius HG. A comparison of the effects of
5. Reddy ST, Wang CY, Sakhaee K, Brinkley L, Pak CYC. Effect of low-carbohydrate high- potassium citrate and sodium bicarbonate in the alkalinization of urine in homozygous
protein diets on acid-base balance, stone-forming propensity, and calcium metabolism. cystinuria. Urol Res. 2001;29(5):295-302.
Am J Kidney Dis. 2002;40(2):265-274. 36. Marangella M, Di Stefano M, Casalis S, Berutti S, D‘Amelio P, Isaia GC. Effects of
6. Tucker KL, Hannan MT, Kiel DP. The acid-base hypothesis: diet and bone in the potassium citrate supplementation on bone metabolism. Calcif Tissue Int.
Framingham Osteoporosis Study. Eur J Nutr. 2001;40(5):231-237. 2004;74(4):330-335.
7. Institute of Medicine of the National Academy of Sciences. Potassium. In: Dietary 37. Sakhaee K, Maalouf NM, Abrams SA, Pak CY. Effects of potassium alkali and calcium
Reference Intakes for Water, Potassium, Sodium, Chloride, and Sulfate. Washington, DC: supplementation on bone turnover in postmenopausal women. J Clin Endocrinol
National Academies Press; 1994:186-268. Metab. 2005;90(6):3528-3533.
8. Green J, Kleeman CR. Role of bone in regulation of systemic acid-base balance. Kidney 38. Sellmeyer DE, Schloetter M, Sebastian A. Potassium citrate prevents increased urine
Int. 1991;39:9-26. calcium excretion and bone resorption induced by a high sodium chloride diet. J Clin
9. Brenner RJ, Spring DB, Sebastian A, et al. Incidence of radiographically evident bone Endocrinol Metab. 2002;87(5):2008-2012.
disease, nephrocalcinosis and nephrolithiasis in various types of renal tubular acidosis. 39. Jehle S, Zanetti A, Muser J, Hulter HN, Krapf R. Partial neutralization of the acidogenic
N Engl J Med. 1982;307(4):217-221. Western diet with potassium citrate increases bone mass in postmenopausal women
10. Sebastian A, Harris ST, Ottaway JH, Todd KM, Morris RC Jr. Improved mineral balance with osteopenia. J Am Soc Nephrol. 2006;17(11):3213-3222.
and skeletal metabolism in postmenopausal women treated with potassium bicarbon- 40. Trivedi B, Tannen RL. Effect of respiratory acidosis on intracellular pH of the proximal
ate. N Engl J Med. 1994;330(25):1776-1781. tubule. Am J Physiol. 1986; 250(6 Pt 2):F1039-1045.
11. Tucker KL, Hannan MT, Chen H, Cupples LA, Wilson PW, Kiel DP. Potassium, magne-
sium and fruit and vegetable intakes are associated with greater bone mineral density
in elderly men and women. Am J Clin Nutr. 1999;69(4):727-736.
12. Sellmeyer DE, Stone, KL, Sebastian A, Cummings SR. A high ratio of dietary animal
to vegetable protein increases the rate of bone loss and the risk of fracture in post-
menopausal women. Study of Osteoporotic Fractures Group. Am J Clin
Nutr.
2001;73(1):118-122.
13. Lehninger AL. Biochemistry: The Molecular Basis of Cell Structure and Function. 2nd ed.
New York: Worth Publishers, Inc;1977.
14. Charoenphandhu N, Tudpor K, Pulsook N, Krishnamra N. Chronic metabolic acidosis
stimulated the transcellular and solvent drag-induced calcium transport in the duode-
num of female rats. Am J Physiol Gastrointest Liver Physiol. 2006;291(3):G446-455. Epub
2006 May 4.
15. Nijenhuis T, Renkema KY, Hoenderop JG, Bindels RJ. Acid-base status determines the
renal expression of Ca2+ and Mg2+ transport proteins. J Am Soc Nephrol.
2006;17(3):617-626.
16. Bailey JL, Zheng B, Hu Z, Price SR, Mitch WE. Chronic kidney disease causes defects in
signaling through the insulin receptor substrate/phosphatidylinositol 3-kinase/Akt
pathway: implications for muscle atrophy. J Am Soc Nephrol. 2006;17(5):1388-1394.
17. Thomas L ed. Clinical Laboratory Diagnostics: Use and Assessment of Clinical Laboratory
Results. 1st ed. Frankfurt, Germany: TH-Books;1998.
18. Preminger GM, Harvey JA, Pak CY. Comparative efficacy of ―specific‖ potassium cit-

Anticancer Effect of Alkaline Reduced Water
Kyu-Jae LEE1,2, Seung-Kyu PARK1,2, Jae-Won KIM 1, Gwang-Young KIM 1, Young-Suk RYANG5, Geun-Ha
1 3 2,3 2,4
KIM , Hyun-Cheol CHO , Soo-Kie KIM , and Hyun-Won KIM
1
Dept. of Parasitology, 2 Institute of Basic Medical Sciences, 3 Dept. of Microbiology, 4 Dept. of Biochemistry, Wonju College of
Medicine, Yonsei Univ. ( Wonju , Korea)
5
Dept. of Biomedical Laboratory Science and Institute of Health Science, College of Health Science, Yonsei Univ. ( Wonju , Korea)
Abstract: Certain minerals can produce alkaline reduced water with high pH and low oxidation-reduction
potential (ORP) when dissolved in water. Alkaline reduced water (ARW) showed significant anticancer effect.
When B16 melanoma cells were inoculated subcutaneously and intra-peritoneally, C56BL/6 mice fed with
ARW showed tumor growth delay and the survival span was significantly lengthened. ARW also showed the
inhibition of metastasis by reducing the numbers of B16 melanoma colonies when injected through tail vein.
The amount of reactive oxygen species (ROS) was very reduced when fed with ARW except for spleen,
which is a major organ for immunity. Even for normal mice, ARW intake invoked systemic cytokines, such
as, Th1 (IFN-γ, IL-12) and Th2 (IL-4, IL-5), suggesting strong immuno-modulation effect. Both ROS
scavenging effect and immuno-modulation effect might be responsible for anticancer effect of alkaline
reduced water.
Keyword: alkaline reduced water, anticancer effect, antioxidant, immuno-modulation
1. Introduction 2. Materials & Methods
Reactive oxygen species (ROS) or free radicals are Alkaline Reduced Water (ARW)
one of the major offenders to render oxidative damage to ARW was made by putting mineral combinations
biological macromolecules. These unstable ROS are into water bottle. The pH of water was increased up to
known to cause or aggravate a variety of incurable 10.5 and ORP was decreased until -200mv. The mineral
diseases such as cancer, cardiovascular diseases, neuro- contents of ARW were also increased time dependently.
degenerative diseases as well as aging 1, 2).
The cellular radial-scavengers such as superoxide Animals and Cells
dismutase, catalase, glutathion peroxidase are natural C57BL/6 mice (4-5 weeks old) were obtained from
defense system against ROS. External source of the Daehan Bio Link Co., Ltd. (Chungbuk, Korea), and
antioxidative protection include antioxidant vitamins C maintained on standard chow and tap water until taking
and E, carotene and carotenoids as well as minerals such ARW. Mouse B16 melanoma cell lines were maintained
as selenium and zinc. Great efforts have been made in an in Dulbecco‘s Modified Eagle‘s Medium (DMEM)
attempt to find safe and potent natural antioxidants. supplemented with 5% heat-inactivated fetal bovine
serum (FBS) in a humidified atmosphere of 95% air-5%
CO2 at 37°C. The high-metastatic B16 cell line was
isolated from the lung of C57BL/6 mouse, which had
Water consists 70% of Human body. Water reaches been inoculated intraperitoneally with B16 cells. Cells
every tissue of human body within 30 minutes after were cloned by the limiting dilution methods and
drinking. It even flows through blood brain barrier with selected cloned were inoculated into mice. This method
no obstacle, and has almost no side effect. If water itself was repeated thrice, and the final clone with high
could work as a radical scavenger, it would be an ideal metastastic potential was obtained as B16-BL6
antioxidant 3). melanoma cells.
Recently, electrolyzed-reduced water with high pH
and significant negative redox potential (ORP) was In Vivo Evaluation of Antimetastatic Effect
shown to have SOD-like activity and catalase-like Cultured B16-BL6 melanoma cells were harvested
activity, and thus, scavenge active oxygen species and with 2 mM EDTA in PBS, and then washed three times
protect DNA from damage by oxygen radicals in vitro 4). with PBS. 1 × 106 B16-BL6 melanoma cells were
We developed a mineral combination to produce intravenously injected in tail vein of control and ARW-
alkaline reduced water (ARW) with high pH and low administered C57BL/6 mice. After 20 days, mice were
ORP similar to electrolyzed-reduced water. The mineral sacrificed and the lungs were collected to count the
combination was easy to carry and less expensive than colonies of metastasized B16-BL6 melanoma cells.
the system to produce electrolyzed-reduced water.
Present article demonstrates anticancer effect of In Vivo Suppression of Tumor Growth
alkaline reduced water in animal model. Cultured B16-BL6 melanoma cells were harvested
with 2 mM EDTA in PBS, then washed three times with
PBS. 1 × 106 B16-BL6 melanoma cells were
Hyun-Won KIM, ph.D., Dept. of Biochemistry, Wonju College subcutaneouly injected on the back of C57BL/6 mouse.
of Medicine, Yonsei Univ., Wonju 220-701, Korea. The length of long and short axis of tumor were
Phone +82-33-741-0283, Fax. +82-33-743-0411 measured every day and the volumes were calculated
E-mail [email protected] using the formula ab2/2, where a is the length of long
axis and b the length of short axis. Survival curve was
plotted using Kaplan-Meier method.
Cytokine ELISA
Concentrations of cytokines from mice sera were
measured by conventional sandwich ELISA method. A
coating and biotinylated capture antibody was purchased
form Pharmingen (USA): clones JES5-2A5 and JES5-
16E3 for IL-4, and clones R4-6A2 and XMG1-2 for IL5,
respectively. Coating on 96-well microtiter plate was
performed with 250 g coating antibody. Sera sample,
biotinylated capture antibody, secondary antibody and
then streptavidinylated HRP was sequentially added,
incubated and washed. o-phenylenediamine solution was
added for development and 2N sulfuric acid for stop the
development. The absorbance at 490 nm was measured Fig. 1. Effect of ARW on ROS scavenging in mice.
with ELISA reader at 490 nm.
ROS Assay
Quantitation of cytosolic ROS was measured by Evaluation of immuno-modulating effect of ARW
oxidation method of 2‘,7‘-dichlorofluroscein-diacetate ARW intake invoked systemic cytokines, such as,
(DCF-DA) as described in elsewhere5). 12.5 M DCFDA Th1 (IFN- IL-12), cytokines for cellular immunity and
was incubated with liver, spleen, lung, or brain Th2 (IL-4, IL-5), cytokines for humoral immunity (Fig.
homogenate and change of fluorescence was measured at 2). This suggests that ARW stimulates both cellular and
485 nm of excitation wavelength and 585 nm of emission humoral immunity. Th1 and Th2 reached maximal peak
wavelength. The relative fluorescence unit (RFU) was after 2 week of ARW feeding and returned back to
calculated to 1 mg protein in homogenate. baseline. Cytokines levels of tap water fed control
remained at the baseline.
3. Results
140 IN F -r
IL -1 2
Effect of ARW on tumor growth and survival time 120
IN F -r c o n t r o l
Tumor growth was significantly reduced in ARW fed 100
C on ce n tra tio n pg /m l
IL -1 2 c o m t r o l
group. After 10th days from subcutaneous injection of
B16 melanoma cells into flank of C57BL/6 mice, tumor 80
mass was palpable and thereafter serially measured. At 60
10 days tumor size was 0.27 cm3 for ARW fed group,
while that of tap water treated group was 0.48 cm3. At 40
19th day tumor size was 3.32 cm3 for ARW fed group, 20
and 6.02 cm3 for control group, showing 54% inhibitionP 0
Survival rate was also monitored after intraperitoneal
injection of B16 melanoma cells to C57BL/6 mice. ARW 0 1 2 3 4 5 6
lengthened mean survival time from 36 days for control W ee k
group to 44 days for ARW fed group.
250 IL -4
Evaluation of antimetastatic activity of ARW on IL -5
200 IL -4 c o n tro l
After intravenous injection of B16 melanoma cells to IL -5 c o n tro l
C o n c e n tr a tion p g /m l
of ARW was evaluated. 15 days after injection, mice 150

were sacrificed. Their lung tissues were removed, and
the metastatic lesions were compared. ARW fed group 100
had fewer metastatic lesions. 257 Black colonies were
counted on the lungs of ARW group and 145 black spots 50
were shown in the control group, indicating 44%
inhibition against metastasis of melanoma cell.
0
As melanoma cell is know to exhibit increased
oxidative stress that could support the progression of 0 1 2 3 4 5 6
metastasis, concentration of ROS was also measured for W eek
each organ of the same B16 melanoma injected mice
Fig. 2. Time kinetics in serum concentrations of Th1
using DCFH-DA (Fig. 1). Amount of ROS for lung,
and Th2 cytokines in ARW or control mice injected
liver, and kidney were very low in ARW fed mice
with B16-BL6 melanoma cells.
compared to that of control. However, the spleen, which
is a major organ for immunity, shows very high ROS in
ARW fed group. This might suggest the immune
boosting effect of ARW.
through a retroviral-mediated. Cancer Res, 62: 7135-7138,
4. Discusssion 2002.
8) Sander, C. S., Hamm, F., Elsner, P., and Thiele, J. J.
Oxidative stress in malignant melanoma and non-melanoma
Recently, electrolyzed-reduced water with high pH
skin cancer. Br J Dermatol, 148: 913-922, 2003.
and significant negative redox potential was shown to
have SOD-like activity and catalase-like activity, and
thus, scavenge ROS and protect DNA from damage by
oxygen radicals in vitro. If ARW is actually acting as
antioxidants and protects DNA from damage, it might be
hypothesized that ARW intake would be possible to
show anticancer effect.
Present investigation demonstrates the anticancer
effect of ARW. ARW intake slowed down tumor growth,
and inhibited the intravenous metastasis, leading to
prolonged survival span in B16 melanoma injected mice.
B16 melanoma cell is one of the most frequent tumors in
humans and is characterized by its high capacity for
invasion and metastasis6, 7). They escape from immune
surveillance and spread more rapidly than any other
tumors using several mechanisms including MHC down-
regulation, increasing reactive oxygen species (ROS)
levels, and thus, expedite the progression of metastasis8).
Our study demonstrated that ARW not only acts as an
antioxidant but also acts as a strong immnuo-moduator,
both of which could be responsible for the anticancer
effect. Thus, ARW is expected to be effective for the
various diseases resulting from low immunity and/or
high reactive oxygen species as well as for the
prevention of cancer.
ARW not only has high pH and low ORP, but also
contain some magnesium ion. Recently, magnesium was
shown to be effective for the prevention of various
diseases8). We cannot exclude the possibility that the
magnesium in ARW might have contributed to the
anticancer effect.
Water reaches every tissue of human body within 30
minutes after drinking. It even flows through blood brain
barrier with no obstacle, and has almost no side effect.
Taking ARW could be an ideal way to maintain health.
References
1) Feig, D. I., Reid, T. M., and Loeb, L. A.: Reactive Oxygen
Species in Tumorigenesis, Cancer Res., 54: 1890-1894,
1994.
2) Reid, T. M. and Loeb, L. A.: Mutagenic Specificity of
Oxygen Radicals Produced by Human Leukemia Cells.
Cancer Res., 53: 1082-1086, 1992.
3) Kim, H. W.: The Reason of Every Disease, Definition of
Active Oxygen, “The Best Water for Human Body”, 60-62,
Seoul, Seojiwon press, 2002.
4) Shirahata, S., Kabayama, S., Nakano, M., Miura, T.,
Kusumoto, K., Gotoh, M., Hayashi, H., Otsubo, K.,
Morisawa, S., and Katakura, Y.: Electrolyzed-reduced Water
Scavenges Active Oxygen Species and Protects DNA from
Oxidative Damage. Biochem. Biophys. Res. Commun., 234:
269-274, 1997.
5) Kim, S. H., H.J., C., Kang, D. H., Song, G. A., Cho, M.,
Yang, U. S., Kim, H. J., and Chung, H. Y. NF-kB binding
activity and cyclooxygenase-2 expression in persistent
CCL4-treated rat liver injury. J Kor Med Sci, 17: 193-200,
2002.
6) Hofmann, U. B., Westphal, J. R., Van Muijen, G. N., and
Ruiter, D. J. Matrix metalloproteinases in human melanoma.
J Invest Dermatol, 115: 337-344, 2000.
7) Shah, A. H., Tabayoyong, W. B., Kundu, S. D., Kim, S. J.,
Parijs, L. V., Liu, V. C., Kwon, E., Greenberg, N. M., and
Lee, C. Supression of tumor metastasis by blockade of
transforming growth factor signaling in bone marrow cells
Effect of Electrolyzed Water on
Wound Healing
Artificial Organs 2000; 24:984-987
*Naoki Yahagi, *Masashi Kono, *Masaki Kitahara,

*Akito Ohmura, †Osao Sumita,
‡Toshimasa Hashimoto, ‡Katsuaki Hori,
‡Chen Ning-Juan, §Paul Woodson, ¶Shoji Kubota,
**Arata Murakami, and **Shinichi Takamoto,
*Department of Anesthesiology, Teikyo University
Mizonokuchi Hospital; †Coherent Technology Inc.;
‡Faculty of Engineering, Tokyo Institute of
Technology; §Basic Sciences Department, Kenmore
Bastyr University; ¶Water Design Laboratories, and
**Department of Thoracic Surgery, University of
Tokyo, Tokyo, Japan
Abstract: Electrolyzed water accelerated the healing of full-thickness cutaneous wounds

in rats, but only anode chamber water (acid pH or neutralized) was effective.
Hypochlorous acid (HOCl), also produced by electrolysis, was ineffective, suggesting
that these types of electrolyzed water enhance wound healing by a mechanism unrelated
to the well-known antibacterial action of HOCl. One possibility is that reactive oxygen
species, shown to be electron spin resonance spectra present in anode chamber water,
might trigger early wound healing through fibroblast migration and proliferation.
Key Words: Wound healing— Electrolyzed water—Anode water—Cathode water—

Hypochlorous acid.
Electrolyzed water, in a variety of forms and made by a variety of different

processes, is widely used in
THOUGHTS AND PROGRESS 985
Japan as a topical disinfectant (1,2). We describe stored in PET bottles, the pH and ORP of all 6 types
here our findings that some types of electrolyzed of water remained stable for at least a month.
water appear to accelerate the healing of full- Forty-two Wistar rats (8 weeks old) were ran-
thickness cutaneous wounds in rats. domly assigned to 6 experimental groups, housed in
individual metabolic cages at 25°C, and fed rodent
Materials and methods chow and water ad libitum. Under pentobarbital an-
Six different types of water were made and tested. esthesia, the back was shaved and two 1.0 cm square,
full-thickness cutaneous wounds were made, one be-
The first, ultrapure water (resistivity � 18 M� � cm),
hind the other and 1.5 cm apart, on the back of each
was produced by a sequence of treatments applied to
animal. In each rat, 1 wound (selected randomly)
city tap water: charcoal filtration, reverse osmosis,
was treated twice a day for 7 days with 1 of the 6
and ion exchange. One group of experimental ani-
types of water described previously; the other wound
mals was treated with this ultrapure, nonelectrolyzed
was left untreated. The rat was observed carefully
water. Four types of electrolyzed water were made
until the water was absorbed by the wound to ensure
from this ultrapure water. In each case, the water
that no spillage occurred. The first treatment was
was electrolyzed (voltage gradient 13 V and appar- administered immediately after surgery. All wounds
ent current density 200 mA/cm 2 ) while being were allowed to heal without dressings. For 17 days
pumped (500 ml/min) through a 3 chamber device after surgery, wound areas were measured daily by
(Coherent Technology, Tokyo, Japan) (3). One planimetry, using digital video camera images dis-
chamber contained a platinum-plated titanium an- played via a personal computer.
ode. Usually, the middle chamber was filled with a Acid and neutralized anode waters were studied
saturated sodium chloride solution made with the by electron spin resonance (ESR; JEOL-JES-RE2X;
ultrapure water. The third chamber contained the Nihon Denshi, Tokyo, Japan) with the addition of a
cathode, also made of platinum-coated titanium. spin trapping agent [5,5-dimethyl-1-pyrroline-N-
Proprietary ion-exchange membranes separated the oxide (DMPO, Sigma, St. Louis, MO, U.S.A.)] using
chambers. The following 3 types of electrolyzed wa- a flat cell of 1 mm width (4). This was carried out 24
ter were made using the Coherent Technology de- hr after the preparation of the electrolyzed water.
vice in this configuration (all measurements made at The duration of the incubation of the electrolyzed
25°C). The first, acid pH water, Ac(+), was taken water with DMPO was 2 min. The magnetic field was
from the anode chamber [pH 2.50–2.63, oxidation- of 335 ± 5 mT. Signal strength was compared with
reduction potential (ORP) 1104–1191 mV, concen- the signal derived from Mn2+ (as a control).
tration of residual chlorine (determined by the All protocols were approved by the Animal Re-
o-toluidine method) 80 to 100 ppm]. Neutral pH search Review Committee of Teikyo University
(7.40) anode chamber water, N(+), was made by Medical School.
adding NaOH (1N) to the electrolyzed water taken For each group, the results are presented as mean
from the anode chamber [pH 7.4, ORP 749–784 mV, wound area ± SD. The comparison between the ar-
concentration of residual chlorine almost the same eas of water-treated and nontreated wounds was
as in the Ac(+) solution]. Alkaline pH water, Al(−), performed using a paired Student‘s t test. The com-
was taken from the cathode chamber (pH 10.65– parisons among the experimental groups were made
10.85, ORP 212–297 mV, residual chlorine only a few using a one-way analysis of variance. When statisti-
ppm). Replacing the platinum cathode in the Coher- cal significant was detected, Dunnett‘s test was used
ent Technology device by one made of carbon and to determine which values differed significantly from
replacing the center-chamber solution by 5 M citrate those obtained using the nonelectrolyzed ultrapure
(organic acid; citric acid) in ultrapure water allowed water. Values of p < 0.05 were considered significant.
us to make a fourth type of electrolyzed water. This
acidic water [Ac(−)] was taken from the cathode Results
chamber (pH 3.86–3.87, ORP 212–297 mV, no re- As shown in Table 1, both types of anode chamber
sidual chlorine). Finally, hypochlorous acid (HOCl) water [acidic and neutral: Ac(+) and N(+), respec-
solution was made by electrolyzing 0.45% NaCl in a tively] accelerated wound healing (when compared
single-chamber device (Omuko Co. Ltd., Tokyo, Ja- to the effect of nonelectrolyzed ultrapure water) (p <
pan) (Voltage gradient, apparent current density, 0.05). This acceleration of wound healing was evi-
and pump rate were the same as for the Coherent dent from as early as postoperative Day (POD) 1 in
Technology device.). The pH and ORP of this solu- Ac(+) or POD 2 in N(+). The alkaline water from
tion were 7.45 and 780 mV, respectively. When the cathode chamber [Al(−)] showed a slight, but
Artif Organs, Vol. 24, No. 12, 2000

