Medicine in Microecology 15 (2023) 100076

Contents lists available at ScienceDirect

Medicine in Microecology
journal homepage: www.journals.elsevier.com/medicine-in-microecology

Fungal composition in saliva and plaque in children with caries: Differences

and influencing factors
Meixiang Yin a, b, 1, Yang You a, 1, Xiao Zheng a, Qiuying Liang a, Buling Wu a, *, Wen'an Xu a, **
a
Department of Pediatric Dentistry, Shenzhen Stomatology Hospital (Pingshan), Southern Medical University, 143 Dongzong Road, Pingshan District, Shenzhen, 518118,
China
b
Department of Stomatology, Shenzhen Samii Medical Center, No.1 Jinniu West Road, Pingshan District, Shenzhen, 518118, China

A R T I C L E I N F O A B S T R A C T

Keywords: Caries is a dental disease that can affect oral and psychological health and has a high incidence in children. The
Mycobiome role of fungal flora in childhood caries has not been fully described. In this study, we aimed to investigate the
Dental caries fungal composition differences and the influencing factors in unstimulated saliva (S) and supragingival plaque (P)
Internal transcribed spacer
samples in childhood caries. S and P samples were collected from 63 children with caries. The ITS2 region in the
Saliva
Plaque
fungal genome was then amplified and sequenced. Subsequently, we quantified and analyzed the fungal com-
positions in the samples. Cryptococcus was the most abundant genus in the S and P subgroups. The relative
abundances of Cryptococcus and Wickerhamomyces significantly differed between the S and P subgroups (p <
0.05). Significant differences were also observed in alpha and beta diversities between the two subgroups (p <
0.05). However, no significant differences were observed between the mycobiome of the SFe and SMa subgroups
or the PFe and PMa subgroups (p > 0.05). Conversely, species differences were detected between the SDD and
SMD subgroups (p < 0.05) but not in the PDD and PPD subgroups (p > 0.05). Our findings revealed significant
differences in the mycobiome of unstimulated saliva and supragingival plaque. Dentition period and oral hygiene
behaviors may have affected these differences.

revealed the presence of fungal communities in children with and

without dental caries. Among these, Candida albicans has been widely
1. Introduction studied, and an increasing amount of evidence suggests its associated
with dental caries [11–13]. In addition, several studies have attempted to
Dental caries is a microbially mediated multifactorial disease of hard investigate the effects of gender, age, and geographic location on the
tissues [1]. The incidence of dental caries is high among childre, More- composition of oral fungi [9,14].
over, a lack of timely treatment and prevention can affect chewing Typically, unstimulated saliva and supragingival plaque are consid-
function and psychological health, thereby causing a serious burden to ered suitable for studying the oral microbiome [15–17]. Many studies
society [2]. have focused on fungal communities in saliva or plaque samples sepa-
Oral bacteria play an important role in the etiology of dental caries rately [18–20], whereas the relationship and phenotypic effects between
[3–7]. For example, researchers have detected Streptococcus mutans in salivary and supragingival mycobiomes remain poorly understood.
childhood caries and conducted comprehensive research on its patho- Recently, high-throughput sequencing technology has promoted the
genic mechanisms [8]. Previous studies on oral microorganisms have discovery of highly diverse oral microbial communities [17,21–23]. Most
mainly focused on the present bacterial groups; however, the mycobiome ITS-based fungal studies have focused on the ITS1 or ITS2 subregion.
community and its relevance in oral health and disease has been mini- Compared with the ITS1 subregion, ITS2 is more commonly used owing
mally investigated. Ghannoum et al. [9] identified the presence of fungi to its small length variation, more common primer sites, and less classi-
in the oral cavity of 20 healthy adults, and for the first time, to charac- fication bias [24].
terized the “basal fungal flora” in healthy people. Fechney et al. [10]

* Corresponding author.
** Corresponding author.
E-mail addresses: [email protected] (M. Yin), [email protected] (Y. You), [email protected] (X. Zheng), [email protected] (Q. Liang),
[email protected] (B. Wu), [email protected] (W. Xu).
1
These authors contributed equally to this work and should be considered co-first authors.

https://doi.org/10.1016/j.medmic.2023.100076
Received 20 December 2022; Received in revised form 16 January 2023; Accepted 19 January 2023
Available online 20 January 2023
2590-0978/© 2023 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
M. Yin et al. Medicine in Microecology 15 (2023) 100076

performed to collect unstimulated saliva samples, while sterile cotton

Abbreviations swabs were used to collect the supragingival plaque samples from all
tooth surfaces. A total of 63 S and 63 P samples were collected. All
internal transcribed spacer (ITS) samples were collected in 1.5 ml sterile sampling tube (Beyotime,
International Caries Detection and Assessment System FCT217), placed on dry ice after collection