986 THOUGHTS AND PROGRESS
TABLE 1. Comparison between the areas of water-treated and nontreated wounds, and comparison between
experimental groups
POD 0 1 2 3 4 5 7 9 11 14 17
b b b b b b b b b
Water (n � 7)
Mean 1.0399 1.3117 1.3082 1.1325 1.0894 0.8760 0.6588 0.3165 0.2280 0.1525 0.0839
SD 0.0777 0.1889 0.1559 0.2135 0.1194 0.1133 0.1203 0.0348 0.0801 0.0159 0.0202
NT
Mean 1.0931 1.1958 1.1007 1.0242 0.9849 0.8509 0.6558 0.3208 0.2000 0.1685 0.0795
SD 0.0839 0.2697 0.2186 0.2407 0.1832 0.1154 0.1554 0.1189 0.0664 0.0609 0.0416
Ac(+) (n � 9) a,c a a a,c a,c a,c a,c a,c a,c a,c
Mean 1.0347 0.9213 1.0904 0.9001 0.7937 0.6248 0.3709 0.1597 0.0878 0.0225 0.0040
SD 0.1105 0.2005 0.2187 0.1868 0.1832 0.1578 0.1783 0.0868 0.0330 0.0225 0.0083
NT
Mean 1.0876 1.1913 1.3229 1.2836 1.1969 1.0530 0.7255 0.3509 0.2114 0.1225 0.0430
SD 0.1815 0.2506 0.3939 0.3362 0.3535 0.2524 0.2738 0.1552 0.0967 0.0399 0.0351
N(+) (n � 6) a a a a,c a,c a,c a,c a,c a,c a,c
Mean 1.0457 1.1577 0.9918 0.8878 0.7846 0.6214 0.3754 0.1960 0.1122 0.0230 0.0151
SD 0.1076 0.2757 0.1751 0.1926 0.1775 0.1438 0.1273 0.0957 0.0700 0.0239 0.0371
NT
Mean 1.0972 1.4260 1.3473 1.3465 1.2990 1.1729 0.8549 0.4755 0.3371 0.1447 0.0811
SD 0.0494 0.2773 0.1889 0.1699 0.1379 0.1614 0.2917 0.1421 0.1781 0.1191 0.0719
Al(−) (n � 6) c a a c c
Mean 1.0151 0.9611 0.9970 0.8861 0.8052 0.7372 0.4776 0.2692 0.1221 0.0368 0.0305
SD 0.0595 0.1277 0.0876 0.1099 0.1335 0.1400 0.1461 0.1524 0.0280 0.0227 0.0251
NT
Mean 1.0488 1.0272 1.1619 1.0939 1.0963 0.9781 0.7044 0.3958 0.2025 0.1406 0.0720
SD 0.0643 0.1376 0.3234 0.3316 0.2564 0.2191 0.2431 0.1335 0.0843 0.0510 0.0442
Ac(−) (n � 6) c
Mean 0.9723 1.1173 0.9656 0.9082 0.8789 0.7429 0.5517 0.2316 0.1471 0.0979 0.0763
SD 0.0642 0.2219 0.3055 0.2881 0.2423 0.2130 0.2021 0.0842 0.0584 0.0482 0.0311
NT
Mean 0.9374 1.0732 1.0655 1.0394 1.0151 0.8215 0.6636 0.3369 0.1941 0.1110 0.0795
SD 0.0682 0.1278 0.1326 0.1958 0.2027 0.1632 0.1818 0.1109 0.0440 0.0487 0.0318
HOCl (n � 8) c
Mean 1.1368 1.1986 1.2423 1.1403 0.9823 0.8702 0.6797 0.3585 0.1802 0.0961 0.0509
SD 0.1941 0.2300 0.3154 0.2580 0.2814 0.2474 0.2628 0.1830 0.1005 0.0563 0.0407
NT
Mean 1.1909 1.1885 1.3253 1.3231 1.2036 1.1455 0.8468 0.3892 0.1901 0.1488 0.0660
SD 0.2448 0.3144 0.3970 0.3555 0.3412 0.2983 0.2766 0.1555 0.1103 0.1155 0.0559
a
p < 0.05 vs the area of the NT wound (paired Student‘s t test).
b
p < 0.05 among the groups (one-way ANOVA).
c
p < 0.05 versus water (Dunnett).
Values are cm2. POD: postoperative day (wounds were made on Day 0), Water: nonelectrolyzed pure water, NT: nontreated wounds,
Ac(+): acid pH anode water, N(+): neutral pH anode water, Al(−): alkaline pH cathode water, Ac(−): acid pH cathode water, HOCl:
hypochloric acid.
insignificant, tendency to increase healing (com- Discussion

pared with the ultrapure water), but the acidic water The bactericidal action of various types of anode
from the cathode chamber [Ac(−)] and the HOCl chamber water in the past has been attributed to
solution were both ineffective. All the wounds in all their HOCl content (1). Since our HOCl solution
animals were free from signs of infection. was without effect on wound healing, we suggest that
As shown in Fig. 1, no significant ESR spectrum the anode chamber waters tested here may have a
was observed for untreated acidic anode chamber mode of action unrelated to any antibacterial HOCl
water. However, when we added a small amount of produced by the electrolysis. One possibility is that
ferric salt to the anode water (5) to mimic the in vivo free radicals, generated in the anode chamber waters
experiment, 4 lines suggestive of hydroxyl radicals by contact with the wound (Fig. 1), may be respon-
were observed in the spectrum. Similar ESR spectra sible for the very early effect on wound healing seen
were observed for neutralized anode chamber water in this model. This interpretation is supported by the
(in the absence or presence of ferric salt, respec- known effects of free radicals on inflammation as
tively). well as by what is known of the role of inflammation

THOUGHTS AND PROGRESS 987
(e.g., on neutrophils, fibroblasts, and endothelial

cells even at dilute concentrations of 2.5 × 10−2% to
2.5 × 1−4% (12). Furthermore, wounds created on
mouse ears and treated with 0.25% sodium hypo-
chlorite showed delayed epithelialization and neo-
vascularization (13). This might be the reason that
HOCl was without effect in our wound healing model.
In conclusion, acid and neutral anode chamber
waters accelerated the healing of full-thickness cuta-
neous wounds in rats. This effect might be caused by
the generation of reactive oxygen species; however,
further study is necessary for the elucidation of the
mechanism underlying the effects of electrolyzed
water on wound healing.
Acknowledgement: The authors owe grateful thanks to

Dr. Yuko Nishimoto for valuable discussion.
References
FIG. 1. Shown are electromagnetic spectra of acidic anode 1. Tanaka H, Hirakata Y, Kaku M, Yoshida R, Takemura H,
chamber water. The upper line is for untreated acidic anode Mizukane R, Ishida K, Tomono K, Koga H, Kohno S, Kami-
chamber water. There was no significant ESR spectrum. Note hara S. Antimicrobial activity of superoxidized water. J Hosp
that the lower line, the spectrum of the same water with ferric salt Inf 1996;34:43–9.
added, shows 4 lines suggestive of hydroxyl radicals. 2. Hayashi H, Kumon K, Yahagi N, Haruna M, Watanabe Y,
Matoui J, Hattori R. Successful treatment of mediastinitis af-
ter cardiovascular surgery using electrolyzed strong acid
in the initiation of healing (6) in this model. In our aqueous solution. Artif Organs 1997;21:39–42.
3. Sumida N, Hashimoto H. Japanese Patent Publication No.
study, differences in pH could not account for the 07-000966. Liquid coexisting hydrogen ion or hydroxide ion
significant difference in the acceleration of wound with oxidizing-reducing material by electrolyzing pure water
healing between acidic (pH about 2.5) and neutral- and its production. 1991.
4. Harbour JR, Chow V, Bolton JR. An electron spin resonance
ized (pH 7.4) anode chamber waters on the one study of the spin adducts of OH and HO2 radicals with ni-
hand, and acidic cathode chamber water (pH about trones in the ultraviolet. Photolysis of aqueous hydrogen per-
3.8) on the other. Furthermore, there was no differ- oxide solutions. Can J Chem 1974;52:3549–54.
5. Cohen G, Sinet PM. The Fenton reaction between ferrous-
ence in pH or ORP between neutralized anode diethylenetriamine-pentaacetic acid and hydrogen peroxide.
chamber water (pH 7.4, ORP 749–784 mV) and FEBS Lett 1982;138:258–60.
HOCl (pH 7.45, ORP 780 mV). Thus, ORP presum- 6. Asmussen PD, Sollner B. Mechanism of wound healing. In:
Wound Care. Tutorial Medical Series. Stuttgart: Hippokrates
ably did not substantially affect wound healing in our Company, 1993.
experiment. 7. Murrell GA, Francis MJ, Bromley L. Modulation of fibroblast
Reactive oxygen species were shown to affect proliferation by oxygen free radicals. Biochem J 1990;265:
659–65.
DNA synthesis and proliferation in fibroblasts. A 8. Nicotera TM, Privalle C, Wang TC, Oshimura M, Barrett JC.
low level of these species stimulates DNA synthesis Differential proliferative responses of Syrian hamster embryo
and cell division while a high level inhibits DNA fibroblasts to paraquat-generated superoxide radicals de-
synthesis (the cytotoxicity induced being propor- pending on tumor suppressor gene function. Cancer Res
1994;54:3884–8.
tional to the level of reactive oxygen species) (7–9). 9. Subirade I, Fernandez Y, Periquet A, Mitjavila S. Catechin
Moreover, in small amounts, reactive oxygen species protection of 3T3 Swiss fibroblasts in culture under oxidative
were shown to be involved in the mechanism under- stress. Biol Trace Elem Res 1995;47:313–9.
10. Wach F, Hein R, Adelmann-Grill BC, Kreig T. Inhibition of
lying fibroblast chemotaxis into sites of injury or in- fibroblast chemotaxis by superoxide dismutase. Eur J Cell
flammation (10). Biol 1987;44:124–7.
To our knowledge, there is no report clearly ex- 11. Oosthuizen MM, Greyling D. Antioxidants suitable for use
with chemiluminescence to identify oxyradical species. Redox
plaining the direct beneficial effect of HOCl on Rep 1999;4:277–90.
wound healing. HOCl generates not only chlorine 12. Kozol RA, Gillies C, Elgabaly SA. Effects of sodium hypo-
gas, which is the main cause of the bactericidal effect chlorite (Dakin‘s solution) on cells of the wound module.
Arch Surg 1988;123:420–3.
of HOCl, but also singlet oxygen, which is a reactive 13. Kjolseth D, Frank JM, Barker JH, Anderson GL, Rosenthal
oxygen species whose physiological effect is still un- AI, Acland RD, Schuschke D, Campbell FR, Tobin GR,
known (11). Kozol et al. demonstrated that sodium Weiner LJ. Comparison of the effects of commonly used
wound agents on epithelialization and neovascularization. J
hypochlorite had toxic effects on wound modules Am Coll Surg 1994;179:305–12.

January 2008 Biol. Pharm. Bull. 31(1) 19—26 (2008) 19
Inhibitory Effect of Electrolyzed Reduced Water on Tumor Angiogenesis

Jun YE,a,b Yuping LI,a,c Takeki HAMASAKI,d Noboru NAKAMICHI,e Takaaki KOMATSU,d
Taichi KASHIWAGI,d Kiichiro TERUYA,a,d Ryuhei NISHIKAWA,d Takeshi KAWAHARA,d Kazuhiro OSADA,d
Kazuko TOH,d Masumi ABE,d Huaize TIAN,d Shigeru KABAYAMA,f Kazumichi OTSUBO,f
Shinkatsu MORISAWA,f Yoshinori KATAKURA,a,d and Sanetaka SHIRAHATA*,a,d
a
Graduate School of Systems Life Sciences, Kyushu University; d Department of Genetic Resources Technology, Faculty of
Agriculture, Kyushu University; 6–10–1 Hakozaki, Higashi-ku, Fukuoka 812–8581, Japan: b Key Laboratory of the
Ministry of Education for Cell Biology and Tumor Cell Engineering, School of Life Science, Xiamen University; Fujian,
361005 P.R. China: c School of Life Sciences, Nanchang University of Science and Technology; Nanchang 330006, P.R.
China: e Functional Water Cell Analysis Center Co., Ltd.; Fukuoka 812–0053, Japan: and f Nihon Trim Co., Ltd.; 1–8–34
Oyodonaka, Kita-ku, Osaka 531–0076, Japan.
Received June 9, 2007; accepted October 16, 2007; published online October 17, 2007
Vascular endothelial growth factor (VEGF) is a key mediator of tumor angiogenesis. Tumor cells are ex-
posed to higher oxidative stress compared to normal cells. Numerous reports have demonstrated that the intra-
cellular redox (oxidation/reduction) state is closely associated with the pattern of VEGF expression. Electrolyzed
reduced water (ERW) produced near the cathode during the electrolysis of water scavenged intracellular H2O2
and decreased the release of H2O2 from a human lung adenocarcinoma cell line, A549, and down-regulated both
VEGF transcription and protein secretion in a time-dependent manner. To investigate the signal transduction
pathway involved in regulating VEGF expression, mitogen-activated kinase (MAPK) specific inhibitors,
SB203580 (p38 MAPK inhibitor), PD98059 (ERK1/2 inhibitor) and JNKi (c-Jun N-terminal protein kinase in-
hibitor) were applied. The results showed that only PD98059 blocks VEGF expression, suggesting an important
role for ERK1/2 in regulating VEGF expression in A549 cells. As well, ERW inhibited the activation of extracel-
lular signal-regulated kinase (ERK) in a time-dependent manner. Co-culture experiments to analyze in vitro
tubule formation assay revealed that A549 cell-derived conditioned medium significantly stimulated the forma-
tion of vascular tubules in all analyzed parameters; tubule total area, tubule junction, number of tubules, and
total tubule length. ERW counteracted the effect of A549 cell-conditioned medium and decreased total tube
length (p 0.01). The present study demonstrated that ERW down-regulated VEGF gene transcription and pro-
tein secretion through inactivation of ERK.
Key words electrolyzed reduced water; angiogenesis; oxidative stress; vascular endothelial growth factor; extracellular signal-
regulated kinase; A549 cell-conditioned medium
Tumor angiogenesis, the formation of new blood capillar- ble compounds, whereas VEGF189 and VEGF206 remain cell
ies by vascular endothelial cells from existing vessels, is an surface associated or are primarily deposited in the extracel-
important mechanism for supplying nutrients, oxygen, lular matrix.9)
growth factors and others to tumor cells. Tumor cells trigger Reactive oxygen species (ROS) are suggested to play an
angiogenesis by secreting angiogenic factors, especially vas- important role in angiogenesis.10) Furthermore, there is in-
cular endothelial growth factor (VEGF-A),1) which plays an creasing evidence of the involvement of H2O2 in the regula-
important role in the regulation of normal and abnormal an- tion of angiogenesis.9,11—13) As well, a variety of cell lines
giogenesis.2) derived from human tumors has been shown to produce large
VEGF-A (commonly known as VEGF) was first reported amounts of H2O2.14) Constitutive surveillance for cellular
as a vascular permeability-inducing factor secreted by tumor protection against oxidative stress is conferred by intracellu-
cells, and referred to as vascular permeability factor (VPF).3) lar antioxidative agents.15) Excess amounts of ROS are toxic
VEGF gene expression is initiated by extracellular signals in- and cause a reduction of intracellular antioxidant levels.16) It
cluding growth factors, mitogens, phorbol ester, cytokines has been reported that pretreatment of the heart with exoge-
and extracellular stresses. The first three of these exogenous nous antioxidants improved its condition as a result of reduc-
signals activate the Ras-Raf-MEK-ERK pathway that trans- ing ROS production.17) The VEGF-A gene is one that has its
duces mitogenic signals regulating cell proliferation or dif- expression regulated by ROS, especially by H2O2. Additional
ferentiation. The other extracellular signals activate the data support that VEGF-A mRNA is up-regulated by H2O2 in
JNK/SAPK and p38 pathways that regulate cellular inflam- a dose- and time-dependent manner.18,19) Taken together,
matory or stress responses.4) VEGF is overexpressed at both these suggest that some endogenous as well as exogenous an-
mRNA and protein levels in a high percentage of malignant tioxidative agents can be used to regulate VEGF-A gene ex-
animal and human tumors, as well as in many immortalized pression and/or H2O2 production for therapeutic purposes.
and transformed cell lines.5—7) The VEGF-A gene transcript Electrolyzed reduced water (ERW) has attracted much at-
undergoes alternative splicing to yield mature isoforms of tention because of its antioxidative potential. Water electroly-
121, 165, 189, and 206 amino acids, with VEGF165 appearing sis typically produces two forms of water: reduced or alka-
to be quantitatively and functionally predominant in most an- line (high pH) water near the cathode and an oxidized or acid
giogenic states.8) VEGF121 and VEGF165 are secreted as solu- (low pH) water near the anode. Applications of oxidized
∗ To whom correspondence should be addressed. e-mail: [email protected] © 2008 Pharmaceutical Society of Japan
u.ac.jp
January 2008 20
water have frequently been reported.20—22) In Japan, ERW with addition of NaOH could scavenge intracellular ROS or
produced from tap water by house-use electrolyzing purifiers not, and such effect was not observed. Also, these MEM
is popular as it is thought to have health benefits. ERW has media were applied to human fibrosarcoma HT1080 cells
been shown to be clinically effective in the treatment of pa- and measured matrix metalloproteinase (MMP) gene expres-
tients with irritable bowel syndrome or non-ulcer dyspep- sions. We did not observe any difference in the levels of
sia.23) Shirahata et al. first demonstrated that ERW not only MMP expression between HT1080 cells cultured with the
exhibited high pH, low dissolved oxygen, extremely high dis- two MEM media (unpublished observation). Together with
solved molecular hydrogen, but most importantly, showed these observations and the knowledge that both MMP and
ROS scavenging activity and protective effects against oxida- VEGF are redox-sensitive genes, we judged that an addition
tive damage to DNA.24) Thereafter, the inhibitory effects of of NaOH into culture media has no effect on intracellular
ERW on alloxan-induced pancreatic cell damage25) and on redox state and related genes expression. We therefore used
hemodialysis-induced oxidative stress in end-stage renal dis- MEM media prepared with Milli Q water as a control in sub-
ease (ESRD) patients26,27) were reported. Kim and Kim re- sequent experiments.
ported that ERW derived from tap water exhibited an anti- Human umbilical vein endothelial cells (HUVEC) were
type 2 diabetic effect in animal experiments.28) purchased from Cambrex and cultured in EGM-2 medium
Although the data accumulated so far suggest that ERW (Cambrex, MD, U.S.A.). Homovanillic acid (HVA) and
could be a useful antioxidative agent, further studies are re- horseradish peroxidase type VI were purchased from Sigma
quired to elucidate the mechanisms of its actions in cells. To Chemical Co. (St. Louis, MO, U.S.A.). SB203580, PD98059
this end, we hypothesized that ERW could regulate VEGF-A and c-Jun N-terminal protein kinases inhibitor (JNKi) were
gene expression to exert antiangiogenic effects via scaveng- purchased from Calbiochem (CA, U.S.A.). The Quantikine
ing ROS, in particular H2O2. We carried out a series of ex- kit (Human VEGF Immunoassay, Catalog Number DVE00)
periments as a first step to uncover the mechanisms involved. was obtained from R&D Systems, Inc. (Minneapolis, MN,
Here we present evidence that ERW attenuates both the re- U.S.A.). The Quantikine VEGF Immunoassay kit is designed
lease of H2O2 and the secretion of VEGF. This then leads to to measure VEGF165 levels in cell culture supernates. An An-
the suppression of angiogenesis induced by tumor cells. giogenesis Tubule Staining Kit (for staining CD31) was ob-
tained from TCS Cellworks (Buckingham, U.K.). Total and
MATERIALS AND METHODS phospho-ERK mitogen-activated protein kinase (MAPK)
antibody was purchased from Cell Signaling Technology
Preparation of Electrolyzed Reduced Water (ERW) (Danvers, MA, U.S.A.). 2 ,7 -Dichlorofluorescein diacetate
ERW (oxidation reduction potential, 600 mV; pH 11) was (DCFH-DA) was purchased from Molecular Probes, Inc.
prepared by electrolyzing ultra pure water containing 0.002 M (Eugene, OR, U.S.A.).
NaOH at 100 V for 60 min using an electrolyzing device Measurement of Intracellular H2O2 Scavenging Activ-
equipped with platinum-coated titanium electrodes (TI-200s, ity by ERW H2O2 produced in A549 cells was measured
Nihon Trim Co., Osaka, Japan), and typically contains using DCFH-DA. A549 cells were pretreated with serum-
0.2 ppb Pt Nps when assayed with ICP-MS spectrometer (un- free MEM/ERW for 30 min, and then incubated with 5 m M
published data). A batch type electrolyzing device was used. DCFH-DA for 30 min at 37 °C. DCFH-DA diffused freely
It consisted of a 4-l vessel (190 mm length 210 mm width into cells and was then hydrolyzed by cellular esterases to
140 mm height) divided by a semi-permeable membrane DCFH, which was trapped within the cell. This non-fluores-
(190 mm width 130 mm height, 0.22 mm thickness, pore cent molecule was then oxidized to fluorescent dichlorofluo-
size is not disclosed, Yuasa Membrane System Co., Osaka rescein (DCF) by the action of intracellular H 2O2. Cells were
Japan). Two electrodes (70 mm width 110 mm length) were washed with phosphate-buffered saline (PBS, pH 7.4) to re-
placed at a distance of 55 mm from each side of the semi- move the DCFH-DA. H2O2 levels were measured using flow
permeable membrane. cytometry (EPICS XL System II; Beckman Coulter, U.S.A.)
Cell Culture and Reagents All electrolyzed alkaline by determining the intensity of the fluorescence relative to
ERW was neutralized by adding 1 ml of 10 minimum that of control cells.
Eagle‘s medium (MEM) (pH 7) and 0.2 ml of 1 M 4-(2-hy- Measurement of H2O2 Release H2O2 release from
droxyethyl)piperazine-1-ethanesulfonic acid (HEPES) buffer A549 cells into the culture medium was assayed by a pub-
(pH 5.3) to 9 ml of ERW (pH 11) before use. Human lung lished method.29) Briefly, A549 cells were cultured in a 24-
adenocarcinoma, A549 cells and human diploid embryonic well plate with serum-free MEM/Milli Q or serum-free
lung fibroblast, TIG-1 cells were obtained from the Health MEM/ERW for 24 h. The cells were washed with PBS and
Science Research Resources Bank and maintained in MEM then incubated with an 800 m l reaction buffer (100 m M HVA,
supplemented with 10% fetal bovine serum (FBS) designated 5 units/ml horseradish peroxidase type VI, and 1 mM HEPES
as 10% FBS/MEM (Biowest, France). During the experi- in Hanks balanced salt solution without phenol red, pH 7.4).
ments, A549 cells were cultured with MEM (no FBS) pre- The reaction buffer without cells was treated in the same
pared by dilution of 10 MEM with Milli Q water which way, as a control. This solution was then collected after incu-
designated as serum-free MEM/Milli Q or cultured with bation for 30 min, pH was adjusted to 10.0 with 0.1 M
MEM (no FBS) prepared by dilution of 10 MEM with glycine–NaOH buffer, and fluorescence was then measured
ERW which designated as serum-free MEM/ERW. In a pre- using a fluorescence spectrophotometer (F-2500, Hitachi,
liminary experiment done in the past, we had compared two Japan) at excitation and emission wavelengths of 321 nm and
MEM media prepared either with 0.002 M NaOH aqueous so- 421 nm, respectively.
lution or with Milli Q water to examine whether MEM media Semiquantitative Reverse Transcription-Polymerase
January 2008 21
Chain Reaction (RT-PCR) Total RNA was isolated using was added until tubules developed a dark purple color. Co-
a GenEluteTM Mammalian Total RNA isolation kit (Sigma cultures were then dried and analyzed. Tubule formations in
Chemical Co., St. Louis, MO, U.S.A.) and following the pro- the co-culture system were observed by phase-contrast mi-
tocol provided by the supplier. The primer sequences for croscopy and photomicrographs were documented with a
glyceraldehyde-3 -phosphate dehydrogenase (GAPDH) are digital camera (Olympus, Japan). Recorded images were ana-
5 ACCACAGTCCATGCCATCAC3 (forward) and 5 TC- lyzed by Angiogenesis Image Analysis Software (AngioSys
CACCACCCTGTTGCTGTA-3 (reverse), which amplify a 1.0, TCS, Cellworks, U.K.). Twelve random fields per well
512 bp segment (NCBI Acc#: NM 002046). The common were photographed for tubule formation assessment.
primer sequences for VEGF transcripts are 5 GGGCCTCC- Western Blot Analysis Appropriately treated cells were
GAAACCATGAAC3 (forward) and 5 CTGGTTCCCGA- washed with PBS, and incubated with extraction buffer
AACCCTGAG3 (reverse), which differentiate alternatively (50 mM Tris–HCl pH 7.5, 150 mM NaCl, 1 mM PMSF, 1%
spliced VEGF165 and VEGF121 transcripts by generating NP-40, 0.1% SDS, 10 m g/ml aprotinin and 10 mM EDTA) on
625 bp and 495 bp fragments, respectively.8,30) PCR amplifi- ice. Cells were collected with a scraper. The lysate was then
cation for VEGF was carried out at 94 °C for 45 s of denatur- centrifuged at 12000 g for 5 min. Thirty micrograms of pro-
ing, annealing for 45 s at 60 °C, and extension for 1 min at tein samples were boiled in a ratio of 3 : 1 with sample buffer
72 °C for 35 cycles using Taq polymerase (Takara). Likewise, (250 mM Tris–HCl pH 6.8, 40% glycerol, 20% b -mercap-
PCR amplification for GAPDH was carried out at 94 °C for toethanol, 8% SDS and 0.04% bromophenol blue), and elec-
3.5 min of denaturing, annealing for 30 s at 58 °C, and exten- trophoresed in SDS-PAGE. Resolved proteins were then
sion for 1 min at 72 °C for 30 cycles. The semi-quantitative transferred onto Hybond-ECL membranes (Amersham Bio-
RT-PCR products were not saturated under the conditions science, U.K.), which were blocked with 0.05% Tween 20-
used in the present experiments. Amplified products were re- PBS (T-PBS) containing 10% skim milk powder (Wako,
solved by agarose gel electrophoresis and then photographed Osaka, Japan) and probed with primary and secondary anti-
with a digital camera (ATTO, Tokyo). For densitometric bodies coupled with peroxidase. After washing three times
analysis, recorded images were analyzed by an NIH image with T-PBS, the bound antibody was developed using an
analyzer program (Image 1.62f) using a personal computer. ECL plus Western Blotting Detection System (Amersham
Values below the panel were normalized by arbitrarily setting Biosciences, U.K.).
the density of the VEGF165 and VEGF121 bands of untreated
A549 cells to 1.0. GAPDH transcripts were used as an inter- RESULTS
nal control for cellular activity.
Measurement of VEGF Secreted into the Culture ERW Scavenges Intracellular H2O2 and Decreases the
Medium A549 cells (5 104 cells/well) were seeded in 24- Release of H2O2 from A549 Cells It has been reported
well plates with 10% FBS/MEM and cultured overnight. The that cancer cells produce high amounts of ROS, including
medium was replaced with serum-free MEM/ERW and incu- H2O2,14) and that exogenous ROS stimulates induction of
bated for another 24 h. The conditioned medium was col- VEGF in various cell types.18,31) ERW has been shown to ef-
lected to measure secreted VEGF, which was measured ac- fectively scavenge intracellular ROS in HIT-T15 cells (a
cording to the manufacturer‘s protocol. hamster pancreatic cell line).25) These data together suggest
Preparation of Conditioned Medium and Tubule For- that ERW might regulate VEGF expression by way of ROS.
mation Assay A549 cells (1 106 cells) were seeded in a To test this idea and to ascertain if the ROS scavenging activ-
90 mm dish with 10% FBS/MEM and incubated overnight. ity of ERW is applicable to other cell types, we began by ex-
The medium was replaced with serum-free MEM/Milli Q or amining the scavenging effect of ERW in A549 cells. A549
serum-free MEM/ERW and cultured for 24 h. The condi- cells were treated with MEM containing ERW and then incu-
tioned medium was collected and filtered with a 0.2 m m filter. bated with DCFH-DA. Intracellular H2O2 levels were meas-
Aliquots were stored in a 80 °C deep-freezer. Tubule for- ured using flow cytometry by determining the intensity of the
mation assay was performed with a co-culture system. fluorescence relative to that of control cells, as detailed in the
HUVEC were mixed with TIG-1 cells at 1 : 40, seeded in 24- Materials and Methods. The results showed a reduction of in-
well plates, and cultured in EGM-2 medium overnight. The tracellular H2O2, as the signal curve obtained from ERW-
medium was removed and a mixture of A549 cell condi- treated A549 cells (designated as ―ERW‖) was shifted to the
tioned and EGM-2 media mixed at 2 : 1 was added. The con- left compared with untreated A549 cells (designated as
ditioned medium was changed every 2 d. Tubules formed ―Control‖) (Fig. 1A). This shift of the signal curve would
with different media were detected with HUVEC-specific indicate scavenging of H2O2. Thus ERW was suggested to
markers CD31 (PECAM-1). Briefly, at day 11, the medium scavenge intracellular H2O2 in A549 cells. To test the ROS
was completely removed, and the co-culture plate was fixed scavenging activity of ERW, we examined the effect of ERW
for 30 min with 70% ethanol solution. After incubation with on the release of H2O2 from A549 cells. Our test method was
PBS containing 1% bovine serum albumin (BSA), the co- based on the conversion of homovanillic acid, a substituted
culture plate was incubated with a mouse anti-human CD31 phenol, to its fluorescent dimer in the presence of H2O2 and
antibody (1 : 4000) for 60 min, followed by another 60 min horseradish peroxidase. As shown in Fig. 1B, when A549
incubation with a secondary goat anti-mouse IgG antibody cells were pre-treated with ERW for 24 h, the release of H2O2
conjugated with alkaline phosphatase (both antibodies were from A549 cells decreased to approximately 40% compared
included in the Tubule Staining Kit). After washing the cul- to non-treated control (p 0.05). Thus, the results confirmed
ture plate, 5-bromo-4-chloro-3-indolylphosphate toluidine a previous report.25)
salt/nitro-blue tetrazolium chloride (BCIP/NBT) substrate The present results from two different assays capable of
January 2008 22
Fig. 2. ERW Down-Regulates VEGF Transcription and Secretion

(A) Four sets of A549 cells were treated with ERW for 0.5, 4 and 24 h. A549 cells
treated for designated time periods were used to isolate total RNAs. VEGF and
GAPDH transcripts were detected by RT-PCR with an appropriate set of primers, as
shown in Materials and Methods. Values above the panel were normalized by arbitrarily
setting the densitometry of VEGF165 and VEGF121 bands at time zero to 1.0. A GAPDH
transcript was used as an internal control for cellular activity. (B) A549 (5 105 cells)
cells/well were seeded in 24-well plates with 10% FBS/MEM for 0.5, 4 and 24 h. The
medium was replaced with serum-free MEM/ERW for the indicated time periods. The
medium was collected to measure an amount of VEGF secreted by A549 cells, as de-
Fig. 1. Intracellular H2O2 Scavenging Activity of ERW (A) and Suppres- scribed in Materials and Methods. Filled columns ( ), controls cultured in serum-free
sion of H2O2 Release from A549 Cells by ERW (B) MEM/Milli Q; open columns ( ), tests cultured in serum-free MEM/ERW. The results
(A) Cultured A549 cells were pretreated for 30 min with 10% FBS/MEM/ERW, then of 3 independent experiments were analyzed by Student‘s t test (values are the
incubated with 5 m M DCFH-DA for 30 min at 37 °C. The fluorescence intensity of mean S.D., n 3). An asterisk represents a significant difference compared with the
DCFH was measured with a flow cytometer. The fluorescence intensity relative to that control (∗ p 0.05) and p values of 0.05 are considered statistically
of control cells is presented as curves. The curve designated as ―Control‖ is the fluores- significant.
cence intensity obtained from control A549 cells. The curve designated as ―ERW‖ is
the fluorescence intensity obtained from A549 cells treated with ERW. H2O2 scavenging
solve RT-PCR products (Fig. 2A). Ratios of band intensities
activity was judged positive, as the ERW-treatment curve (ERW) was shifted to the left
between different incubation periods for GAPDH and those
compared with the control curve (Control). Mn X in the ERW and Control panels
means the mean of fluorescence intensity. A representative result is shown from three
for the two VEGF isoform products were used to compare
independent experiments. (B) ERW was added to A549 cells in culture followed by fur-
time dependent transcription levels (Fig. 2). The results
ther 24 h incubation. Released H2O2 in the culture media was measured as described in
Materials and Methods. Differences were analyzed by Student‘s t test (values are the
showed that ERW treatment down-regulated transcriptions of
mean S.D., n 3). An asterisk represents a significant difference compared with con-
trols (∗ p 0.05) and p values of VEGF165 and VEGF121 in a time-dependent manner. Notably,
0.05 are considered statistically
significant. when the cells were treated with ERW for 24 h, VEGF tran-
scription was significantly suppressed, while that of GAPDH
measuring endogenous and exogenous H2O2 levels clearly changed little; indicating that the results were not due to the
demonstrated that ERW has the potential to reduce and/or cytotoxic effects of ERW (Fig. 2A).
scavenge H2O2. VEGF is known to be secreted outside tumor cells to exert
ERW Inhibits Both VEGF Gene Expression and Extra- its angiogenic effect by stimulating proliferation and migra-
cellular Secretion in A549 Cells As we had confirmed tion of endothelial cells.18) Therefore, the effect of ERW on
that ERW reduces H2O2 production from A549 cells, we in- the secretion of VEGF in A549 cells was tested. The secre-
vestigated using an RT-PCR method to determine if H2O2 tion of VEGF from control cells increased in a time-depend-
and VEGF levels are coordinately regulated by ERW in A549 ent manner, whereas ERW gradually suppressed the increase
cells. in the VEGF secretion (Fig. 2B). A significant difference
Primers were designed to amplify a 495 bp product for the in the secreted VEGF accumulations between control
VEGF121 transcript and a 625 bp product for the VEGF165 (1217.94 61.83 pg/ml) and treated samples (1095.53
transcript. Agarose gel electrophoresis was performed to dis- 21.50 pg/ml) was only observed when A549 cells were
January 2008 23
treated with ERW for 24 h (p 0.05, Fig. 2B). This delayed VEGF gene transcription.
response of VEGF protein secretion compared to VEGF Further experiments were performed to determine whether
gene transcription level, which after 4 h treatment reduced to ERW-induced down-regulation of VEGF expression is due to
approximately 30—40%, may be attributable to assay point the suppression of ERK1/2 phosphorylation. Western blot
differences, i.e., transcription and accumulated protein levels analyses showed that phosphorylation of ERK decreased in a
because RT-PCR detects specific transcripts directly at spe- time-dependent manner from 0.5 to 4 h. After 4 h, the phos-
cific time points while VEGF assay detects accumulated total pho-ERK level remained low for up to 24 h, even after ex-
VEGF165 protein during the incubation periods indicated. tended ERW treatment. The total amount of ERK MAPK
ERW Inactivates ERK1/2 VEGF gene transcription protein was unaffected by ERW treatment (Fig. 3B). These
was demonstrated to be regulated by ERW, suggesting that its results further strengthened the results shown in Fig. 3A.
action point is at a gene transcription level and/or at signal They also suggested that MEK is involved in the regulation
transduction pathway levels upstream to transcription initia- of VEGF transcription via ERK phosphorylation.
tion complexes. As an initial step, the signal transduction Effect of ERW on Vascular Tubule Formation Induced
pathway involved in regulating VEGF gene expression was by A549 Cells Exogenous ROS is known to stimulate
investigated using MAPK specific inhibitors, SB203580 (p38 VEGF production18) and to promote tubular morphogenesis
MAPK inhibitor), PD98059 (MEK inhibitor which is an up- in endothelial cells.32) To evaluate the effect of ERW on
stream kinase of the ERK pathway) and JNKi (JNK in- tubule formation, four parameters; tubule area, number of
hibitor). For this purpose, the same RT-PCR assay system junctions, number of tubules, and total tube length, were
and analysis methods, as in Fig. 2A, were used to quantify measured. For this, a co-culture of HUVEC and TIG cells
VEGF transcripts (Fig. 3A). The results showed that only was incubated with mixtures of EGM-2 medium and non-
PD98059 blocked VEGF expression, suggesting an impor- conditioned MEM (Fig. 4A, Control), A549 conditioned
tant role for the Ras-Raf-MEK-ERK pathway, particularly MEM (Fig. 4B, A549 CM), and ERW-treated A549 condi-
ERK1/2 factor, in regulating VEGF expression in A549 cells tioned MEM (Fig. 4C, ERW-A549 CM) at a ratio of 1 : 2, re-
(Fig. 3A). Other inhibitors, SB203580 and JNKi, did not spectively. Co-cultures treated with the A549 conditioned
show any significant inhibitory effect on VEGF gene tran- MEM significantly increased the formation of vascular
scription, indicating that the JNK/stress activated protein ki- tubules in all analyzed parameters in comparison with con-
nase (SAPK) and p38 pathways were not directly involved in trol; that is, a 76% increase on total tubule areas, a 200% in-
crease of the number of tubule junctions, a 179% increase of
Fig. 3. VEGF Expression Is Down-Regulated via Inactivation of the ERK

Pathway
(A) A549 cells were treated with serum-free MEM containing SB203580 (10 m M),
PD98059 (20 m M) or JNK inhibitor II (40 nM) for 24 h and total RNAs isolated. Total Fig. 4. Effects of ERW on A549 Cell Conditioned Medium-Induced Vas-
RNAs were used to amplify VEGF165 and VEGF121 transcripts by RT-PCR with respec-
tive primer sets. Amplified products were resolved in an agarose gel electrophoresis and cular Tubule Formation
bands were photographed and documented using a digital camera. Recorded images HUVEC/TIG-1 co-culture in a 24-well plate was challenged with mixtures of EGM-
were analyzed by an NIH image analyzer program (Image 1.62f) using a personal com- 2 medium and non-conditioned MEM (A. Control), A549 cell conditioned MEM (B.
puter. Values above the panel were normalized by arbitrarily setting the densitometry of A549 CM) and ERW-treated A549 cell conditioned MEM (C. ERW-A549 CM) mixed
VEGF165 and VEGF121 bands at time zero to 1.0. A GAPDH transcript was used as an at 1 : 2, respectively. Media were changed every 2 d. At day 11, tubule formations were
internal control for cellular activity. Control: no inhibitor, SB: SB203580 (p38 MAPK detected with a Tubule Staining Kit and visualized by phase-contrast microscopy. Pho-
inhibitor), PD: PD98059 (MEK inhibitor), JNKi: JNK inhibitor. (B) A549 cells were tomicrographs from a digital camera were used to characterize tubules. Recorded im-
incubated in serum-free MEM/ERW for the indicated time periods. Cell lysates were ages were analyzed by angiogenesis quantification software (D). Twelve random fields
prepared and 30 m g proteins from each lysate were resolved by SDS-PAGE and used for per well were pictured for tubule formation assessment. Data are expressed as a per-
Western-blot analysis as described in Materials and Methods. Total- and phospho-ERK centage of the total area, the number of junctions, the number of tubules and the total
were detected using Total- and phospho-ERK MAPK antibodies. Values above the tube length in untreated control cells (mean S.E.). Asterisks represent a significant
panel were normalized by arbitrarily setting the densitometry of phospho-ERK band to difference compared with controls (∗ ∗ p 0.01). p values of 0.05 were considered
1.0. Total ERK was used to monitor cellular activity. sta-
tistically significant.
January 2008 24
the number of tubules, and a 65% increase of total tubule ciency of ERW on ERK activation is only short-term. The in-
length, respectively (Fig. 4D: compares control and A549 hibition of constitutive VEGF expression in A549 cells can
CM). Taking these results into consideration, conditioned be partially ascribed to the blockade of ERK activation by
medium derived from A549 cells cultured with ERW (ERW- ERW. Also, we considered possible transcription factor(s) in-
A549 CM) was used to see how ERW influences the tubule volved in regulating VEGF gene transcription in relation to
formation parameters. The results showed that ERW treat- ROS. Exogenous stimulation of cultured cells by hydrogen
ment affected only the total tubule length, decreasing it at a peroxide (H2O2) was shown to up-regulate VEGF mRNA in a
statistically significant level compared to A549 CM treated dose- and time-dependent manner. VEGF mRNA activation
cells (p 0.01, Fig. 4D: see total tubule length). Although, was also shown to correlate with an enhanced binding of AP-
the total tubule length parameter is commonly used for quan- 1 and NF-k B.60) NF-k B resides in the cytoplasm complexed
titative analysis of tubule formation, other parameters were with the inhibitor protein I-k B masking the nuclear localiza-
also measured. ERW was shown to exert its influence by tion signal of NF-k B. NF-k B is activated by H2O2 treatment
marginally suppressing the other three parameters, though through phosphorylating I-k B to release NF-k B for nuclear
not to a statistically significant level (Fig. 4D). These results translocation via the Ras mitogen-activated protein kinase
strongly suggested that ERW exerts an inhibitory effect on (MAPK) pathway.61) Our present results with specific in-
tumor-induced angiogenesis by way of down-regulating H2O2 hibitors showed that MAPK pathway (p38 and JNK) is not
release and VEGF secretion from A549 cells (Fig. 4). involved (Fig. 3) and thus VEGF mRNA activation by NF-
k B is excluded. On the other hand, AP-1 is considered as a
DISCUSSION redox-sensitive transcription factor62) and thus VEGF mRNA
up-regulation by H2O2 is likely to involve AP-1. Another
Our findings suggest that ERW reduces H2O2 induced transcription factor, ETS-1, is up-regulated by H2O2 via HIF-
VEGF expression in a human lung adenocarcinoma cell line, 1a which is stabilized by H2O2.63,64) The HIF-1a (120 kDa)
A549. As cancer cells produce ROS, including H2O2, the re- is complexed with HIF-1b (94 kDa) subunit forming func-
lease of H2O2 could be a trigger for the angiogenic process in tional HIF-1 (hypoxia-inducible factor-1). HIF-1a is the rate
those cancer cells.9,11,12,14) As well, H2O2 has also been shown limiting subunit which determines the activity of the HIF-1
to induce significant VEGF expression in various cell complex.65) HIF-1a is a short lived protein that is maintained
types.33—35) As well, tumor vascularity has been shown to be at low and often undetectable levels in normoxia, whereas it
directly correlated with VEGF production by tumors.36—41) is strongly induced in hypoxic cells.66) We showed that ERW
Blockade of tumor secreted VEGF by an anti-VEGF anti- scavenges endogenous as well as exogenous H2O2 (Fig. 1)
body caused significant damage on endothelial cells.42) These suggesting that HIF-1 regulated ETS-1 involvement is less
results together strongly support the hypothesis that the likely. However, it has been shown that ETS-1 promoter con-
blockade of H2O2 release and VEGF secretion from cancer tains several transcription factor binding sites including AP-
cells has therapeutic value by conferring an antiangiogenic 167) and AP-1 is considered as a redox-sensitive transcription
effect. Along this line, antioxidants such as N-acetylcystein, factor.62) Taking all these information into considerations, we
vitamin E, catechins, and natural polyphenols from red wine deduced AP-1 as the prime candidate for up-regulating
have been evaluated for their efficacy, with positive re- VEGF transcription.
sults.42—47) Present results uncovered that mRNA levels were dramati-
The signal transduction pathway for VEGF expression is cally decreased in the cells treated by ERW while secreted
highly divergent and is cell type dependent. Involvement of protein levels decreased rather slowly. Drastic mRNA decline
both phosphatidylinositol 3 -kinase and MAPK/ERK kinase could be interpreted as that the half-life of VEGF mRNA is
1/2 in the regulation of VEGF expression is reported in astro- 42 min68) and 43 6 min69) under normoxic conditions, while
cytomas48) and head and neck squamous cell carcinoma,49) the average half-life of eukaryotic mRNA is 10—12 h.70) Fur-
while phosphatidylinositol 3 -kinase pathway, but not ERK thermore, the VEGF mRNA contains destabilizing elements
MAPK regulated VEGF expression is involved in hepatocel- in its 5 UTR, coding region and 3 UTR, and three elements
lular carcinoma.50) As well, p38 MAPK is reported to affect act additively to execute rapid degradation under normoxic
VEGF expression in vascular smooth muscle,43) and breast conditions.71) Our experiments were carried out under nor-
cancer51) cells, while ERK MAPK does so in fibroblasts,52) moxic conditions and therefore mRNA is considered to be
and colon carcinoma.53) In the present study, at least ERK short lived. In addition, the activities of hydrogen peroxide
was proven to be involved in regulation of VEGF expression (H2O2) regulated transcription factors would also be de-
in lung adenocarcinoma A549 cells, because only PD98059 creased due to lowered H2O2 levels by scavenging activity of
blocked VEGF expression in the cells (Fig. 3). ERW. Considering incubation times (0.5, 4.0, 24 h) used and
ERK activation is sensitive to redox stress.54—58) Thus, the short-half life of VEGF mRNA as well as lowered transcrip-
reduction of redox stress induced in cells or the neutralization factor(s) together would explain the drastic decrease of
tion of exogenous oxidative stress may block activation of VEGF mRNA levels in the present experimental conditions
ERK MAPK, which can lead to an alteration of the target (Fig. 3A). VEGF protein secreted in the medium is not dras-
gene expression. Epigallocatechin gallate, an antioxidant tically decreased as mRNA does. Our interpretation is that
contained in green tea, inhibited VEGF expression via the the levels of VEGF protein assayed are cumulative instead of
suppression of ERK activation in HT29 human colon cancer time point levels. Thus the amount of protein will be accu-
cells.59) In the current study, ERW inactivated ERK in a time- mulated as incubation time is extended up to 24 h. At 24 h
dependent manner, within 4 h, after which ERW showed no point, control medium contains 1217.94 61.83 pg/ml while
further effect on ERK activation. This indicated that the effi- ERW treated medium contains 1095.53 21.50 pg/ml and
January 2008 25
thus ERW treated medium still contains ca. 85% of VEGF derstanding of the biological differences between cancer and
protein (Fig. 2B). Then, one would expect that more VEGF normal cells is necessary. It will also be necessary to seek
protein exist in the conditioned medium, more tubule forma- out appropriate therapeutic agents that can block the biologi-
tion will result. ERW could have reduced ca. 15% VEGF cal events critical for cancer cells, but not those for normal
protein compared to control after 24 h incubation and thus cells. Cancer cells, as compared to normal ones, are exposed
the tubule formation is exerted by ca. 85% VEGF protein. to higher oxidative stresses associated with oncogenic trans-
Three criteria show the suppressive tendencies though not formation, alterations in metabolic activity, and increased
statistically significant levels, and showed significant reduc- generation of ROS. ERW possesses an advantage over many
tion in the total tubule length only (Fig. 4D). Therefore, vas- other antioxidants in that cancer cells with higher oxidative
cular tubule formation assay is in accordance with the pro- stress are more likely to be affected by ERW, whereas normal
tein levels detected in Fig. 2B (Fig. 4D). cells are not.
The mechanism underlying how ERW effectively scav- Taken together, we demonstrated here for the first time that
enges intracellular H2O2 remains to be clarified in more de- ERW can suppress angiogenesis induced by A549 cells
tail. ERW contains a high concentration of hydrogen mole- through down-regulating both H2O2 release and VEGF ex-
cule, however, hydrogen molecule is chemically inert at room pression. Moreover, our study suggested that ERK MAPK
temperature. In an attempt to overcome this challenging plays a critical role in regulating VEGF expression in A549
problem, Shirahata et al. proposed an active hydrogen hy- cells, and that inhibition of VEGF by ERW partially corre-
pothesis of reduced water in which active hydrogen with a lated with inactivation of ERK MAPK.
high reducing potential was produced in ERW by electrolysis While the present results have pointed out the intracellular
and played a key role in scavenging ROS.24,72) Active hydro- target sites regulated by ERW, what component(s) in ERW
gen can be produced from hydrogen molecule by catalysis actually scavenged intracellular H2O2 remains to be eluci-
action of noble metal nanoparticles like platinum nanoparti- dated. Future investigations need to be directed to clarifying
cles.73) Transition metal nanoparticles such as Pd, Pt, Ni, and the reducing agent(s) in ERW. Also, our future studies could
Cu are produced during the process of electrolysis.74) Plat- be directed to perform similar experiments under normoxic
inum nanoparticles have also been demonstrated to adsorb and hypoxic conditions to learn ERW effects at the gene ex-
active hydrogen.75) Synthetic platinum nanoparticles were pression levels which include confirmation of AP-1 involve-
shown to scavenge superoxide radicals.76) There is a possibil- ment.
ity that platinum nanoparticles derived from platinum-coated
titanium electrode used here during electrolysis and metal
REFERENCES
nanoparticls of 1—10 nm size can stably exist in solution for
a long time.74) Taken together, here we propose a new hy- 1) Hicklin D. J., Ellis L. M., J. Clin. Oncol., 23, 1011—1027 (2005).
pothesis of reduced water containing metal nanoparticles and 2) Ferrara N., Trends Cardiovasc. Med., 3, 244—250 (1993).
hydrogen molecule as follows: (1) Electrolysis produces ac- 3) Senger D. R., Perruzzi C. A., Feder J., Dvorak H. F., Cancer Res., 46,
tive hydrogen on the cathodic platinum electrode and hyper- 5629—5632 (1986).
4) Kunz M., Ibrahim S. M., Mol. Cancer, 2, 23—35 (2003).
saturated hydrogen molecule in ERW. (2) Metal ions in the 5) Berse B., Brown L. F., Van de Water L., Dvorak H. F., Senger D. R.,
solution are reduced to metal nanoparticles on the electrode Mol. Biol. Cell, 3, 211—220 (1992).
or in hydrogen-rich ERW. (3) Transition metal nanoparticles 6) Brown L. F., Berse B., Jackman R. W., Tognazzi K., Guidi A. J., Dvo-
with low ionic tendencies adsorbed or absorbed active hydro- rak H. F., Senger D. R., Connolly J. L., Schnitt S. J., Am. J. Pathol.,
gen can exist stably in ERW but other metal nanoparticles 143, 1255—1262 (1993).
7) Sato K., Terada K., Sugiyama T., Takahashi S., Saito M., Moriyama
with high ionic tendencies such as Na and K disappear in M., Kakinuma H., Suzuki Y., Kato M., Kato T., Tohoku J. Exp. Med.,
ERW soon. (4) Hydrogen molecule is constantly converted to 173, 355—360 (1994).
active hydrogen, which can scavenge ROS, by the catalysis of 8) Takahashi H., Shibuya M., Clin. Sci., 109, 227—241 (2005).
metal nanoparticles. Some kinds of metal nanoparticles like 9) Monte M., Davel L. E., De Lustig S., Eur. J. Cancer, 33, 676—682
platinum nanoparticles can also directly scavenge ROS with- (1997).
10) Nilanjana M., Dipak K. D., Free Radic. Biol. Med., 33, 1047—1060
out hydrogen molecule. (2002).
On the other hand, Kikuchi et al. hypothesized, in attempt- 11) Stone J. R., Collins T., Endothelium, 9, 231—238 (2002).
ing to elucidate the ROS scavenging substance(s) in ERW, 12) Qian Y., Luo J., Leonard S. S., Harris G. K., Millecchia L., Flynn D.
that activated molecular hydrogen or hydrogen nanobubbles C., Shi X., J. Biol. Chem., 278, 16189—16197 (2003).
13) Ushio-Fuaki M., Cardiovasc. Res., 71, 226—235 (2006).
are responsible for the reducibility of ERW.77—81) Recently, 14) Szatrowski T. P., Nathan C. F., Cancer Res., 51, 794—798 (1991).
molecular hydrogen was demonstrated to act as a selective 15) Yoshida T., Maulik N., Engelman R. M., Ho Y.-S., Magnenat J.-L.,
antioxidant against cytotoxic oxygen radicals like hydroxyl Rousou J. A., Flack J. E., III, Deaton D., Das D. K., Circulation, 96,
radical and peroxynitrite.82) Hiraoka et al. reported that ERW 216—220 (1997).
and several natural mineral waters also possess reducing ac- 16) Das D. K., Engelman R. M., Rousou J. A., Breyer R. H., Otani H.,
Lemeshow S., Basic Res. Cardiol., 81, 155—166 (1986).
tivities and hypothesized that it is due to molecular hydrogen 17) Tosaki A., Droy-Lefaix M. T., Pali T., Das D. K., Free Radic. Biol.
and/or reductive vanadium ions.83,84) Hanaoka et al. sug- Med., 14, 361—370 (1993).
gested that the enhancement of superoxide anion radical dis- 18) Chua C. C., Handy R. C., Chua B. H. L., Free Radic. Biol. Med., 25,
mutation activity can be explained by changes in the ionic 891—897 (1998).
product of water in ERW.85,86) 19) Inoue M., Itoh H., Tanaka T., Chun T.-H., Doi K., Fukunaga Y.,
Sawada N., Yamshita J., Masatsugu K., Saito T., Sakaguchi S., Sone
Major drawbacks of cancer chemotherapy are the various M., Yamahara K., Yurugi T., Nakao K., Arterioscler Thromb. Vasc.
side-effects of the drugs used and the resistance that can be Biol., 21, 560—566 (2001).
developing to these drugs. To resolve these problems, an un- 20) Nakae H., Inaba H., J. Trauma, 49, 511—514 (2000).
26 Vol. 31, No. 1
21) Koseki S., Itoh K., J. Food Prot., 64, 1935—1942 (2001). 53) Jung Y. D., Nakano K., Liu W., Gallick G. E., Ellis L. M., Cancer Res.,
22) Vorobjeva N. V., Vorobjeva L. I., Khodjaev E. Y., Artif. Organs, 28, 59, 4804—4807 (1999).
590—592 (2004). 54) Guyton K. Z., Liu Y., Gorospe M., Xu Q., Holbrook N. J., J. Biol.
23) Fujiyama Y., Koyama S., Bamba T., Tashiro H., Ono H., Kitahora T., Chem., 271, 4138—4142 (1996).
7th Functional Water Symposium Abstract, 2000, pp. 74—75. 55) Aikawa R., Komuro I., Yamazaki T., Zou Y., Kudoh S., Tanaka M., Shi-
24) Shirahata S., Kabayama S., Nakano M., Miura T., Kusumoto K., ojima I., Hiroi Y., Yazaki Y., J. Clin. Invest., 100, 1813—1821 (1997).
Gotoh, M., Hayashi H., Otsubo K., Morisawa S., Katakura Y., 56) Abe M. K., Kartha S., Karpova A. Y., Li. J., Liu P. T., Kuo W. L., Her-
Biochem. Biophys. Res. Commun., 234, 269—274 (1997). shenson M. B., Am. J. Respir. Cell. Mol. Biol., 18, 562—569 (1998).
25) Li Y. P., Nishimura T., Teruya K., Tei M., Komatsu T., Hamasaki T., 57) Wang X., Martindale J. L., Liu Y., Holbrook N. J., Biochem. J., 333,
Kashiwagi T., Kabayama S., Shim S.-Y., Katakura Y., Osada K., 291—300 (1998).
Kawahara T., Otsubo K., Morisawa S., Ishii Y., Gadek Z., Shirahata S., 58) Gaitanaki C., Konstantina S., Chrysa S., Beis I., J. Exp. Biol., 206,
Cytotechnology, 40, 139—140 (2002). 2759—2769 (2003).
26) Huang K.-C., Yang C.-C., Lee K.-T., Chien C.-T., Kidney Int., 64, 59) Jung Y. D., Kim M. S., Shin B. A., Chay K. O., Ahn B. W., Liu W., Bu-
704—714 (2003). cana C. D., Gallick G. E., Ellis L. M., Br. J. Cancer, 84, 844—850
27) Huang K.-C., Yang C.-C., Hsu S.-P., Lee K.-T., Kiu H. W., Morisawa (2001).
S., Otsubo K., Chen C.-T., Kidney Int., 70, 391—398 (2006). 60) Chua C. C., Handy R. C., Chua B. H. L., Free Radic. Biol. Med., 25,
28) Kim M.-J., Kim H. K., Life Sci., 79, 2288—2292 (2006). 891—897 (1998).
29) Ruch W., Cooper P. H., Baggiolini M., J. Immunol. Methods, 63, 61) Eyries M., Collins T., Khachigian L. M., Endothelium, 11, 133—139
347—357 (1983). (2004).
30) Tischer E., Mitchell R., Hartman T., Silva M., Gospodarowicz D., Fid- 62) Ordway J. M., Eberhart D., Curraqn T., Mol. Cell. Biol., 23, 4257—
des J. C., Abraham J. A., J. Biol. Chem., 286, 11947—11954 (1991). 4266 (2003).
31) Ruef J., Hu Z. Y., Yin L.-Y., Wu Y., Hanson S. R., Kelly A. B., Harker 63) Wilson L. A., Gemin A., Espiritu R., Singh G., FASEB J., express arti-
L. A., Rao G. N., Runge M. S., Patterson C., Circ. Res., 81, 24—33 cle 10.1096/fj.05-4401fje (2005).
(1997). 64) Oikawa M., Abe M., Kurosawa H., Hida W., Biochem. Biophys. Res.
32) Shono T., Ono M., Izumi H., Jimi S.-I., Matsushima K., Okamoto T., Commun., 289, 39—43 (2001).
Kohno K., Kuwano M., Mol. Cell Biol., 16, 4231—4239 (1996). 65) Huang L. E., Arany Z., Livingston D. M., Bunn H. F., J. Biol. Chem.,
33) Brauchle M., Oliver F. J., Kind P., Werner S., J. Biol. Chem., 271, 271, 32253—32259 (1996).
21793—21797 (1996). 66) Berra E., Pages G., Pouyssegur J., Cancer Metastasis Rev., 19, 139—
34) Cho M., Hunt T. K., Hussain M. Z., Am. J. Physiol. Heart Circ. Phys- 145 (2000).
iol., 280, H2357—H2363 (2001). 67) Chen J. H., Wright C. D., Oncogene, 8, 3375—3383 (1993).
35) Zhu J.-W., Yu B.-M., Ji Y.-B., Zheng M.-H., Li D.-H., World J. Gas- 68) Liu L. X., Lu H., Luo Y., Date T., Belanger A. J., Vincent K. A., Akita
troenterol., 8, 153—157 (2002). G. Y., Goldberg M., Cheng S. H., Gregory R. J., Jiang C., Biochem.
36) Berkman R. A., Merrill M. J., Reinhold W. C., Monacci W. T., Saxena Biophys. Res. Commun., 291, 908—914 (2002).
A., Clark W. C., Robertson J. T., Ali I. U., Oldfield E. H., J. Clin. In- 69) Levy A. P., Levy N. S., Goldberg M. A., J. Biol. Chem., 271, 2746—
vest., 91, 153—159 (1993). 2753 (1996).
37) Wizigmann-Voss S., Breier G., Risau W., Cancer Res., 55, 1358— 70) Yoo P. S., Mulkeen A. L., Cha C. H., World J. Gastroenterol., 12,
1364 (1994). 4937—4942 (2006).
38) Guidi A. J., Abu-Jawdeh G., Berse B., Jackman R. W., Tognazzi K., 71) Dibbens J. A., Miller D. L., Damert A., Risau W., Vadas M. A.,
Dvorak H. F., Brown L. F., J. Natl. Cancer Inst., 87, 12137—12145 Goodall G. J., Mol. Biol. Cell., 10, 907—919 (1999).
(1995). 72) Shirahata S., ―Animal Cell Technology: Basic & Applied Aspects,‖
39) Mattern J., Koomagi R., Volm M., Br. J. Cancer, 73, 931—934 (1996). Proceedings of the 13th JAACT Meeting, 16—21 November, 2000, ed.
40) Suzuki K., Hayashi N., Miyamoto Y., Yamamoto M., Ohkawa K., Ito by Shirahata S., Teruya K., Katakura Y., Kluwer, Fukuoka-Karatsu,
Y., Sasaki Y., Yamaguchi Y., Nakase H., Noda K., Enomoto N., Arai Japan, 2002, pp. 25—30.
K., Yamada Y., Yoshihara H., Tujimura T., Kawano K., Yoshikawa K., 73) Minaev B., Ågren H., J. Mol. Catal. A, 149, 179—195 (1999).
Kamada T., Cancer Res., 56, 3004—3009 (1996). 74) Roucoux A., Schulz J., Patin H., Chem. Rev., 102, 3757—3778 (2002).
41) Balsari A., Maier J. A., Colnaghi M. I., Menard S., Lab. Invest., 79, 75) Isobe Y., Yamauchi M., Ikeda R., Kitagawa H., Synthetic Metals,
897—902 (1999). 135—136, 757—758 (2003).
42) Malafa M. P., Fokum F. D., Smith L., Louis A., Ann. Surg. Oncol., 9, 76) Hamasaki T., Kashiwagi T., Aramaki S., Imada T., Komatsu T., Li Y.,
1023—1032 (2002). Teruya K., Katakura Y., Kabayama S., Otubo K., Morisawa S., Shira-
43) Oak M.-H., Chataigneau M., Keravis T., Chataigneau T., Beretz, A., hata S., ―Animal Cell Technology Meets Genomics,‖ Proceedings of
Andriantsitohaina R., Stoclet J.-C., Chang S.-J., Schini-Kerth V. B., Ar- the 18th ESACT Meeting, 11—14 May, 2003, ed. by Godia F.,
terioscler. Thromb. Vasc. Biol., 23, 1001—1007 (2003). Fussenegger M., Springer, Granada, Spain, 2005, pp. 249—251.
44) Agarwal A., Munoz-Najar U., Klueh U., Shih S.-C., Claffey K. P., Am. 77) Kikuchi K., Takeda H., Rabolt B., Okaya T., Ogumi Z., Saihara Y.,
J. Pathol., 164, 1683—1696 (2004). Noguchi H., J. Electroanal. Chem., 506, 22—27 (2001).
45) Castilla M. A., Neria F., Renedo G., Pereira D. S., Gonzalez-Pacheco 78) Kikuchi K., Takeda H., Rabolt B., Okaya T., Ogumi Z., Saihara Y.,
F. R., Jimenez S., Tramon P., Deudero J. J. P., Arroyo M. V. A., Yaguee Noguchi H., J. Appl. Electrochem., 31, 1301—1306 (2001).
S., Caramelo C., Am. J. Physiol. Cell. Physiol., 286, C1170—C1176 79) Kikuchi K., Tanaka Y., Saihara Y., Maeda M., Kawamura M., Ogumi
(2004). Z., J. Colloid Interface Sci., 298, 914—919 (2006).
46) Tang F.-Y., Chiang E.-P. I., Shih C.-J., J. Nutr. Biochem., 18, 391—399 80) Kikuchi K., Tanaka Y., Saihara Y., Ogumi Z., Electrochim. Acta, 52,
(2007). 904—913 (2006).
47) Sadowska A. M., Manuel-y-Keenoy B., De Backer W. A., Pulm. Phar- 81) Kikuchi K., Nagata S., Tanaka Y., Saihara Y., Ogumi Z., J. Elec-
macol. Ther., 20, 9—22 (2007). troanal. Chem., 600, 303—310 (2007).
48) Woods S. A., McGlade C. J., Guha A., Neuro-Oncology, 4, 242—252 82) Ohsawa I., Ishikawa M., Takahashi K., Watanabe M., Nishimaki K.,
(2002). Yamagata K., Katsura K.-I., Katayama Y., Asoh S., Ohta S., Nat. Med.,
49) Dong G., Chen Z., Li Z. Y., Yeh N. T., Bancroft C. C., Van Waes C., 13, 688—694 (2007).
Cancer Res., 61, 5911—5918 (2001). 83) Hiraoka A., Takemoto M., Suzuki T., Shinohara A., Chiba M., Shirao
50) Huang G. W., Yang L. Y., Lu W. Q., World J. Gastroenterol., 10, 809— M., Yoshimura Y., J. Health Sci., 50, 456—465 (2004).
812 (2004). 84) Hiraoka A., Sasaki S., Yamada T., Shinohara A., Chiba M., J. Health
51) Xiong S., Grijalva R., Zhang L., Nguyen N. T., Pisters P. W., Pollock Sci., 52, 817—820 (2006).
R. E., Yu D., Cancer Res., 61, 1727—1732 (2001). 85) Hanaoka K., J. Appl. Electrochem., 31, 1307—1313 (2001).
52) Milanini J., Vinals F., Pouyssegur J., Pages G., J. Biol. Chem., 273, 86) Hanaoka K., Sun D., Lawrence R., Kamitani Y., Fernandes G., Bio-
18165—18172 (1998). phys. Chem., 107, 71—82 (2004).
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 1999, p. 4276–4279 Vol. 65, No. 9
0099-2240/99/$04.0010
Copyright © 1999, American Society for Microbiology. All Rights Reserved.
Efficacy of Electrolyzed Oxidizing Water for Inactivating

Escherichia coli O157:H7, Salmonella enteritidis,
and Listeria monocytogenes
KUMAR S. VENKITANARAYANAN, 1 GABRIEL O. EZEIKE,2 YEN-CON HUNG,2
2
AND MICHAEL P. DOYLE *
Department of Animal Science, University of Connecticut, Storrs, Connecticut 06269,1

and Center for Food Safety and Quality Enhancement, College of Agricultural and
Environmental Sciences, University of Georgia, Griffin, Georgia 30223-17972
Received 14 December 1998/Accepted 18 June 1999
The efficacy of electrolyzed oxidizing water for inactivating Escherichia coli O157:H7, Salmonella enteritidis,
and Listeria monocytogenes was evaluated. A five-strain mixture of E. coli O157:H7, S. enteritidis, or L. mono-
cytogenes of approximately 108 CFU/ml was inoculated in 9 ml of electrolyzed oxidizing water (treatment) or 9
ml of sterile, deionized water (control) and incubated at 4 or 23°C for 0, 5, 10, and 15 min; at 35°C for 0, 2, 4,
and 6 min; or at 45°C for 0, 1, 3, and 5 min. The surviving population of each pathogen at each sampling time
was determined on tryptic soy agar. At 4 or 23°C, an exposure time of 5 min reduced the populations of all three
pathogens in the treatment samples by approximately 7 log CFU/ml, with complete inactivation by 10 min of
exposure. A reduction of >7 log CFU/ml in the levels of the three pathogens occurred in the treatment samples
incubated for 1 min at 45°C or for 2 min at 35°C. The bacterial counts of all three pathogens in control samples
remained the same throughout the incubation at all four temperatures. Results indicate that electrolyzed
oxidizing water may be a useful disinfectant, but appropriate applications need to be validated.
Enterohemorrhagic Escherichia coli O157:H7, Salmonella low concentration of sodium chloride (0.1%) in an electrolysis
enteritidis, and Listeria monocytogenes are food-borne patho- chamber where anode and cathode electrodes were separated
gens of major public health concern in the United States. A by a diaphragm imparted strong bactericidal and virucidal
variety of foods, including poultry, eggs, meat, milk, fruits, and properties to the water collected from the anode (EO water).
vegetables, have been implicated as vehicles of one or more of Water from the anode normally has a pH of 2.7 or lower, an
these pathogens in outbreaks of food-borne illness (2, 4, 5). oxidation-reduction potential (ORP) greater than 1,100 mV,
The Pathogen Reduction program of the U.S. Department of and a free-chlorine concentration of 10 to 80 ppm (10). EO
Agriculture Food Safety and Inspection Service recommends water has been experimentally used in Japan by medical and
antimicrobial treatments as a method for reducing or inacti- dental professionals for treating wounds or disinfecting medi-
vating pathogenic bacteria in foods (13). Effective methods of cal equipment. The objective of this study was to evaluate the
reducing or eliminating pathogens in foods are important to efficacy of EO water for killing E. coli O157:H7, S. enteritidis,
the successful implementation of Hazard Analysis and Critical and L. monocytogenes with a view to its potential application to
Control Point (HACCP) programs by the food industry and for foods and food contact surfaces as an antimicrobial treatment.
the establishment of critical control points in restaurants, homes, Bacterial culture and media. Five strains each of E. coli
and other food service units. Washing of raw agricultural pro- O157:H7, S. enteritidis, and L. monocytogenes were used for the
duce with water is practiced in the industry; however, washing study. The five strains of E. coli O157:H7 (with origins in pa-
alone does not render the product completely free from patho- rentheses following strain designations) were E06 (milk), E08
gens. Although many chemicals generally recognized as safe (meat), E10 (meat), E16 (meat), and E22 (calf feces). The S.
(GRAS), including organic acids, possess antimicrobial activity enteritidis isolates included SE180 (human), SE457 (egg), SE565
against food-borne pathogens, none can eliminate high popu- (salad), SE294 (egg), and SE1697 (human). The five strains of
lations of pathogens when they are used individually at con- L. monocytogenes were LM ATCC 19117 (sheep), LM101 (sa-
centrations acceptable in foods. Treatments of fruits and veg- lami), LM109 (pepperoni), LM116 (cheese), and LM201 (milk).
etables with water containing sanitizers, including chlorine, The E. coli O157:H7 and L. monocytogenes strains, but not
may reduce but not eliminate pathogens on the surface of
ATCC 19117, were isolated by one of the authors, whereas the
produce (2, 14). Hence, there is a need for, and interest in,
S. enteritidis isolates were obtained from the Centers for Dis-
developing practical and effective antimicrobial treatments for
ease Control and Prevention, Atlanta, Ga. The strains of each
the inactivation of pathogenic microorganisms on foods.
pathogen were cultured separately in 100 ml of sterile tryptic
Electrolyzed oxidizing water (EO water) is the product of a
soy broth (TSB) (Difco Laboratories, Detroit, Mich.) in 250-ml
new concept developed in Japan. Research carried out in Ja-
pan revealed that electrolysis of deionized water containing a Erlenmeyer flasks at 37°C for 24 h with agitation (150 rpm).
Following incubation, 10 ml of each culture was sedimented by
centrifugation (4,000 3 g for 20 min), washed, and resus-
* Corresponding author. Mailing address: Center for Food Safety pended in 10 ml of 0.1% peptone water (pH 7.1). The optical
and Quality Enhancement, College of Agricultural and Environmental density of the suspension was determined and adjusted with
Sciences, University of Georgia, 1109 Experiment St., Griffin, GA 0.1% peptone water to 0.5 at 640 nm (representing approxi-
30223-1797. Phone: (770) 228-7284. Fax: (770) 229-3216. E-mail: mdoyle mately 109 CFU/ml). The bacterial population in each culture
@cfsqe.griffin.peachnet.edu. was confirmed by plating 0.1-ml portions of appropriately di-
4276
VOL. 65, 1999 ANTIBACTERIAL ACTIVITY OF ELECTROLYZED OXIDIZING WATER 4277
TABLE 1. Inactivation of E. coli O157:H7, S. enteritidis, and L. monocytogenes by EO water at 4 or 23°C

Surviving bacterial population
Temp EO water property
Bacterial species (mean log CFU/ml) after exposure for:
(°C)
0 min 5 min 10 min 15 min pH ORP (mV) Free chlorine (ppm)
E. coli O157:H7 4 7.98 6 0.04 ,1.0 a

0 b
0 b
2.36 6 0.03 1,153 6 3 86.3 6 5.4

Control 7.98 6 0.04 7.99 6 0.07 7.96 6 0.06 7.99 6 0.04
S. enteritidis 7.74 6 0.08 1.06 6 0.15 0b 0b

2.48 6 0.03 1,153 6 2 83.5 6 7.8
Control 7.74 6 0.08 7.68 6 0.09 7.61 6 0.11 7.60 6 0.12
L. monocytogenes 7.91 6 0.05 1.34 6 0.37 0b 0b

2.63 6 0.03 1,160 6 4 43.0 6 4.6
Control 7.91 6 0.05 7.88 6 0.06 7.87 6 0.06 7.91 6 0.03
E. coli O157:H7 23 8.04 6 0.07 ,1.0a 0b 0b

2.37 6 0.01 1,155 6 1 82.3 6 2.2
Control 8.04 6 0.07 7.97 6 0.03 7.99 6 0.07 7.76 6 0.42
S. enteritidis 7.76 6 0.08 ,1.0a 0b 0b

2.45 6 0.12 1,151 6 1 82.0 6 5.8
Control 7.76 6 0.08 7.65 6 0.09 7.73 6 0.08 7.69 6 0.10
L. monocytogenes 7.89 6 0.10 1.25 6 0.33 0b 0b

2.63 6 0.04 1,158 6 5 48.5 6 4.1
Control 7.89 6 0.10 7.83 6 0.06 7.85 6 0.04 7.85 6 0.07
a
Positive by enrichment.
b
Negative by enrichment and no detectable survivors by a direct plating procedure.
luted culture on tryptic soy agar (TSA) (Difco Laboratories) incubation at 37°C for 48 h. A volume of 1 ml of the inoculated
plates and incubating the plates at 37°C for 48 h. For each solution (treatment or control) after exposure to each temper-
pathogen, equal portions from each of the five strains were ature-time combination was also transferred to separate 250-
combined, and 1 ml of the suspension was used as the inocu- ml Erlenmeyer flasks containing 100 ml of sterile TSB and
lum (109 CFU). incubated at 37°C for 24 h. Following enrichment in TSB, the
EO water. EO water was generated with a model ROX- culture was streaked on either sorbitol MacConkey agar no. 3
20TA EO water generator (Hoshizaki Electric Company Ltd., (Oxoid Division, Unipath Co., Ogdensburg, N.Y.) (for E. coli
Toyoake, Aichi, Japan). The current passing through the EO O157:H7), xylose lysine deoxycholate agar (Gene-Trak, Fra-
water generator and the voltage between the electrodes were mingham, Mass.) (for S. enteritidis), or Oxford agar (Gene-
set at 19.8 A and 10 V, respectively. A 12% solution of sodium Trak) (for L. monocytogenes), and the plates were incubated at
chloride (Sigma Chemical Co., St. Louis, Mo.) and deionized 37°C for 24 h. Representative colonies of E. coli O157:H7 and
water from the laboratory supply line were simultaneously S. enteritidis from the respective plates were confirmed by the
pumped into the equipment. The display indicator was acti- E. coli O157:H7 latex agglutination assay (Remel Microbiology
vated and observed until the machine stabilized at a reading of Products, Lenexa, Kans.) and the Salmonella latex test (Oxoid),
19.8 A. The EO water was collected from the appropriate respectively. The colonies of L. monocytogenes on Oxford agar
outlet in sterile containers and was used within 5 min for the were confirmed by the API-20E diagnostic test kit (Biome-
microbial study. Samples for determination of the pH, ORP, rieux, Hazelwood, Mo.). At least duplicate samples of treat-
and free-chlorine concentration also were collected simulta- ments and controls were assayed at each sampling time, and
neously. the entire study with each pathogen was replicated three times.
Sample inoculation and treatments. A volume of 9 ml of EO The pH and ORP of the EO water were measured in dupli-
water (treatment) or sterile deionized water (control) was cate samples immediately after sampling by using pH and ORP
transferred to separate, sterile screw-cap tubes, and the caps electrodes (model 50, ACCUMET meter; Denver Instrument
were tightly closed. The tubes were placed in a water bath in Company, Denver, Colo.). The free-chlorine concentration
order to prewarm the water samples to the desired tempera- was determined by an iodometric method using a digital titra-
ture. To each tube containing 9 ml of EO water or deionized tor (model 16900; Hach Company, Loveland, Colo.). The assay
water, 1 ml (equivalent to 109 CFU) of the five-strain mixture was verified periodically by using a 100 6 0.05 ppm chlorine
of E. coli O157:H7, S. enteritidis, or L. monocytogenes was standard solution (Orion Research Inc., Beverly, Mass.).
added, and the samples were incubated in a water bath (Phar- Statistical analysis. For each treatment, the data from the
macia LKB, Piscataway, N.J.) at 4°C for 0, 5, 10, and 15 min; at independent replicate trials were pooled and the mean value
23°C for 0, 5, 10, and 15 min; at 35°C for 0, 2, 4, and 6 min; and and standard deviation were determined (11).
at 45°C for 0, 1, 3, and 5 min. Following each incubation, the The mean pH, ORP, and free-chlorine concentration of EO
number of viable cells in each sample was determined by plat- water at the different temperatures used for treatment are
ing 0.1-ml portions directly or after serial (1:10) dilutions in presented in Tables 1 through 3. The mean pH and ORP of
0.1% peptone water on duplicate TSA plates. Colonies of the sterile deionized water were 7.1 6 0.15 and 355 6 7.0 mV,
inoculated pathogen were enumerated on TSA plates after respectively. No free chlorine was detected in deionized water.
4278 VENKITANARAYANAN ET AL. APPL. ENVIRON. MICROBIOL.
TABLE 2. Inactivation of E. coli O157:H7, S. enteritidis, and L. monocytogenes by EO water at 35°C

EO water property
E. coli O157:H7 7.97 6 0.03 0 b

0 b
0 b
2.38 6 0.00 1,154 6 1 84.3 6 4.6

Control 7.97 6 0.03 7.94 6 0.04 7.96 6 0.03 7.94 6 0.04
S. enteritidis 7.68 6 0.14 ,1.0a 0b 0b

2.44 6 0.04 1,153 6 1 79.8 6 3.3
Control 7.68 6 0.14 7.63 6 0.06 7.59 6 0.11 7.64 6 0.11
L. monocytogenes 7.91 6 0.10 0b 0b 0b

2.48 6 0.05 1,159 6 4 73.3 6 1.8
Control 7.91 6 0.10 7.88 6 0.11 7.86 6 0.08 7.81 6 0.12
a
b
EO water had major antibacterial activity at 4 and 23°C on water at 45°C, E. coli O157:H7 was killed completely (a reduc-
the five-strain mixtures of E. coli O157:H7, S. enteritidis, and tion of approximately 8.0 log CFU/ml), whereas the popu-
L. monocytogenes (Table 1). At time zero, both treatment and lations of S. enteritidis and L. monocytogenes were reduced
control samples for all three pathogens had approximate mean by approximately 7.0 log CFU/ml. The bacterial counts of all
bacterial counts of 8.0 log CFU/ml. At 5 min of exposure at three pathogens in control samples remained the same
4°C, the E. coli O157:H7 count in the treatment samples was throughout the study at both 35 and 45°C.
reduced to less than 1.0 log CFU/ml (detected only by enrich- The theoretical sequence of chemical reactions involved in
ment in TSB for 24 h), whereas the populations of S. enteritidis the production of EO water can be summarized as follows (1).
and L. monocytogenes were slightly greater than 1.0 log CFU/ During electrolysis, sodium chloride dissolved in deionized
ml. All three pathogens decreased to undetectable levels (as water in the electrolysis chamber dissociates into negatively
determined by both plating and enrichment procedures) after charged chloride (Cl2) and hydroxy (OH2) ions and positively
10 min of exposure to EO water at 4°C. However, no differ- charged sodium (Na1) and hydrogen (H1) ions. The chloride
ences in bacterial counts were observed in the control samples and hydroxy ions are adsorbed to the anode, with each ion
throughout the study. At 5 min of exposure at 23°C, the pop- releasing an electron (e2) to become a radical. The chloric and
ulations of E. coli O157:H7 and S. enteritidis in the treatment hydroxy radicals combine, forming hypochlorous acid (HOCl),
samples decreased to less than 1.0 log CFU/ml, whereas the which separates from the anode. Two chloric radicals can also
L. monocytogenes count was reduced to 1.25 log CFU/ml. In combine to produce chlorine gas. In the cathode section, each
agreement with the results obtained at 4°C, all three pathogens positively charged sodium ion receives an electron and be-
were undetectable after 10 min of contact with EO water at comes metallic sodium. The metallic sodium combines with
23°C. water molecules, forming sodium hydroxide and hydrogen gas.
E. coli O157:H7, S. enteritidis, and L. monocytogenes were A bipolar membrane separating the electrodes enhances the
more rapidly inactivated by EO water at 35 or 45°C (Tables 2 electrolysis of water to produce strong acidic and alkali waters
and 3) than at 4 or 23°C. At 35°C, the populations of E. coli from the anode and cathode, respectively.
O157:H7 and L. monocytogenes in the treated samples de- The antagonistic effects of chlorine and low pH on micro-
creased to undetectable levels within 2 min of exposure to EO organisms are well documented. Although organic acids (with
water, whereas S. enteritidis was detected only by enrichment of low pH) and hypochlorite solution (with free chlorine) have
the treated sample in TSB. After 1 min of exposure to EO been used widely in treatments for killing food-borne bacteria
TABLE 3. Inactivation of E. coli O157:H7, S. enteritidis, and L. monocytogenes by EO water at 45°C

EO water property
E. coli O157:H7 7.96 6 0.03 0 b

0 b
0 b
2.39 6 0.02 1,153 6 4 85.8 6 2.7

Control 7.96 6 0.03 7.89 6 0.03 7.87 6 0.03 7.86 6 0.11
S. enteritidis 7.70 6 0.12 1.13 6 0.33 0b 0b

2.44 6 0.03 1,155 6 1 79.33 6 3.0
Control 7.70 6 0.12 7.63 6 0.12 7.67 6 0.15 7.61 6 0.14
L. monocytogenes 7.91 6 0.10 ,1.0a 0b 0b

2.48 6 0.05 1,159 6 4 73.3 6 1.8
Control 7.91 6 0.10 7.88 6 0.10 7.88 6 0.08 7.83 6 0.12
a
b
VOL. 65, 1999 ANTIBACTERIAL ACTIVITY OF ELECTROLYZED OXIDIZING WATER 4279
in the food industry, systems involving high ORP values, results in a reduction in the L. monocytogenes count of less
greater than 1,000 mV, have not normally been used. The ORP than 2 log CFU/g (15). Studies comparing the efficacies of
of a solution is an indicator of its ability to oxidize or reduce, chlorinated water and EO water for inactivating E. coli
with positive and higher ORP values correlated to greater O157:H7 on apples are in progress in our laboratory.
oxidizing strength (6, 8, 9). An ORP of 1200 to 1800 mV is Results revealed that EO water is highly effective in killing
optimal for growth of aerobic microorganisms, whereas an E. coli O157:H7, S. enteritidis, and L. monocytogenes, indicating
optimum range of 2200 to 2400 mV is favored for growth of its potential application for decontamination of food and food
anaerobic microorganisms (6). Since the ORP of EO water in contact surfaces. An advantage of EO water is that it can be
this study was greater than 1,100 mV, the ORP likely played an produced with tap water, with no added chemicals other than
influential role, in combination with low pH and free chlorine, sodium chloride.
in killing microorganisms. A possible explanation for the high
ORP of EO water is the oxygen released by the rupture of the REFERENCES
weak and unstable bond between hydroxy and chloric radicals 1. Anonymous. 1997. Principle of formation of electrolytic water. Hoshizaki
(1). It is hypothesized that the low pH in EO water sensitizes Electric Co. Ltd., Sakae, Toyoake, Aichi, Japan.
2. Beuchat, L. R. 1995. Pathogenic microorganisms associated with fresh pro-
the outer membranes of bacterial cells, thereby enabling hy- duce. J. Food Prot. 59:204–216.
pochlorous acid to enter the bacterial cells more efficiently. 3. Beuchat, L. R., B. V. Nail, B. B. Adler, and M. R. S. Clavero. 1998. Efficacy
Acid-adapted cells of Salmonella typhimurium were reported to of spray application of chlorinated water in killing pathogenic bacteria on
be more sensitive to inactivation by hypochlorous acid than raw apples, tomatoes, and lettuce. J. Food Prot. 61:1305–1311.
4. D’Aoust, J. 1997. Salmonella species, p. 135–137. In M. P. Doyle, L. R.
nonadapted cells, due to increased outer membrane sensitivity Beuchat, and T. J. Montville (ed.), Food microbiology: fundamentals and
to hypochlorous acid in acid-adapted cells (7). Experiments to frontiers. American Society for Microbiology, Washington, D.C.
identify the contributions of the different components of EO 5. Doyle, M. P., T. Zhao, J. Meng, and S. Zhao. 1997. Escherichia coli O157:H7,
water to its antimicrobial activity are under way in our labora- p. 175–178. In M. P. Doyle, L. R. Beuchat, and T. J. Montville (ed.), Food
Microbiology: fundamentals and frontiers. American Society for Microbiol-
tory. ogy, Washington, D.C.
The effects of EO water on the three pathogens were eval- 6. Jay, J. M. 1996. Modern food microbiology, 5th ed., p. 48–49. Aspen Pub-
uated at low and moderate temperatures in the interest of lishers, Gaithersburg, Md.
developing potential antibacterial dip treatments for unproc- 7. Leyer, G. J., and E. A. Johnson. 1997. Acid adaptation sensitizes Salmonella
typhimurium to hypochlorous acid. Appl. Environ. Microbiol. 63:461–467.
essed agricultural foods. No differences in the inactivation 8. McPherson, L. L. 1993. Understanding ORP‘s in the disinfection process.
rates of the three pathogens were observed between treatment Water Eng. Management 140(11):29–31.
at 4°C and treatment at 23°C. However at 35 and 45°C, much 9. Robbs, P. G., J. A. Bartz, J. K. Brecht, and S. A. Sargent. 1995. Oxidation-
higher rates of inactivation were observed for all three patho- reduction potential of chlorine solutions and their toxicity to Erwinia cara-
tovora subsp. caratovora and Geotrichum candidum. Plant Dis. 79:158–162.
gens. 10. Shimizu, Y., and T. Hurusawa. 1992. Antiviral, antibacterial, and antifungal
Since chlorine is one of the antimicrobial components of EO actions of electrolyzed oxidizing water through electrolysis. Dental J. 37:
water, we evaluated the survival of E. coli O157:H7 and 1055–1062.
L. monocytogenes in sterile deionized water containing a free- 11. Steel, R. G. D., and J. H. Torrie. 1980. Principles and procedures of statistics.
McGraw-Hill, New York, N.Y.
chlorine concentration of 70 to 80 ppm, which was similar to 12. Tryland, I., M. Pommepuy, and L. Fiksdal. 1998. Effect of chlorination on
that present in EO water. Results revealed reductions in the b-D-galactosidase activity of sewage bacteria and Escherichia coli. J. Appl.
bacterial counts of both pathogens similar to those observed Bacteriol. 85:51–60.
with EO water, indicating that the concentration of free chlo- 13. U.S. Department of Agriculture Food Safety and Inspection Service. 1995.
Pathogen reduction: Hazard Analysis and Critical Control Point (HACCP)
rine present in EO water is sufficient to bring about the reduc- systems. Proposal billing code 3410-DM-P. Docket no. 93-016P. U.S. De-
tions in bacterial counts achieved by EO water. Although chlo- partment of Agriculture, Beltsville, Md.
rine is highly effective in killing pathogenic microorganisms in 14. U.S. Food and Drug Administration. 1997. Guide to minimize microbial
simple aqueous systems, its antibacterial effect on microorgan- food safety hazards for fresh fruits and vegetables. Center for Food Safety
and Applied Nutrition, U.S. Food and Drug Administration, Washington,
isms on foods is minimal, especially in the presence of organic D.C.
materials which convert chlorine into inactive forms (3). For 15. Zhang, S., and J. M. Farber. 1996. The effects of various disinfectants against
example, treatment of fresh produce with 200 ppm chlorine Listeria monocytogenes on fresh-cut vegetables. Food Microbiol. 13:311–321.
Biophysical Chemistry 107 (2004) 71–82
The mechanism of the enhanced antioxidant effects against

superoxide anion radicals of reduced water produced by
electrolysis
Kokichi Hanaokaa,*, Dongxu Sunc, Richard Lawrencec, Yoshinori Kamitanib,
Gabriel Fernandesc
a
Bio-REDOX Laboratory Inc. 1187-4, Oaza-Ueda, Ueda-shi, Nagano-ken 386-0001, Japan
b
Hoshizaki Electric Company, Limited 3-16 Minamiyakata, Toyoake, Aichi-ken 470-1194, Japan
c
Divison of Clinical Immunology, Department of Medicine, University of Texas Health Science Center at San Antonio,
San Antonio, TX 78229, USA
Received 8 July 2003; received in revised form 22 August 2003; accepted 22 August 2003
Abstract
We reported that reduced water produced by electrolysis enhanced the antioxidant effects of proton donors such as
ascorbic acid (AsA) in a previous paper.We also demonstrated that reduced water produced by electrolysis of 2 mM
NaCl solutions did not show antioxidant effects by itself.We reasoned that the enhancement of antioxidant effects
may be due to the increase of the ionic product of water as solvent.The ionic product of water (pKw ) was estimated
by measurements of pH and by a neutralization titration method.As an indicator of oxidative damage, Reactive
Oxygen Species- (ROS) mediated DNA strand breaks were measured by the conversion of supercoiled fX-174 RF
I double-strand DNA to open and linear forms.Reduced water had a tendency to suppress single-strand breakage of
DNA induced by reactive oxygen species produced by H2O2 yCu (II) and HQyCu (II) systems.The enhancement of
superoxide anion radical dismutation activity can be explained by changes in the ionic product of water in the reduced
water.
2003 Elsevier B.V. All rights reserved.
Keywords: Reduced water; Antioxidant; Ionic product of water; DNA damage
1. Introduction (ORP), lower dissolved oxygen (DO) and higher

dissolved hydrogen (DH) than non-electrolyzed
Recently, a new technology involving electrol- water.Reduced water w1–3x, which has such par-
ysis of water has been proposed for clinical ameters, is used extensively as drinking water
improvement of various diseases.Reduced water which in addition to its use as a pure filtered
produced by electrolysis of tap water has a higher drinking water may also act as an antioxidant
pH (9.0 – 10.0), lower oxidation reduction potential against oxidative stress.In contrast, the water
collected from the anode compartment is oxidized
*Corresponding author.Tel.: q81-268-25-1736; fax: q81-
268-24-0050. water and has been used extensively as an antisep-
E-mail address: [email protected] (K.Hanaoka). tic w4–6x.
0301-4622/04/$ - see front matter 2003 Elsevier B.V. All rights reserved.
doi:10.1016/j.bpc.2003.08.007
K. Hanaoka et al. / Biophysical Chemistry 107 (2004) 71–82 72
Oxidative stress w7–12x in the human body is

thought to be due to excess reactive oxygen species
or free radicals including superoxide anion radicals
(Oy2 •), hydroxyl radicals (•OH), hydroperoxyl rad-
icals (•OOH), nitrogen monoxide radicals (NO•),
singlet oxygen (1O2) and hydrogen peroxide mol-
ecules (H2O2).Among these, superoxide anion
radicals are the best known.It is considered that
the dismutation activity for superoxide anion rad-
icals is the most important indicator of antioxidant
effects.We have studied the antioxidant effects of
reduced water produced by electrolysis w13x.The
commonly reported parameters of reduced water
which are pH, ORP, DO and DH, do not explain
the mechanism of enhanced antioxidant effects but
they are useful parameters for determining the
energy of electrolysis, if measured immediately
after electrolysis.They are the parameters of the
solute in the reduced water.We have investigated
the parameters of the solvent water.The parameter Fig.1. Electrolysis cells made of an acrylonitrile–butadien–
styrene mounted in polyvinyl chloride resin. (A) anode, (C)
of the solvent, which is directly related to the chathode, (M) non-charged membrane, (ES) electrolyte solu-
enhancement of dismutation activity by reduced tions, (ECS) electrolyzed cathode solutions (the reduced
water is the ionic product of water.We could water), (EAS) electrolyzed anode solutions (the oxidized
obtain the ionic product of water (pKw) by using water), (PS) electric power source and (p) pump.
pH and the neutralization titration method.We
defined the ionic product of water (pKw) as pIP these two half-cells equipped with platinum-coated
for electrolyzed water.Water passed through the titanium electrodes having an effective area of 100
electrolysis system with no current applied was cm2 on the cathode.
used as a control.In this study, pIP and the increase
of entropy have been estimated from the experi- 2.2. Chemicals and reagents
mental results.We demonstrate that the reduced
water protects DNA from damage by oxygen The reagents used for this study were special-
radicals based on the pIP of the reduced water. grade NaCl, KCl, MgCl2, CaCl2, L-ascorbic acid
The mechanism of the observed antioxidant effects (Wako Pure Chemical Industries Co., Ltd.), and
is discussed in relation to these parameters. as a solvent, water, which was distilled and deion-
ized with an ion-exchange resin to below 0.3 ms
2. Materials and methods cmy1. To measure the superoxide dismutation
activity, a sodium phosphate buffer containing 2
2.1. Electrolysis cell mM hypoxanthine (Sigma Chemical Company), a
sodium phosphate buffer containing, 5,5-dimethyl-
Two electrolysis half-cells, made of acrylo- 1-pyrroline-oxide (DMPO, Labotec Co., Ltd.),
nitrile-butadien-styrene mounted in polyvinyl chlo- superoxide dismutase (Boehringer Manheim), 0.4
ride resin, were prepared as shown in Fig. 1. A unit mly1 xanthine oxidase in sodium phosphate
non-charged membrane, (YUMICRON Y9201-T, buffer (Merck and Co., Inc.) and L-ascorbic acid
YUASA CORPORATION) with an effective area (AsA) were used. FX-174RF1 plasmid DNA
of 100 cm2 and 0.12 mm thickness was mounted (New England Biolabs, Beverly, MA), H2O2,
between the two half-cells.Electrolysis was carried CuSO4, hydroquinone, Tris base, sodium acetate,
out across the non-charged membrane between EDTA, and ethidium bromide (Sigma Chemical
Co., St. Louis, MO) and Agarose (Bio-Rad Lab- titrator (Hiranuma Industry Co.) for the reduced
oratories, Hercules, CA) were used for the DNA water produced at each of the same levels of
damage measurements. electric current as the pH measurements.
2.3. Electrolysis of 2 mM NaCl, KCl, 1 mM 2.6. Measurement of superoxide dismutation

MgCl2 and CaCl2 activity
20 L sample solutions, containing 2 mM NaCl, 1 ml of 10 mM L-ascorbic acid was added to

2 mM KCl, 1 mM MgCl2 or 1 mM CaCl2 were 50 ml samples of the reduced water and to 50 ml
prepared.These samples were pumped from the of 2 mM NaC1 and KCl, and 1 mM MgCl2 and
solution container through a pair of electrolysis CaCl2 solutions, respectively.Superoxide dismu-
half-cells with a non-charged membrane mounted tation activity was measured using an electron spin
between them.The sample solutions were subject- resonance (ESR) spectrometer (ES-10, Nikkiso
ed to electrolysis under set conditions of 0 to 0.8 Co.Ltd.).Each reaction mixture contained 50
A and 25 8C using a constant electric current mm3 of 2 mM hypoxanthine in sodium phosphate
source.Electrolysis was carried out with a constant buffer, 50 mm3 of sample, 16 mm3 of DMPO and
flow rate of 1000"50 ml miny1 in the cathode 50 mm3 xanthine oxidase in a sodium phosphate
compartment and, 2000"100 ml miny1 in the buffer.These reaction mixtures were poured into
anode compartment.The cathode solution pro- a special flat cell to conduct ESR measurements.
duced by electrolysis, which was called reduced This ESR measurement was carried out using 3.7
water, was used for the experiments in this study. mW microwave power, 339.1"5.5 mT magnetic
field, 100 kHz frequency, 0.1 mT modulation,
2.4. Measurements of pH, oxidation and reduction 0.12 s response time and 1 min sweep time. As
potential (ORP), and dissolved oxygen (DO) the unit for superoxide dismutation activity, we
used the same unit as adopted by Friedovich et al.
The parameters that were measured to charac- w14x.The superoxide dismutation activity of the
terize the reduced water produced by electrolysis samples was estimated by means of interpolation
of 2 mM NaCl and KCl, and 1 mM MgCl2 and based on a standard curve of 0 to 30 units per ml
CaCl2 were electrical potential (V) from the power of superoxide dismutase.
source, electrical conductivity (EC) by an EC
meter (TOA EC METER CM-14P), pH by a pH 2.7. The ratio of concentration of cations to that
meter (TOA ION METER IM-4OS), oxidation of anions in the cathode compartment
reduction potential (ORP) by an ORP meter (TOA
ION METER IM-4OS) and dissolved oxygen When electrolysis of diluted electrolyte solutions
(DO) by a DO meter (HORIBA OM-12) at 25 is carried out the concentration of ions in both the
8C. cathode and the anode will be changed compared
to the initial solutions.The concentration of trans-
2.5. Measurement of OHy ions ported ions in the cathode side was measured by
an ion chromatography system (TOA ICA-5000
The concentration of OHy ions was obtained System) and the ratio of cations and anions for
from the measurement of pH and by a neutraliza- each sample solution was estimated.
tion titration method using an automatic titrator.
In this study, pH was measured using a pH meter 2.8. Titration of the reduced water and the control
(TOA ION METER lM-40S, Toa Electronics Ltd.) by 10 mM AsA solutions
in samples produced at each of the following levels
of electric current, 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, The amount of 10 mM AsA solutions consumed
0.7 and 0.8 A. Neutralization titrations with 20 by the neutralization titration for the reduced water
mM HCl were carried out using a COMITE-550 and the control solution was measured.Non-elec-
trolyzed water brought to the same pH as the Where Ka, a and C are dissociation constant,
electrolyzed water by addition of NaOH was used degree of dissociation and initial concentration,
as the control.The pH of the reduced water was respectively.If a is much smaller than 1, Eq. (9)
changed from 10.1 to 10.94 and that of the control can be obtained from Eq. (8).Eq. (10) can be
was changed from 10.05 to 10.94. obtained from Eq. (9).
2.9. The estimation of ionic product p(IP)RW of a((KayC)1y2 (9)

reduced water and the entropy of reduced water
Eq. (10) can be obtained from Eq. (8).
When electrolysis is carried out with 2 mM
NaCl and KCl solutions, and 1 mM MgCl2 and wHqxsCa((KayC)1y2 (10)
CaCl2 solutions, the following reactions will be
observed in the cathode compartment, Thus, pH will be described as follows:
2H2Oq2eyz2OHyqH2 (1) pHs(1y2)(pKaylogC) (11)
and designating monovalent electrolytes as MA and In the case of Kws10y14, the used pH will be
divalent electrolytes as MB, for NaCl, or KCl, and shown as Eq. (12).
MgCl2 or CaCl2, respectively,
pHs7q(1y2)(pKaqlogC) (12)
A qOH ™M AOH
Mq (2)
y
However, the dissociation of water will be

B q2OH ™M B (OH) 2
M2q (3)
y
shown as Eq. (13),
In general, even if pure water is used H2CO3 H2OqH2O|H3OqqOHy (13)
(beyond 1.1=10y2 mM at 258) is present in an
open system.Therefore, most solutes are dissolved
Ionic product of water, Kw and IP will be shown
as carbonates as shown in Eqs. (4) – (6).
as Eq. (14).
H2OqCO2zH2CO3zHqqHCOy
3 (4)
wH3OqxwOHyxsKwsIP (14)
MAOHqH2CO3™(MA)2CO3q2H2O (5)
where IP will be described as Eq. (15) under the
MB(OH)2qH2CO3™MBCO3q2H2O (6) conditions of 25 8C and 1 atm,
The pH of the reduced water is shown as the (IP)ws10y14 (molyl)2 (15)

result of hydrolysis of the carbonate salts.In
general, hydrolysis of salts will be represented by Therefore, p(IP)w will be shown as Eq. (16),
the following equations,
ylog(pKw)spKwsp(IP)w (16)
HA|H qA q y
(7)
The titration for 1-1 carbonates with HCl solu-
Where HA is a weak acid. tions will be carried out as follows,
The dissociation constant in this hydrolysis is
given by Eq. (8), M2CO3qHCl™MClqMHCO3 (17)
KasCa2 y(1ya) (8) MHCO3qHCl™MClqH2OqCO2 (18)

M2CO3q2HCl™2MClqH2OqCO2 (19) 174 RF I double-strand DNA to open and linear

forms, according to the method described by Li
If the neutralization titration is carried out with w15x and Win w16x.Briefly, 0.2 mg DNA was
20 mM HCl, two peaks of differential values (dEy incubated with the indicated concentration of
dV) are observed, where E and V are potential and H2O2 and, 25 mM CuSO4 in 20 ml of 20 mM
volume.The concentration at each neutralization sodium phosphate buffer (pH 7.5) containing 17
titration point is shown as Eqs. (20) and (21). ml of reduced water or, NaOH solution of the
same pH as the reduced water at 37 8C for 30
wOHyxMOHswHClx A point ywHClxB point (20) min.For the hydroquinoneycopper II (HQyCu(II))
induced breaks, 0.2 mg of DNA was incubated
wHClxB point s2wM2CO3xdissociationswMHCO3xtotal with the indicated concentrations of HQ and Cu
(21) (II) in PBS at 37 8C at a final volume of 20 ml
containing 17 ml of reduced water.Following
ylogwOHyxM 2CO 3 s14y(pH)M 2CO 3 (22) incubation, the samples were immediately loaded
in a 1% agarose gel containing 40 mM Tris, 20
wOHyxtotals(wOHyxMOHqwOHyx M 2CO3 (23) mM sodium acetate and 2 mM EDTA, and sub-
jected to electrophoresis in Trisyacetate gel buffer.
p(IP)RWsylogKRWs14 After electrophoresis, the gels were stained with a
qlog(wOHyxtotal ywOHyxpH) (24) 0.5 mgyml solution of ethidium bromide for 30
min, followed by another 30 min destaining in
where wOHyxpH is the concentration of wOHyx water.The gels were then photographed under UV
estimated from pH value of the reduced water. light.
The free energy change DG 0 for a reaction is
related to the equilibrium constant K, enthalpy DH, 3. Results
and entropy DS at equilibrium as shown in follow-
ing equations. When electrolyte solutions are electrolyzed
across the membrane, reduction occurs at the
DG0sDH0yTDS0syRTln K (25) cathode and oxidation at the anode.Oxidation of
water molecules produces Hq and O2 at the anode,
DS0sDH0 yTqR ln K (26) and OHy and H2 at the cathode.Therefore, cathod-
ic alkaline water (reduced water) is abundant in
where R, T and K are the gas constant (1.987 cal dissolved hydrogen (DH), whereas anodic acidic
moly1 Ky1), the absolute temperature and the water (oxidized water) is abundant in DO.DH
equilibrium constant which is the ionic product of and DO produced by electrolysis have particular
water, KRW in the reduced water produced by characteristics w2x.Results of the measurement of
electrolysis.At 25 8C and 1 atm. electric potential (V), electric conductivity (EC),
pH, ORP and DO at different electric currents are
DS0sy68.3y298q1.9872=ln KRW (27) shown in Figs.2 – 6.The electrolysis potential
varies linearly with electric current between 0.1 A
From Eq. (27), the entropy difference, DS 0 of and 0.8 A as shown in Fig. 2. The slopes, VyA
the solvent in the reduced water will be estimated increased in the order of KCl, -CaCl2, -MgCl2,
using KRW which is defined as (IP)RW. -NaCl solutions.Fig.3 shows results of electric
conductivity measurements.The electrical conduc-
2.10. Measurement of DNA strand break under tivity for a fixed electric current increased in the
oxidative stress order of MgCl2, -NaCl, -CaCl2, -KCl.The
conductivity of KCl solutions was very high com-
The ROS-mediated DNA strand breaks were pared with the other electrolyte solutions.pH
measured by the conversion of supercoiled fX- increased from 9.9 to 10.96 in NaCl solutions,
Fig.2. The relationship between electric potential (V) and elec- Fig.4. The relationship between pH and electric current (A)
tric current (A) using various electrolyte solutions. (d) NaCl, using various electrolyte solutions. (d) NaCl, (m) KCl, ( )
(m) KCl, ( ) MgCl2 and (j) CaCl2. MgCl2 and (j) CaCl2.
9.91 to 10.77 in KCl solutions, 9.46 to 10.6 in ly1 in KCl solutions, 6.63 mg ly1 to 6.03 mg ly1
MgCl2 solutions and 9.96 to 10.77 in CaCl2 in MgCl2 solutions and 6.61 mg ly1 to 6.18 mg
solutions when the current was increased from 0.1 ly1 in CaCl2 solutions, respectively.
to 0.8 A. ORP decreased from y50 mV to y170 Fig.7 shows the superoxide dismutation activity
mV in NaCl solutions, y51 mV to y179 mV in of L-ascorbic acid in the reduced water of NaCl,
KCl solutions, y70 mV to y176 mV in MgCl2 KCl, MgCl2 and CaCl2 solutions, and the control
solutions and y73 mV to y137 mV in CaCl2 solutions adjusted to the same pH and concentra-
solutions when the current was increased from 0.1 tion, respectively.The results were obtained
to 0.8 A. DO decreased from 6.97 mg ly1 to 6.28 through ESR measurements conducted using 10
mg ly1 in NaCl solutions, 6.9 mg ly1 to 6.2 mg mM L-ascorbic acid as proton donor.Electrolysis
of 2 mM NaCl and KCl, and 1 mM MgCl2 and
Fig.3. The relationship between electric conductivity (mS per Fig.5. The relationship between redox potential (mV) and
m) and electric current (A) using various electrolyte solutions. electric current (A) using various electrolyte solutions. (d)
(d) NaCl, (m) KCl, ( ) MgCl2 and (j) CaCl2. NaCl, (m) KCl, ( ) MgCl2 and (j) CaCl2.
Fig.6. The relationship between DO and electric current (A)

using various electrolyte solutions. (d) NaCl, (m) KCl, ( )
MgCl2 and (j) CaCl2.
Fig.7. Superoxide dismutation activity of L-ascorbic acid for
the reduced water and control solutions adjusted to the same
pH and initial concentration of electrolyte solutions (2 mM
CaCl2 solutions increased the superoxide dismu- NaCl and KCl, and 1 mM MgCl2 and CaCl2), (RW–Na) the
tation activity from 119 to 173 units per 20 ml, reduced water from 2 mM NaCl solutions, (RW–K) the
115 to 154.3 units per 20 ml, 105 to 140 units per reduced water from 2 mM KCl solutions, (RW–Mg) the
20 ml, and 128 to 165 units per 20 ml for L- reduced water from 1 mM MgCl2 solutions and (RW–Ca)
ascorbic acid, respectively, compared to the same reduced water from 1 mM CaCl2, (PW–Na) the control 2 mM
NaCl solutions and (PW–K) the control 2 mM KCl solutions,
solutions without electrolysis adjusted to the same and (PW–Mg) the control 1 mM MgCl2 solutions and (PW–
pH as the reduced water,.In the previous paper, Ca) the control 1 mM CaCl2 solution.
we demonstrated that the reduced water did not
show any dismutation activity without added
ascorbic acid.These results show the enhancement
of superoxide dismutation activity by electrolysis
compared the control solutions.
Fig.8 shows the results of the ratio of concen-
tration of cations to that of anions, wcationsxcathode y
wanionsxcathode. The ratio of wcationsxcathode y
wanionsxcathode increased in the order of CaCl2,
-MgCl2, -KCl, -NaCl.The value of CaCl2 was
negative between 0.1 and 0.8 A of electric current.
For KCl and MgCl2 the ratio was nearly 1.The
NaCl solution, showed the highest value (between
3.848 and 4.151).
In order to confirm the difference in consumed
amount for neutralization titration between the
reduced water and the sample solution, the solu-
tions were titrated using a 10 mM AsA solution
from pH 10.05 to 10.95. As the result, the con-
sumed amount of 10 mM AsA solution for the Fig.8. The ratio of the concentration of cations and anions in
reduced water was lower than that of sample the cathode compartment corresponding to electric current (A).
solutions at all pH levels as shown in Fig. 9. (d) NaCl, (m) KCl, ( ) MgCl2 and (j) CaCl2.
Table 1
The increase, (DS o )A50.8 y(DS o )A s0, of entropy between 0
and 0.8 A of electric current for the reduced water made from
NaCl, KCl, MgCl2 and CaCl2 solutions
Current NaCl KCl CaCl2 MgCl2

A 2 mM 2 mM 1 mM 1 mM
0 0 0 0 0
0.8 2.4 1.6 1.6 1.1
water of the electrolyte solutions decreased from

14.058 to 13.474. However, there was almost no
change in p(IP)CS between pH:9.8 and pH:10.96
in the control solutions.
Eq. (27) shows the entropy of p(IP)RW.We can
Fig.9. The amount of consumed AsA for the reduced water
estimate the increase in entropy by using Eq. (27).
and the control solutions by neutralization titration correspond- Table 1 shows the estimated entropy increase in
ing to pH. (d) the control solutions of NaOH and (m) the the reduced water from the sample solutions.The
reduced water. reduced water with 2 mM NaCl solution showed
the largest entropy increase (2.4 Kcalymol).Con-
Fig.10 shows the results of p(IP)RW values for versely, the reduced water of MgCl2 showed the
the reduced water of NaCl, KCl, MgCl2 and lowest entropy increase (1.1 Kcalymol).
CaCl2 solutions and control solutions of NaCl and The effects of reduced water on oxidative DNA
KCl.p(IP)RW decreased in reduced NaCl, KCl, damage are presented in Figs. 11 and 12. In the
MgCl2 and CaCl2 solutions in proportion to the present study, oxidative DNA damage is clearly
increase in pH, but control solutions of NaCl and
KCl showed no change of p(IP)RW between pH:9.8
and pH:10.96. The p(IP)RW values of the reduced
Fig.11. Effect of electrolyzed water on hydrogen peroxide

induced DNA damage.Lane 1: Negative control; Lane 2: Con-
Fig.10. The relationship between pIP (ylog KW) and pH for trol; Lane 3: H2O2 qCu(II); Lane 4: H2O2 qCu(II)qKOH
the reduced water made from NaCl, KCl, MgCl2 and CaCl2, solution; Lane 5: H2O2 qCu(II)q2 mM KCl solution (0 A),
and control solutions of NaCl and KCl. (d) NaCl, (m) KCl, pH 6.30; Lane 6: H2O2 qCu(II)qelectrolyzed reduced water
( ) MgCl2 and (j) CaCl2 for the reduced water, and (%) (0.4 A), pH 10.47; and Lane 7: H2O2qCu(II)qelectrolyzed
NaCl and (∑) KCl for the control solutions. reduced water (0.8 A), pH 10.74.
shows pH:9.2 to 10.6 between 10-6 mol ly1 and

10y3 mol ly1 and in NaHCO3, pH:7.2 to 8.7
between 10y6 mol ly1 and 10y3 mol ly1, respec-
tively, w17x.At 25 8C, 1.15=10y2 mM carbon
dioxide is dissolved in pure water.As mentioned
above, when sufficiently dilute electrolyte solu-
tions are used for the reduced water, carbonates
cannot be neglected.ORP is the oxidation reduc-
tion potential and it can be estimated from the
Nernst equation as follows,
EVsE0Vq2.303RT y nFlog(ox)y(red) (28)
Where, EV, EV0 , R, T, n, F, (ox) and (red) are the

oxidation reduction potential, standard potential,
Fig.12. Effect of electrolyzed water on hydroquinone (HQ)
gas constant, absolute temperature, number of
induced DNA damage.Lane 1: Negative control; Lane 2: Con- electrons transferred in the reaction, Faraday con-
trol; Lane 3: HQqCu(II); Lane 4: HQqCu(II)qKOH solu- stant, product of the activities of the oxidized
tion; Lane 5: HQqCu(II)q2 mM KCl solution (0 A), pH species and product of activities of reduced spe-
6.30; Lane 6: HQqCu(II)qelectrolyzed reduced water (0.4 cies, respectively.Thus, in the case of reduced
A), pH 10.47; and Lane 7: HQqCu(II)qelectrolyzed reduced
water (0.8 A), pH 10.74.
water, as oxidation and reduction are included for
oxygen in the original water and hydrogen in the
evident in the H2O2 yCu (II) and the HQyCu (II) reduced water, the ORP equation will be shown as
systems (lane 3).Densitometric results, expressed Eq. (29)
as the fraction of DNA converted to open circular
and linear forms, clearly showed that reduced EV5E0Vq(n)pHq(m)OlogwO2xq(m)HlogwH2x
water significantly inhibited oxidative stress (29)
induced DNA damage in both H2O2 yCu (II) and
HQyCu (II) systems (lanes 6 and 7) compared to Where, (n), (m)O and (m)H are coefficients relative
the control solution passed through the apparatus to pH, O2 and H2 w18x.Therefore, ORP is the
with no voltage applied (lane 5). parameter indicating the concentrations of oxygen
and hydrogen dissolved in the reduced water.As
4. Discussion DO and DH are the concentrations of oxygen and
hydrogen in the reduced water, they are parameters
4.1. The characterization of solutes in the reduced relative to solutes in it.Those solutes will be
water generated by the process of electrolysis.
The electric potential at each level of electric
The parameters related to solutes in water current was higher in NaCl solution than that in
reduced by electrolysis are pH, ORP, DO, DH and KCl, and MgCl2 solutions, which was higher than
EC.pH is the indicator which shows the hydrogen in CaCl2 solution as shown in Fig. 2. It is assumed
ion concentration.When electrolysis is carried out that the difference in ionic mobility between cati-
in electrolyte solutions such as NaCl, KCl, ons and anions will be proportional to the electric
MgCl2 or CaCl2 the pH of the reduced water potential.For example, the ratio of Cly ions to
produced in the cathode compartment will be Naq ions is 0.767, that of Cly ions to Kq ions is
measured as hydrolysis of carbonates of those 0.987, and that of Cl ions to Mg2q ions is 0.713
electrolytes.Therefore, the pH value depends on and Cly ions to Ca2q is 0.799. It is strongly
the initial concentration of the carbonates and the suggested that the higher the ratio of anions to
parameters of hydrolysis.For example, Na2CO3 cations, the lower the electric potential gradient.
Results for electrical conductivity were contrary to dissociation of protons at the 3rd functional group
those for electrical potential as mentioned above. of AsA, dissolved in the reduced water accounts
This is a reasonable result.Furthermore, pH, ORP for the significant difference between the reduced
and DO also changed as expected in proportion to water and the control solutions.This property is
the magnitude of the electrical field energy. due to water molecules as solvent and also a very
stable molecular structure.As described in a pre-
4.2. The enhancement of superoxide dismutation vious paper, the increase in dissociation activity of
activity in reduced water the reduced water is due to the process of elec-
trolysis w10x.When a sufficiently large electric
Reduced water prepared from all of the electro- field is applied to the boundary between the
lyte solutions (NaCl, KCl, MgCl2 and CaCl2) had electrode and the electrolyte bulk solutions, a very
higher superoxide dismutation activity, when meas- high electric potential will be generated (above
ured using AsA as an antioxidant indicator, than 107 V cmy1).If a sufficient amount of reduced
the corresponding control solutions adjusted to the water is taken into the body, it will increase the
same pH (Fig.7).AsA has the structure of a 2,3- dissociation activity for the water-soluble antioxi-
enediol which is a kind of saccharic acid, and it dant substances of relatively lower dissociation
plays a role in the protection system against activity.As a result, we speculate that their anti-
oxidative stress in animals and plants w19,20x.The oxidant capacity will be enhanced.It is quite
OH at the 2nd functional group has pKas11.79 possible that many useful phenomena related to
and that at the 3rd functional group has pKas reduced water will be found to be the result of the
4.25. If AsA is added to reduced water and control increase of dissociation activity of water as solvent
solutions which are adjusted to the same pH as by electrolysis.The enhancement of the reduced
the reduced water, the proton on the OH of the water will depend on the ionic properties of the
3rd functional group will react with the OH ions solutes such as species and membrane or ionic
of the reduced water and the OH ions in control
mobility w23,24x.When a non-charged membrane
solutions, and will be neutralized because the OH
is used for the production of reduced water a
of the 3rd functional group of AsA is dissociated
greater difference in ionic mobility between cations
as shown in Eq. (30),
and anions will produce higher dissociation activ-
yOH™OyqHq (30) ity as shown in Fig. 8. In general, the dissociation
activity of water depends on the temperature and
Furthermore, it is considered that proton in OH pressure.The ionic product of water p(Kw) has
of the third functional group of AsA will be used been calculated in a wide range of temperatures
for the neutralization of the alkaline reduced water (0 – 600) and densities by H.Sato et al. w25x.
and proton in that of the 2nd functional group of The difference between p(IP)RW for reduced
AsA which has very low dissociation activity at a water and p(IP)CS for control solutions is shown
pKas11.79 will be used for the superoxide radical in Eq. (31).
dismutation reaction w21,22x.If AsA is mixed with
reduced water, the dissociation activity will
increase because of the higher dissociation activity Dp(IP)sp(IP)CSyp(IP)RW (31)
of the reduced water.The higher dissociation
activity of the reduced water increases the disso-
ciation activity of substances with lower activity.
As shown in Fig. 9, when the neutralization titra- It is considered that the enhancement of anti-
tion was carried out at several different pH levels oxidant effects for superoxide radicals will increase
in reduced water and the control solutions of 2 in proportion to the increase of Dp(IP).Therefore,
mM NaOH, there were significant differences at Dp(IP) for reduced water as solvent is the essential
each pH.It is considered that the increase in parameter.
4.3. The estimation of pIP and entropy produced ence of each electrolyte solution at 0.8 A
by electrolysis in NaCl, KCl, MgCl2 and CaCl2 (DS o)As0.8y(DS o)As 0).The entropy increased in
solutions proportion to the increase of Dp(IP)w .The increase
of entropy means that the reduced water became
Fig.10 shows estimates of p(IP)RW for reduced more active and offered a higher reaction field for
water made from NaCl, KCl, MgCl2, CaCl2, and dissolved substances.Thus, if substances of lower
control solutions using NaCl and KCl.These dissociation activity are dissolved in the reduced
results showed significant differences between water the dissociation activity will increase com-
reduced water and control solutions adjusted to the pared to non-electrolyzed water.
same pH and initial concentration as the reduced
water before electrolysis.In general, DG 0 is related 4.4. The inhibitive effect of reduced water on the
to the dissociation constant K and the electric single-strand breakage of DNA by using H2O2 yCu
potential E o at the equilibrium state as shown in (II) and HQyCu system
Eqs. (25) and (27), can be shown as Eq. (32)
In the present study, the effects of reduced water
DG0synFEo (32) on oxidative DNA damage were investigated by
using H2O2 yCu (II) and HQyCu (II) systems.
E o and hydrogen ionic concentration can be shown Induction of single-strand breaks in the supercoiled
as Eq. (33). double-stranded FX174 plasmid DNA leads to
formation of open circular DNA, while the for-
Eos(RTymnF) lnwHqx (33) mation of a linear form of DNA is indicative of
double-strand breaks w15x.Cu (II), H2O2 is able
Where m is the coefficient of the correction of the to cause strand breaks in isolated DNA.As such,
relationship between E o and pH at KWs10y14. H2O2 yCu (II) has been widely used as a model
system to induce oxidative DNA damage w16,26x.
log IPs2.303(RTymnF) logwHqxqC (34) Although the exact reactive species remain to be
chemically defined, a bound hydroxyl radical or
Thus, pIP is described as Eq. (35). its equivalent derived from the reaction of H2O2
and copper has been suggested to participate in
p(IP)RWs(0.0591ym)pHqC (35) the oxidative DNA damage w15,26x.The addition
of reduced water to H2O2 yCu (II) resulted in
The plot of p(IP)RW vs pH is a straight line marked inhibition of conversion of supercoiled
with a slope of (0.0591ym) and a constant.The DNA to open circular forms, suggesting that
constant C will depend on the properties of elec- reduced water is capable of protecting against the
trolytes and m will depend on the properties of H2O2 yCu (II)-mediated DNA strand breaks. To
the membrane and the interaction between the further determine the inhibitory effects of reduced
membrane and the ions or solvent.The p(IP)CS of water on oxidative DNA damage, HQqCu (II)
the control solutions did not change with a change was used in the present study.It has been previ-
of pH from 9.8 to 10.88 but that of all sample ously shown that the HQyCu (II) system is able
solutions changed linearly with a change of pH to induce DNA breaks, with both Cu (II)yCu (I)
from 9.9 to 10.9. The p(IP)RW of the reduced redox cycle and H2O2 being critically involved.
water decreased in proportion to the increase in Similar to what was observed with the H2O2 yCu
pH.This change will depend on the magnitude of (II), the presence of reduced water also markedly
the applied electric current.Therefore, the disso- protected against DNA strand breaks induced by
ciation energy depends on the electric current used the HQyCu (II) system.Therefore, the results
during electrolysis. suggest that reduced water can prevent oxidative
Entropy is estimated by Eq. (31) using IP DNA damage possibly by enhanced antioxidant
instead of KW.Table 1 shows the entropy differ- effects against superoxide anion radicals as shown
82 K. Hanaoka et al. / Biophysical Chemistry 107 (2004) 71–82
originally by S.Shirahata et al. w27x.Thus, it tions, and methods for their quantification, Toxicol.
Pathol.30 (2002) 620–650.
appears that consumption of electrolyzed reduced w11x J.W. Heinecke, Oxidative stress: new approaches to
drinking water may potentially serve to prevent diagnosis and prognosis in atherosclerosis, Am.J. Car-
DNA damage induced by oxygen free radicals diol.91 (2003) 12A–16A.
produced by the mitochondria due to the rise in w12x R.S. Sohal, Role of oxidative stress and protein oxida-
oxidative stress. tion in the aging process, Free Radic. Biol.Med.33
(2002) 37–44.
w13x K.Hanaoka, Antioxidant effects of reduced water pro-
Acknowledgments duced by electrolysis of sodium chloride solutions, J.
Appl.Electrochem. 31 (2001) 1307–1313.
We would like to thank Dr Yoshiaki Matsuo and w14x J.M. McCord, I. Fridovich, Superoxide dismutase: an
enzymatic function for erythrocuprein (hemocuprein),
Dr Dick Wullaert for stimulating discussion and
J.Biol. Chem. 244 (1969) 6049–6055.
encouragement. w15x Y.Li, M.A. Trush, DNA damage resulting from the
oxidation of hydroquinone by copper: role for a Cu(II)y
References Cu(I) redox cycle and reactive oxygen generation,
Carcinogenesis 14 (1993) 1303–1311.
w16x W.Win, Z. Cao, X.Peng, M.A. Trush, Y. Li, Different
w1x D.Nelson, C.P.Avula, C.Jolly, J.DeVierville, G.
effects of genistein and resveratrol on oxidative DNA
Fernandes, Effect of electrolyzed water intake on lifes-
damage in vitro, Mutat.Res. 513 (2002) 113–120.
pan of autoimmune disease prone mice, FASEB.J.12 w17x J.Butler, Ionic Equilibrium, Wiley-Interscience, New
(1998) A794.
York, 1998.
w2x K.Kikuchi, H.Takeda, B. Rabolt, T. Okaya, Z. Oguchi,
w18x K.Hanaoka, The physico-chemical propertties and its
Y.Saihara, et al., Hydrogen concentration in water from
application in electrolyzed functional water, Fragrance.
an Alkali–Ion–Water electrolyzer having platinum-elec-
J.3 (1999) 18–22.
troplated titanium electrode, J.Appl.Electrochem. 31 w19x K.Asada, Ascorbate peroxidase a hydrogen peroxides-
(2001) 1301–1306.
cavenging enzyme in plants, Physiol.Plant 85 (1992)
w3x K.Kikuchi, H.Takeda, B. Rabolt, T. Okaya, Z. Ogumi,
235–241.
Y.Saihara, et al., Hydrogen particles and supersaturation w20x H.E. Sauberlich, Pharmacology of vitamin C, Annu.
in alkaline water from an Alkali–Ion–Water electroly- Rev.Nutr. 14 (1994) 371–391.
zer, J.Electroanalyt. Chem. 506 (2001) 22–27. w21x M.Nishikimi, Oxidation of ascorbic acid with super-
w4x D.Nelson, Newer technologies for endoscope disinfec-
oxide anion generated by the xanthine-xanthine oxidase
tion: electrolyzed acid water and disposable-component system, Biochem.Biophys.Res. Commun.63 (1975)
endoscope systems, Gastrointest.Endosc.Clin. N. Am. 463–468.
10 (2000) 319–328. w22x D.Cabelli, B. Bielski, Kinetics and mechanism for the
w5x K.S. Venkitanarayanan, C.M. Lin, H. Bailey, M.P. oxidation of ascorbic acidyascorbate by HO2 yOy 2 radi-
Doyle, Inactivation of Escherichia coli O157:H7, Sal- cals, J.Phys.Chem. 87 (1983) 1809–1812.
monella enteritidis, and Listeria monocytogenes on w23x B.Breslau, I.Miller, A hydrodynamic model for elec-
apples, oranges, and tomatoes by lactic acid with hydro- troosmosis, Ind.Eng.Chem. Fundam. 10 (1975)
gen peroxide, J.Food Prot. 65 (2002) 100–105. 554–564.
w6x S.M. Russell, The effect of electrolyzed oxidative water w24x K. Hanaoka, R.Kiyono, M.Tasaka, Thermal membrane
applied using electrostatic spraying on pathogenic and potential across anion-exchange membranes in KCL and
indicator bacteria on the surface of eggs, Poult.Sci. 82 KIO3, J.Memb.Sci. 82 (1993) 255–263.
(2003) 158–162. w25x H.Sato, F.Hirata, Ab initio study on molecular and
w7x H.Sies, Oxidative Stress, Academic Press, London, thermodynamic properties of water: A theoretical pre-
1985. diction of pKw over a wide range of temperature and
w8x M. Kaneko, T.Nakayama, M.Kodama, C. Nagata, density, J.Phys.Chem. B103 (1999) 6596–6604.
Detection of DNA lesions in cultured human fibroblasts w26x K.Yamamoto, S. Kawanishi, Hydroxyl free radical is
induced by active oxygen species generated from a not the main active species in site-specific DNA damage
hydroxylated metabolite of 2-naphthylamine, Gann 75 induced by copper (II) ion and hydrogen peroxide, J.
(1984) 349–354. Biol.Chem. 264 (1989) 15 435–15 440.
w9x J.A. Klein, S.L. Ackerman, Oxidative stress, cell cycle w27x S. Shirahata, S.Kabayama, M.Nakano, T. Miura, K.
and neurodegeneration, J. Clin.Invest.111 (2003) Kusumoto, M.Gotoh, et al., Electrolyzed–reduced water
785–793. scavenges active oxygen species and protects DNA
w10x R.Kohen, A.Nyska, Oxidation of biological systems: from oxidative damage, Biochem. Biophys.Res.Com-
oxidative stress phenomena, antioxidants, redox reac- mun.234 (1997) 269–274.
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS 234, 269 – 274 (1997)
ARTICLE NO. RC976622
Electrolyzed – Reduced Water Scavenges Active Oxygen

Species and Protects DNA from Oxidative Damage
Sanetaka Shirahata,1 Shigeru Kabayama, Mariko Nakano, Takumi Miura,
Kenichi Kusumoto, Miho Gotoh, Hidemitsu Hayashi,* Kazumichi Otsubo,**
Shinkatsu Morisawa,** and Yoshinori Katakura
Institute of Cellular Regulation Technology, Graduate School of Genetic Resources Technology, Kyushu University, 6-10-1
Hakozaki, Higashi-ku, Fukuoka 812-81, Japan; *Water Institute, Nisshin Building 9F, 2-5-10 Shinjuku, Tokyo 160,
Japan; and **Nihon Trim Co. Ltd., Meiji Seimei Jusou Building 6F, 1-2-13 Shinkitano, Yodogawa-ku, Osaka 532, Japan
Received March 21, 1997
ascorbic acid, could directly scavenge H2O2 . Reduced

Active oxygen species or free radicals are considered water suppresses single-strand breakage of DNA by
to cause extensive oxidative damage to biological mac- active oxygen species produced by the Cu(II)-cata-
romolecules, which brings about a variety of diseases lyzed oxidation of ascorbic acid in a dose-dependent
as well as aging. The ideal scavenger for active oxygen manner, suggesting that reduced water can scavenge
should be ‘active hydrogen’. ‘Active hydrogen’ can be not only O•0
2 and H2O2 , but also 1O2 and •OH. q 1997
produced in reduced water near the cathode during Academic Press
electrolysis of water. Reduced water exhibits high pH,
low dissolved oxygen (DO), extremely high dissolved
molecular hydrogen (DH), and extremely negative re-
dox potential (RP) values. Strongly electrolyzed – re- Active oxygen species or free radicals, such as singlet
duced water, as well as ascorbic acid, (/)-catechin and oxygen (1O2), superoxide anion radical (O•0 2 ), hydrogen
tannic acid, completely scavenged O•0 2 produced by the peroxide (H2O2) and hydroxyl radical ( •OH) are consid-
hypoxanthine-xanthine oxidase (HX-XOD) system in ered to cause extensive oxidative damage to biological
sodium phosphate buffer (pH 7.0). The superoxide dis- macromolecules (DNA, membrane polyunsaturated
mutase (SOD)-like activity of reduced water is stable fatty acid chains, enzymes and so on), which bring
at 47C for over a month and was not lost even after about a variety of diseases, as well as aging (1, 2). We
neutralization, repeated freezing and melting, defla- believe that the ideal countermeasure against active
tion with sonication, vigorous mixing, boiling, re- oxygen is ‗active hydrogen‘. Electrolysis of water pro-
peated filtration, or closed autoclaving, but was lost duces reduced and oxidized water near the cathode and
by opened autoclaving or by closed autoclaving in the
anode, respectively. Reduced water exhibits high pH,
presence of tungsten trioxide which efficiently ad-
low dissolved oxygen (DO), high dissolved hydrogen
sorbs active atomic hydrogen. Water bubbled with hy-
(DH) and significant negative redox potential (RP) val-
drogen gas exhibited low DO, extremely high DH and
ues. Soft water in Japan made it possible to develop
extremely low RP values, as does reduced water, but
domestic devices to reform water by electrolysis about
it has no SOD-like activity. These results suggest that
the SOD-like activity of reduced water is not due to the half a century ago.
dissolved molecular hydrogen but due to the dissolved So far, the characteristics of neither reduced water
atomic hydrogen (active hydrogen). Although SOD ac- nor oxidized water have been well clarified. Based upon
cumulated H2O2 when added to the HX-XOD system, the interesting clinical improvement of a variety of dis-
reduced water decreased the amount of H2O2 produced eases by intake of reduced water since 1985, Hayashi
by XOD. Reduced water, as well as catalase and proposed the hypothesis ‗Water Regulating Theory‘ (3).
Here, based on his theory we first demonstrate that
reduced water scavenges active oxygen species and pro-
1
To whom correspondence should be addressed. Fax: 81-92-642-
tects DNA from damage by oxygen radicals.
3052. E-mail: [email protected].
Abbreviations: AET, 2-(aminoethyl)isothiuronium; AsA, ascorbic
acid; CL, chemiluminescence; CLA, Cypridina luciferin analog; DO, MATERIALS AND METHODS
dissolved oxygen; DH, dissolved hydrogen, EC, electrical conduc-
tance; HX, hypoxanthine; RP, redox potential; SOD, superoxide dis- Electrolysis of water. Ultrapure water produced by an ultrapure
mutase; XOD, xanthine oxidase. system (ULTRAPUR LV-10T, TORAY, Tokyo) was added 0.1 g/l NaCl
269 0006-291X/97 $25.00

Copyright q 1997 by Academic Press
All rights of reproduction in any form reserved.
Vol. 234, No. 1, 1997 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
to elevate electrical conductance (EC) to about 20 ms/m. The water

was then electrolyzed with various voltages by an electrolyzing de-
vice (Type TI-7000S and TI-7000SL, Nihon Trim Co., Osaka)
equipped with a platinum-coated titanium electrode to produce re-
duced water which exhibited various RP. RP, EC, DO and DH were
measured using a RP meter (type, HM-14P), a EC meter (CM-14P),
a DO meter (DO-14P) and a DH meter (DHDI-1) from Toa Electronics
Ltd. (Tokyo) at 257C. pH was measured using a pH meter (Beckman,
Type pHI32) at 257C.
Assay of the SOD-like activity of reduced water, ascorbic acid (AsA),
(/)-catechin, and tannic acid. The reaction mixture (1 ml) for mea-
suring chemiluminiescence (CL) intensity specific to O•0 2 contained
500 mM hypoxanthine (HX), 200 mM EDTA, 40 mM sodium phos-
phate buffer (pH 7.0), 0.6 ml of the reduced water or NaOH solution
of the same pH as reduced water, 2.5 mM 2-methyl-6-phenyl-3,7-
dihydroimidazo[1,2-a] pyrazin-3-one (Cypridina luciferin analog
(CLA), Tokyo Kasei Industrial Co., Tokyo) and 0.5 U/l of xanthine
oxidase (XOD) (Wako Purechemical Industries, Tokyo). The CL in-
tensity of the reaction mixture (0.85 ml) except for XOD solution was
measured in a glass-tube in a CL reader (Aloka, type BLR-301) at
26 7C. At 18 seconds time point, 0.15 ml of XOD solution was injected
into the tube and the CL intensity was continuously measured for
120 sec. The change of the CL intensity in the presence of reduced
water, SOD derived from bovine erythrocytes (Sigma), AsA (Wako),
(/)-catechin (Wako) or tannic acid (Wako) was measured with the
HX-XOD system to evaluate the scavenging activity of O2•0 . The
strongly reduced water (RP, 0820 mV; pH 11.0) was diluted with a
NaOH solution (pH 11.0) to assure the same final pH of the reaction
mixture (pH 7.3) among the test samples. The extinguishing rate of
O•0
2 (%) was calculated by dividing the total CL intensity of the test
sample by that of the control.
Analysis of catalase-like activity of reduced water and AsA. The
reaction mixture (100 ml) of the HX-XOD system described above in
the presence or absence of SOD or reduced water was put into a 96-
well microplate and incubated at 37 7C. Time course of the change
in the H2O2 concentration was measured by the addition of 200 ml
of substrate containing peroxidase (0.3 mg/ml 2,2 *-azino-di-(3-ethyl
benzthiazolin sulfonic acid), 0.1 M citrate buffer, pH 4.0, streptavi-
dine-horseradish peroxidase conjugate (Amersham) diluted to 1000
times). Absorbency of the reaction product was measured at 405 nm
by an ELISA reader. In order to examine the catalase-like activity,
the H2O2 solution was directly incubated with control NaOH solution
(pH 11.0), reduced water (pH 11.0), AsA or catalase (Wako) in 40
mM sodium phosphate buffer (pH 7.0) at 37 7C and the H2O2 concen- FIG. 1. Relationships of RP with pH (A), DO (B) and DH (C) in
trations were determined. electrolyzed-reduced water. Ultrapure water was electrolyzed by an
Analysis of single-strand breakage of DNA caused by active oxygen electrolyzing device and RP, pH, DO and DH values were immedi-
species produced by the Cu(II)-catalyzed oxidation of AsA. Time- ately measured. The data of water before electrolysis was shown by
course of the single-strand DNA breaking reaction caused by Cu(II)- dark squares. Arrows show the reduced water which exhibited the
catalyzed oxidation of AsA was examined by using super-coil plas- strong SOD-like activity.
mid DNA. One mg of pBluescript II plasmid DNA (Stratagene, La
Jolla, CA) was incubated with the mixture of 25 mM AsA and 25
mM CuSO4 in 20 ml of 20 mM sodium phosphate buffer (pH 7.5)
containing 17 ml of reduced water, NaOH solution of the same pH the cathode and oxidation at the anode. Dissociation of
as the reduced water, SOD, catalase, 2-(Aminoethyl)isothiuronium H2O produces H/ and OH0 ions. At the cathode, H/
(AET)(Wako), KI (Wako), or NaN3 (Wako) at 377C for various peri-
ions gain electrons to change into active atomic hydro-
ods of time. The reaction was stopped by adding 4 ml of 15 mM
EDTA (pH 7.0). Super-coil DNA, open-circular DNA and linear DNA
gen (H). Active atomic hydrogen exhibits high reducing
were separated by electrophoresis with 1% agarose gel and any potential. It is then changed to hydrogen molecules (H2)
changes of the amount of super-coil DNA were determined from the which are chemically inert at room temperature. At
photo images by a NIHimage computer software. the anode, OH0 ions lose electrons to form OH, which
results in the production of O2 and H2O. Cathodic alka-
RESULTS AND DISCUSSION line water (reduced water) is abundant in DH, whereas
anodic acidic water (oxidized water) is abundant in DO.
Characteristics of electrolyzed – reduced water. The The relationships of RP with pH, DO, and DH in re-
principle of electrolysis was founded by Michael Fara- duced water were shown in FIG. 1. Marked changes in
day (1791-1867). In this process, reduction occurs at these values occur in water after electrolysis. It should
270
from 0.0002 mg/l to 0.0001 mg/l; but no change of pH.

As shown in FIG. 2A, water bubbled with hydrogen gas
(H2-water) and nitrogen gas (N2-water) showed de-
creased CL intensity by about 20% as compared to that
of the control in the steady state, suggesting that the
decreased CL intensity in N2-water and H2-water was
due to low DO and H2-water had no SOD-like activity.
The SOD-like activity of reduced water is retained dur-
ing storage, although the RP and DH values exhibit
decay. These results clearly indicate that dissolved mo-
lecular hydrogen gas in reduced water was responsible
for the negative RP value, but not for the SOD-like
activity.
Stability of the SOD-like activity of reduced water.
The SOD-like activity of reduced water was very stable
in a closed glass bottle at 47C for over a month. The
activity was not lost even after neutralization, repeated
freezing and melting, deflation with sonication for 10
minutes, repeated filtration with a 0.22 mm filter, boil-
ing for 10 minutes, or autoclaving in a closed glass
FIG. 2. Analysis of the SOD-like activity of reduced water.
(A) Effects of reduced water, SOD, H 2-water and N 2-water on the bottle at 1217C for 20 minutes (FIG. 2B). However, 90%
accumulation of O2•0 generated by the HX-XOD system. The CL the SOD-like activity was lost by autoclaving in an
intensity was determined in phosphate buffer (pH 7.0) in the pres- opened glass bottle, suggesting that the active sub-
ence of reduced water (RP 0820 mV, pH 11.0; IC50SO(18%)), a stance in the reduced water is volatile. Atomic hydro-
NaOH solution of the same pH as reduced water, SOD, H 2-water,
or N 2-water. h, control NaOH solution; j, reduced water; m, SOD
gen is volatile and can reduce metallic oxide such as
(0.13 U/ml); s, SOD (66.7 U/ml); l, H 2-water; n, N 2-water. (B) tungsten trioxide, though molecular hydrogen cannot
Stability of the SOD-like activity of reduced water. h, control easily do this (5). A sensitive detection method of
NaOH solution. l, reduced water and reduced water treated with atomic hydrogen is based on the color change of tung-
repeated freezing and melting, deflation with sonication, vigorous sten trioxide by reduction (6). The closed autoclaving
mixing for 10 minutes, boiling for 10 minutes, repeated filtration
with 0.22mm filter, or closed autoclaving at 1217C for 20 minutes.
of reduced water with tungsten trioxide at 1217C for
m, reduced water treated with opened autoclaving at 1217C for 20 20 minutes resulted in the loss of 52% of the SOD-like
minutes. n, reduced water treated with closed autoclaving in the activity (FIG. 2B). These results strongly suggest that
presence of tungsten trioxide (0.5 g/70ml reduced water) at 1217C the substance responsible for the SOD-like activity of
for 20 minutes. (C) The SOD-like activity of diluted reduced water.
reduced water is active atomic hydrogen. Active hydro-
Amount of reduced water (%): h, 60%; /, 30%; *, 26%; m, 23%; h,
21%; L, 20%; l, 19%; ,, 15%; s, 7.5%; , 0% (control). (D) Inhibi-
gen in gas phase is rather stable taking into consider-
tion of the accumulation of O•0
2 by variously diluted reduced water. ation of the collision rate (7). Since two atoms of hydro-
All experiments were triplicated and the average values were gen in the ground state have larger energy than molec-
shown in the figures. The SD errors were within 5%. ular hydrogen in any stable state, the extra energy is
required to be eliminated by a third substance to pro-
duce a hydrogen molecule from two atoms of hydrogen
be noticed that the DH value is higher in reduced water by collision (8). Atomic hydrogen can stably exist
than in the original water by two orders of magnitude. avoiding the attack by oxygen in solution and crystals
The SOD-like activity of reduced water. XOD oxi- at room temperature for a period longer than a year
dizes HX to xanthine, coupling to generation of O•0 2 (9). Water vapor is known to prevent the recombination
from O2 . CLA specifically reacts with O•0 1
2 and O2 and of atomic hydrogen on a tungsten surface (8). The char-
emits a CL (4). As shown in FIG. 2A, reduced water acteristics in aqueous solution of active atomic hydro-
completely inhibited the CL, demonstrating the SOD- gen produced by electronic discharge is under investi-
like activity of reduced water. Since the CL was com- gation.
pletely inhibited by SOD, the CL was specific to O•0
2 . When XOD solution was injected into the reaction
Bubbling of hydrogen gas into a NaOH solution (pH mixture containing the diluted reduced water, strong
10.5) for 5 minutes resulted in remarkable changes of CL was emitted immediately after injection (FIG. 2C),
RP from /116 mV to 0842 mV; DO from 7.66 mg/l to but the intensity of CL rapidly dropped below the con-
1.98 mg/l; DH from 0.0002 mg/l to 0.938 mg/l; but no trol value. The initial strong transient emission of CL
change of pH. Bubbling of nitrogen gas into a NaOH in diluted reduced water could be inhibited by SOD,
solution (pH 10.5) resulted in changes of RP from /116 indicating that a large amount of O•0 2 was transiently
mV to /83 mV; DO from 7.66 mg/l to 1.82 mg/l; DH generated just after the addition of XOD. AsA, (/)-
271
catechin and tannic acid, as well as SOD, did not show

such a strong initial transient emission of CL (data not
shown). Injection of the solvent without enzyme did not
result in an emission of CL. More detailed experiments
will be needed to clarify the mechanism of this phenom-
enon. The inhibitory effect of reduced water on the ac-
cumulation of O•02 was increased in a dose-dependent
manner as shown in FIG. 2D, suggesting the stoichio-
metric action of active substance in reduced water.
Definition of the SOD-like activity of reduced water.
Since this paper first reports the O2•0 scavenging activ-
ity of electrolyzed-reduced water, the standardization
of this activity is needed to compare the reducing po-
tency of the reduced water prepared each time. In order
to standardize the reducing potency of the reduced wa-
ter, we defined a IC50SO unit as a reducing potency of
which reduced water can scavenge 50% of O•0 2 gener-
ated by the HX-XOD system under the conditions de-
scribed in the MATERIALS AND METHODS section
and a IC50SO (%) as the concentration (%) of reduced
water in which the 50% of O•0 2 generated by the HX-
XOD system is scavenged. The IC50SO values of SOD,
AsA, (/)-catechin, and tannic acid were 0.05 U/ml, 3
mM (0.53 mg/ml), 130 mM (38 mg/ml), and 33 mg/ml in
the HX-XOD system used here.
Catalase-like activity of reduced water. Although
reduced water could scavenge O2•0 , there was a possi-
bility that reduced water inhibited the enzyme activity
of XOD or inhibited the reaction between O2•0 and the
luciferin analog reagent. To eliminate this possibility,
the production of H2O2 was determined in the HX-XOD
system. XOD can produce not only O•0 2 but also H 2O 2
in this HX-XOD system. As shown in FIG. 3A, XOD
produced H2O2 even in the presence of reduced water,
FIG. 3. The SOD-like and catalase-like activity of reduced water
demonstrating no inhibition of the enzyme activity by and AsA. (A) Change of the amount of H2O2 in the HX-XOD system
reduced water. As expected, the addition of SOD to the in the presence of SOD or reduced water. SOD (70 U/ml) or reduced
HX-XOD system resulted in the accumulation of H2O2 , water (12 IC50SO units) were incubated in the HX-XOD system at
indicating that O•0
2 produced by XOD was changed to 37 7C. h, control NaOH; L, reduced water; s, SOD. (B) Degradation
H2O2 by SOD. Reduced water first accumulated H2O2 of H2O2 by reduced water, AsA and catalase. Reduced water (12
IC50SO units), AsA (100 mM) or catalase (20 U/ml) was incubated
and then gradually lowered the concentration of H 2O 2 , with H2O2 (70 mM) in 20 mM sodium phosphate buffer (pH 7.5) at
suggesting that reduced water exhibits not only SOD- 37 7C. h, control; L, reduced water; n, AsA; s, catalase. All experi-
like activity but also catalase-like activity. The fact ments were triplicated and the average values were shown. The stan-
that reduced water stimulated the accumulation of dard errors were shown by vertical bars. In (B) most of the SD error
bars are embedded in the symbols.
H2O2 in the HX-XOD system in the first 5 minutes
indicated that the decreased CL intensity in the pres-
ence of reduced water is not due to the inhibition of
the reaction between O•0 2 and luciferin analog by re-catalyzed oxidation of AsA is known to produce O•0 2
duced water, but due to the conversion of O•0
2 into H 2 O2
and H2O2 which react to produce •OH (12). In order to
by reduced water. To demonstrate the catalase-like ac- demonstrate that reduced water can scavenge not only
tivity of reduced water, H2O2 was directly incubated O•0
2 and H2O2 but also other active oxygen species, we
with reduced water. As shown in FIG. 3B, reduced wa- examined the effect of reduced water on DNA breakage
ter scavenged H2O2 as well as AsA and catalase. caused by the mixture of AsA and Cu(II). Super-coil
Suppressive effect of reduced water on the single- plasmid DNA (Form I) changes to open-circular DNA
strand breakage of DNA caused by the Cu(II)-catalyzed (Form II) by a single-strand breakage. Open-circular
oxidation of AsA. The DNA strand breakage is caused DNA changes to linear DNA (Form III) by a double-
by the mixture of AsA and Cu(II) (10, 11). The Cu(II)- strand DNA breakage. When plasmid DNA was incu-
272
bated with the mixture of AsA and Cu(II), the amount TABLE 1
of super-coil DNA gradually decreased (FIG. 4). How- Effect of Reduced Water, SOD, Catalase, and Various
ever, reduced water significantly inhibited the single- Radical Scavengers on Single-Strand Breakage of DNA by
strand breakage by the mixture of AsA and Cu(II). As the Cu(II)-Catalyzed Oxidation of AsA
shown in Table 1, reduced water inhibited the DNA
Addition Concn Specificity Inhibin, %
breaking reaction in a dose-dependent manner. Cata-
lase also inhibited the breaking reaction but SOD did Reduced water 3.7 IC50SO units 19
7.5 IC50SO units 38
15 IC50SO units 49
SOD 150 U/ml O•02 2
Catalase 0.8 U/ml H2O2 6
4 U/ml H2O2 36
20 U/ml H2O2 90
AET a 4 1 1005 M gereral 44
KI 1 1 1002 M •
OH 18
5 1 1002 M •
OH 53
NaN3 1 1 1002 M 1
O2 14
5 1 1002 M 1
O2 43
a
AET Å 2-(aminoethyl)isothiuroium.
not, indicating that H2O2 participated in the breaking

reaction, but O2•0 did not. Both radical scavengers spe-
cific to •OH or 1O2 inhibited the breaking reaction.
These results indicated that reduced water can prevent
DNA damage caused by active oxygen species such as
H2O2 , •OH, and 1O2 produced by the Cu(II)-catalyzed
oxidation of AsA. Significant synergistic effect between
reduced water and the radical scavengers used here
was not observed (data not shown). It is noteworthy
that reduced water can prevent DNA damage even in
the presence of metallic ions which catalyze the autoox-
idation of most established antioxidants and reverse
their protective effect against active oxygen species.
However, the water must have a higher reducing abil-
ity for this purpose than scavenging O•0 2 .
Although aerobic organisms have evolved by acquisi-
tion of the ability to utilize oxygen, oxygen is princi-
pally a toxic substance. Recently biological activation
of hydrogen by hydrogenases was reported (13). Hydro-
genases, which are among in the oldest enzymes (3.8
billion years old), can reversibly split molecular hydro-
gen to produce active atomic hydrogen. Active atomic
FIG. 4. Inhibitory effect of reduced water on single-strand break-
age of DNA caused by oxygen radicals produced by the Cu(II)-cata-
hydrogen may have participated in the redox regula-
lyzed oxidation of AsA. (A) Electrophoresis of plasmid DNA treated tion of cellular functions. Water can permeate every-
with the mixture of AsA and Cu(II) in the presence of 4.1 IC50SO where in the body and penetrates every membrane in-
units of reduced water (RP, 0659 mV; pH 10.5; IC50SO(18%)) or cluding the blood-brain barrier. To neutralize the toxic
NaOH solution (pH 10.5). SC, super-coil DNA. OC, open-circular action of active oxygen species, electrolyzed-reduced
DNA. Lane 1, marker (l DNA-HindIII); lane 2, control DNA (2
hours); lane 3, DNA / Cu(II) (2 hours); lane 4, DNA / AsA (2 hours).
water may be an ideal and very powerful antioxidant.
Lanes 5, 7, 9, 11 and 13 show the DNA breaking reaction by the Further intensive investigation on the effect of reduced
mixture of AsA and Cu(II) in the presence of NaOH solution for 0, water on cell biology, immunology and oncology should
15, 30, 60 and 120 minutes, respectively. Lanes 6, 8, 10, 12 and 14 be promoted.
show the DNA breaking reaction by the mixture of AsA and Cu(II)
in the presence of reduced water for 0, 15, 30, 60 and 120 minutes,
respectively. (B) Decrease of the relative amount (%) of super-coil
ACKNOWLEDGMENTS
DNA during the incubation of plasmid DNA with the mixture of AsA
and Cu(II) in the presence of reduced water (s) or NaOH solution
(l). Average values of two independent experiments (nÅ2, each) were We are grateful to Dr. David Barnes, Oregon State University,
shown. The vertical bars show the SD errors. and Mr. Mark Selby for their critical reading of the manuscript.
273
REFERENCES 7. Tanaka, T. (1969) Chemistry of Free Radical, Iwanami Shoten,

Tokyo.
8. Langmuir, I. (1927) Ind. Eng. Chem. 19, 667 – 674.
1. Sohal, R. S., and Weindruch, R. (1996) Science 273, 59 – 63. 9. Sasamori, R., Okaue, Y., Isobe, T., and Matsuda, Y. (1994) Sci-
2. Feig, D. I., Reid, T. M., and Loeb, L. A. (1994) Cancer Res. 54, ence 265, 1691 – 1693.
1890s – 1894s. 10. Shinohara, K., So, M., Nonaka, M., Nishiyama, K., Murakami,
3. Hayashi, H. (1995) Explore 6, 28 – 31. H., and Omura, H. (1983) J. Nutr. Sci. Vitaminol. 29, 481 – 488.
11. Chiou, S.-H. (1983) J. Biochem. 94, 1259 – 1267.
4. Nakano, M., Sugioka, K., Ushijima, Y., and Goto, T. (1986) Anal.
Biochem. 159, 363 – 369. 12. Scarpa, M., Stevanato, R., Viglino, P., and Rigo, A. (1983) J.
Biol. Chem. 258, 6695 – 6697.
5. Gadgil, K., and Gonzalez, R. D. (1975) J. Catal. 40, 190 – 196. 13. Happe, R. P., Roseboom, W., Plerik, A. J., Albracht, S. P. J., and
6. Austin, L. G. (1961) Ind. Eng. Chem. 53, 659 – 661. Bagley, K. A. (1997) Nature 385, 126.
274
234 Biol. Pharm. Bull. 30(2) 234—236 (2007) Vol. 30, No. 2
Preservative Effect of Electrolyzed Reduced Water on Pancreatic b -Cell

Mass in Diabetic db/db Mice
Mi-Ja KIM,a,b Kyung Hee JUNG,c Yoon Kyung UHM,c Kang-Hyun LEEM,d and Hye Kyung KIM*,e
a
Department of Obesity Management, Graduate School of Obesity Science, Dongduk Women’s University; Seoul 136–714,
South Korea: b Imagine Obesity Institute, 117 Purynsol Mun Wa Gyun, Kyung Hee University; 1 Hoegi-Dong,
Dongdaemun-Gu, Seoul 136–701, South Korea: c Department of Pharmacology, College of Medicine, Kyung Hee
University; 1 Hoegi-Dong, Dongdaemun-Gu, Seoul 136–701, South Korea: d College of Korean Medicine, Semyung
University; Jaechon, 370–711, South Korea: and e Department of Food and Biotechnology, Hanseo University; Seosan
356–706, South Korea. Received July 27, 2006; accepted November 10, 2006
Oxidative stress is produced under diabetic conditions and involved in progression of pancreatic b -cell dys-
function. Both an increase in reactive oxygen free radical species (ROS) and a decrease in the antioxidant defense
mechanism lead to the increase in oxidative stress in diabetes. Electrolyzed reduced water (ERW) with ROS scav-
enging ability may have a potential effect on diabetic animals, a model for high oxidative stress. Therefore, the
present study examined the possible anti-diabetic effect of ERW in genetically diabetic mouse strain C57BL/6J-
db/db (db/db). ERW with ROS scavenging ability reduced the blood glucose concentration, increased blood in-
sulin level, improved glucose tolerance and preserved b -cell mass in db/db mice. The present data suggest that
ERW may protects b -cell damage and would be useful for antidiabetic agent.
Key words electrolyzed reduced water; diabetic mice; blood glucose; insulin; glucose tolerance; pancreatic b -cell mass
All oxidative reactions are a continuous source of poten- tively. Electrolyzed reduced water (ERW) exhibits high pH
tially cytotoxic reactive oxygen species (ROS), which play an (pH 10—12), low dissolved oxygen (1.3—3.5 mg/l), high
important role in living systems both through their beneficial dissolved hydrogen (0.3—0.6 mg/l), and significant negative
and detrimental effects.1) Under physiological conditions, redox potential ( 400— 900 mV). The ideal scavenger for
ROS are fully inactivated by an elaborated cellular and extra- ROS is ―reactive hydrogen‖. Since oxidative damage has
cellular antioxidant defense system.2) However, under certain been implicated in the etiology of diabetic complication,
conditions increased generation of ROS and/or reduction of ERW, a potent ROS scavenger, may have a therapeutic role in
the antioxidant capacity leads to enhanced ROS activity and diabetic mellitus. Therefore, the present study examined the
oxidative stress. beneficial effect of ERW on b -cell damage and glycemic
Hyperglycemia, the primary clinical manifestation of dia- control in diabetic mouse strain of C57BL/6J-db/db (db/db)
betes, is the most responsible factor for the development of which exhibits many of the metabolic disturbances of human
various chronic diabetic complications.1) The chronic pres- type 2 diabetes including hyperglycemia, obesity, and insulin
ence of high glucose levels enhances the production of ROS resistance.10)
from protein glycation and glucose autoxidation.3) Diabetes
also disturbs natural antioxidant defense systems.4) Previous MATERIALS AND METHODS
studies have shown that antioxidants such as quercetin,
ascorbate and b -carotene resulted in an improvement of the Materials The ERW was produced by AK-3000 (Nexus,
antioxidant status in diabetic rats.5,6) Korea). This water was produced by the electrolysis of water
During the progression of type 2 diabetes, the develop- from a municipal water system. The ERW used in this study
ment of both insulin resistance and a - and b -cell dysfunc- has the following physical properties: pH 10.24 0.03 and an
tions appear to be the basic metabolic abnormalities leading oxidative-reduction potential of 400.2 17.3 mV.
to the long term disease.7) Once hyperglycemia becomes ap- Animals Genetically diabetic male db/db (C57BL/6J
parent, b -cell function progressively deteriorates: glucose-in- db/db) and their non-diabetic heterozygous littermates
duced insulin secretion becomes further impaired and de- (db/ ) at 3 weeks of age were purchased from Jackson Lab-
granulation of b -cells becomes evident, often accompanied oratory (Bar Harbor, ME, U.S.A.). Mice were housed under
by a decrease in the number of b -cells.8) The maintenance of temperature (20—26 °C) and light (12-h light/dark cycle)
b -cell mass is a dynamic process, undergoing both increases controlled conditions. All animals had free access to standard
and decreases to maintain glycemia within a narrow physio- rodent pellet food (NIH #31M, Samtako, Korea), except
logical range.9) The majority of patients with obesity causing when fasted before experiments. The study has been carried
insulin resistance are not diabetic, as their capacity for b -cell out along the ―Principles of laboratory animal care‖ (WHO,
compensation is maintained but, 15—20% of these individu- 1985), and the ―guidelines of the Animal Care and Use Com-
als become diabetic, when the b -cells lose their compensa- mittee‖ of the Kyunghee University. The db/db (D) and non-
tory ability.9) Therefore, one approach to preventing and diabetic control mice (N) were each randomly divided into 2
treating diabetes could be through the enhancement of b -cell groups (n 8); tap water (DC, NC) or ERW (DE, NE) group.
mass. Blood Glucose and Insulin Measurements At the end
Electrolysis of aqueous NaCl or KCl solutions by di- of 4 weeks of experimental period, mice were fasted
aphragm-type electrolyzing devices produces oxidized and overnight and injected with glucose (1 g/kg, i.p.). Blood sam-
reduced water at the anodic and the cathodic side, respec- ples were collected from the tail vein at various time points
∗ To whom correspondence should be addressed. e-mail: [email protected]; © 2007 Pharmaceutical Society of Japan
[email protected]
February 2007 235
(0—120 min) after glucose loading, and blood glucose levels Table 1. Fasting Blood Glucose and Insulin Levels
were measured by One touch Basic glucose measurement
NC NE DC DE
system (Life Scan Inc., U.S.A.). Mice were killed by decapi-
tation immediately after 120 min blood sample was taken and Blood glucose (mg/dl) 129.0 6.8a 125.4 3.9a 490.1 32.4b 287.9 34.5c
blood samples were taken from the cervical wound. Plasma Blood insulin (ng/ml) 0.71 0.02a 0.68 0.01a 1.55 0.09b 5.72 0.49c
glucose and insulin concentrations were determined with
Values are means S.E.M. (n 8); means in same raw with different superscripts are
commercially available kits (Sigma Co., U.S.A.). significantly different (p 0.05).
Immunohistochemical Staining of Pancreatic Islet Cell
Pancreatic islet cell mass is a major determinant of the in-
sulin secretory capacity. The four groups were used for histo-
logical studies. Pancreases were removed, and then fixed with
10% formalin. Immunohistochemical staining of b -cells
using an anti-insulin antibody (Dako, Santa Barbara, CA,
U.S.A.) was performed11) with 5 m m sections of formalin
fixed and paraffin embedded pancreas.
Statistical Analysis Results were presented as mean
S.E.M., and the data were analyzed by ANOVA followed
by Tukey HSD‘s post-hoc test.
RESULTS AND DISCUSSION
No differences in food intake, water intake, and body

weight were observed by ERW consumption in db/db and
Fig. 1. Effect of Electrolyzed Reduced Water (ERW) on Glucose Toler-
non-diabetic control mice (data not shown). Blood glucose ance in Genetically Diabetic db/db Mice
levels of diabetic mice (DC) were significantly higher than Normal db/ mice fed tap water (NC); normal db/ mice fed ERW (NE); db/db
non-diabetic control mice (NC), and ERW consumption sig- mice fed tap water (DC); db/db mice fed ERW (DE). Data are expressed as
nificantly lowered (41%) the blood glucose levels in hyper- means S.E.M.
glycemic db/db mice (DE) without any effect in non-diabetic

control mice (NE, Table 1). Plasma insulin levels of diabetic
mice were more than 2-fold higher than control mice indicat-
ing insulin resistance in type 2 diabetes. Interestingly, ERW
administration also increased insulin level in diabetic mice
without any effect in control mice, suggesting elevated in-
sulin release in diabetic mice. This increased insulin levels in
diabetic mice resulted from increased pancreatic b -cell mass
(Fig. 2).
Intraperitoneal glucose tolerance test revealed that glucose
tolerance in diabetic db/db mice exhibited significantly
higher glucose level during all time points determined (Fig.
1). After glucose loading, the increase in serum glucose con-
centrations in diabetic mice was very slow, while normal
mice exhibited sharp increase in glucose level with peak con-
centration at 15 min, indicating delayed glucose homeostasis
in db/db mice. ERW administration ameliorated glucose tol-
erance in diabetic db/db mice without any affect in control
mice. Fig. 2. Images of Pancreases Immunohistochemical Staining for Insulin
Significant histological differences were noted between Pancreases from non-diabetic control (a), non-diabetic treated with ERW (b), dia-
betic db/db control (c), or ERW treated db/db mice (d) were immunostained with anti-
db/db mice and their non-diabetic littermates. When b -cells insulin antibody. (c) shows weak staining of b -cells with anti-insulin antibodies in
were stained with anti-insulin antibodies, weak staining of b - db/db mice compared with non-diabetic control (a). db/db mice consumed ERW exhib-
cells were observed in db/db mice (Fig. 2c) compared with ited strong staining (d), as seen in control (a). The bar indicates 100 m m.
control mice (Fig. 2a). ERW supplemented db/db mice ex-

hibited strong staining (Fig. 2d), as seen in the lean litter- low expression of antioxidant enzymes,12) pancreatic b -cells
mates (Fig. 2b). may be rather sensitive to ROS attack when they are exposed
This study clearly demonstrated that treatment with ERW to oxidative stress. Chronic hyperglycemia is not only a
ameliorates hyperglycemia and improves glucose handling marker of poor glycemic control in diabetes but is itself a
capacity in obese diabetic db/db mice. In addition, immuno- cause of impairment of both insulin secretion and biosynthe-
histochemical examination revealed that treatment with ERW sis: prolonged exposure of pancreatic b -cells to high glucose
can prevent loss of b -cell mass resulting in increase of in- levels is known to cause b -cell dysfunction, called glucose
sulin secretory capacity. toxicity.13) Such damaged b -cells often display extensive de-
Recently, pancreatic b -cells emerged as a target of oxida- granulation, and are clinically associated with the develop-
tive stress-mediated tissue damage. Because of the relatively ment of diabetes in some model animals for type 2 dia-
236 Vol. 30, No. 2
betes.14) Thus, it is likely that oxidative stress plays a major cine,‖ Oxford University Press, New York, U.S.A., 1999, pp. 20—37.
role in b -cell deterioration in type 2 diabetes. The restoration 2) Yu B. P., Physiol. Rev., 74, 139—162 (1994).
3) Feillet-Coudray C., Rock E., Coudray C., Grzelkowska K., Azais-
of glucose induced secretory capacity after ERW consump- Braesco V., Dardevet D., Mazur A., Clin. Chem. Acta, 284, 31—34
tion is thought to be due to elimination of glucose toxicity re- (1999).
sulting in protection from the toxic effects of ROS. Indeed, 4) West I. C., Diabet. Med., 17, 171—180 (2000).
ERW consumption increased b -cell mass (Fig. 2) and insulin 5) Mahesh T., Menon V. P., Phytother. Res., 18, 123—127 (2004).
6) Young I. S., Torney J. J., Trimble E. R., Free Rad. Biol. Med., 12, 41—
level (Table 1). Tanaka et al.15) reported that chronic hyper-
46 (1992).
glycemia impairs b -cell function at the level of insulin syn- 7) Saad M. F., Knonwler W. C., Pettitt D. J., Nelson R. G., Charles M. A.,
thesis as well as insulin secretion, and all of these adverse Bonnett P. H., Am. J. Med., 90, 229—235 (1991).
consequences can be prevented by antioxidants. ERW, con- 8) Yki-Jarvinen H., Endocrine Rev., 13, 415—431 (1992).
taining active atomic hydrogen with high reducing ability 9) Bonner-Weir S., Trends Endocrinol. Metab., 11, 375—378 (2000).
10) Surwit R. S., Seldin M. F., Kuhn C. M., Cochrane C., Feinglos M. N.,
which can contribute to ROS scavenging activity,16) could re- Diabetes, 40, 82—87 (1991).
duce oxidative stress in pancreatic islets and loss of b -cell 11) Than S., Ishida H., Inaba M., Fukuba Y., Seino Y., Adachi M., Imura
mass was eventually prevented. Therefore, ERW administra- H., Ikehara S., J. Exp. Med., 176, 1233—1238 (1992).
tion improved islet b -cell function resulting in increased re- 12) Tiedge M., Lortz S., Drinkgern J., Lenzen S., Diabetes, 46, 1733—
lease of circulating insulin and improved insulin sensitivity, 1742 (1997).
13) Poitout V., Olson L. K., Robertson R. P., J. Clin. Invest., 97, 1041—
and thus, ameliorate hyperglycemia and delay the develop- 1046 (1996).
ment of diabetes in these diabetic mice model. 14) Kaneto H., Kajimoto Y., Miyagawa J., Matsuoka T., Fujitani Y.,
To our knowledge, this is the first report showing protec- Umayahara Y., Hanafusa T., Matsuzawa Y., Yamasaki Y., Hori M., Di-
tive effect of ERW on b -cell mass in diabetic animal models. abetes, 48, 2398—2406 (1999).
15) Tanaka Y., Gleason C. E., Tran P. O. T., Harmon J. S., Robertson R. P.,
Proc. Natl. Acad. Sci. U.S.A., 96, 10857—10862 (1999).
REFERENCES 16) Shirahata S., Kabayama S., Nakano M., Miura T., Kusumoto K.,
Gotoh M., Hayashi H., Otsubo K., Morisawa S., Katakura Y.,
1) Halliwell B., Gutteridge J. M. C., ―Free Radicals in Biology and Medi- Biochem. Biophys. Res. Commun., 234, 269—274 (1997).
Kidney International, Vol. 58 (2000), pp. 1859–1869

Kangen Water Intensive Scientific and Clinical Research Part 1

Uploaded by

Copyright:

Available Formats

Kangen Water Intensive Scientific and Clinical Research Part 1

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Kangen Water Intensive Scientific and Clinical Research Part 1

Uploaded by

Copyright:

Available Formats

Enagic® – Kangen Scientific/Clinical Research

Enagic Certifications - http://www.enagic.com/technology_certificates.php

You want SCIENTIFIC & CLINICAL RESEACH?

Chronic Disease And Detoxification

Acid-Alkaline Balance: Role In Chronic

Anticancer Effect of Alkaline Reduced Water……………….……………………………………………………………….Page 6

Effect of Electrolyzed Water on

Inhibitory Effect of Electrolyzed Reduced

Efficacy of Electrolyzed Oxidizing Water for Inactivating

Electrolyzed–Reduced Water Scavenges Active Oxygen

Preservative Effect of Electrolyzed Reduced Water on Pancreatic b -Cell

Citrate therapy for polycystic kidney

Sterilization effect of electrolyzed

Application of electrolyzed water

Various Clinical Studies and Research on

ACID-ALKALINE BALANCE: ROLE IN CHRONIC

Acid-Alkaline Balance ALTERNATIVE THERAPIES, jul/aug 2007, VOL. 13, NO. 4 62

Acid-Alkaline Balance ALTERNATIVE THERAPIES, jul/aug 2007, VOL. 13, NO. 4 63

Acid-Alkaline Balance ALTERNATIVE THERAPIES, jul/aug 2007, VOL. 13, NO. 4 64

Acid-Alkaline Balance ALTERNATIVE THERAPIES, jul/aug 2007, VOL. 13, NO. 4 65

1. Introduction 2. Materials & Methods

of ARW was evaluated. 15 days after injection, mice 150

*Naoki Yahagi, *Masashi Kono, *Masaki Kitahara,

Abstract: Electrolyzed water accelerated the healing of full-thickness cutaneous wounds

Key Words: Wound healing— Electrolyzed water—Anode water—Cathode water—

Electrolyzed water, in a variety of forms and made by a variety of different

Artif Organs, Vol. 24, No. 12, 2000

insignificant, tendency to increase healing (com- Discussion

Artif Organs, Vol. 24, No. 12, 2000

(e.g., on neutrophils, fibroblasts, and endothelial

Acknowledgement: The authors owe grateful thanks to

Artif Organs, Vol. 24, No. 12, 2000

Inhibitory Effect of Electrolyzed Reduced Water on Tumor Angiogenesis

Fig. 2. ERW Down-Regulates VEGF Transcription and Secretion

Fig. 3. VEGF Expression Is Down-Regulated via Inactivation of the ERK

Efficacy of Electrolyzed Oxidizing Water for Inactivating

Department of Animal Science, University of Connecticut, Storrs, Connecticut 06269,1

TABLE 1. Inactivation of E. coli O157:H7, S. enteritidis, and L. monocytogenes by EO water at 4 or 23°C

E. coli O157:H7 4 7.98 6 0.04 ,1.0 a

2.36 6 0.03 1,153 6 3 86.3 6 5.4

S. enteritidis 7.74 6 0.08 1.06 6 0.15 0b 0b

L. monocytogenes 7.91 6 0.05 1.34 6 0.37 0b 0b

E. coli O157:H7 23 8.04 6 0.07 ,1.0a 0b 0b

S. enteritidis 7.76 6 0.08 ,1.0a 0b 0b

L. monocytogenes 7.89 6 0.10 1.25 6 0.33 0b 0b

TABLE 2. Inactivation of E. coli O157:H7, S. enteritidis, and L. monocytogenes by EO water at 35°C

0 min 2 min 4 min 6 min pH ORP (mV) Free chlorine (ppm)

E. coli O157:H7 7.97 6 0.03 0 b

2.38 6 0.00 1,154 6 1 84.3 6 4.6

S. enteritidis 7.68 6 0.14 ,1.0a 0b 0b

L. monocytogenes 7.91 6 0.10 0b 0b 0b

TABLE 3. Inactivation of E. coli O157:H7, S. enteritidis, and L. monocytogenes by EO water at 45°C

0 min 1 min 3 min 5 min pH ORP (mV) Free chlorine (ppm)

E. coli O157:H7 7.96 6 0.03 0 b

2.39 6 0.02 1,153 6 4 85.8 6 2.7

S. enteritidis 7.70 6 0.12 1.13 6 0.33 0b 0b

L. monocytogenes 7.91 6 0.10 ,1.0a 0b 0b

The mechanism of the enhanced antioxidant effects against

Keywords: Reduced water; Antioxidant; Ionic product of water; DNA damage

1. Introduction (ORP), lower dissolved oxygen (DO) and higher

Naoki Yahagi, Masashi Kono, *Masaki Kitahara,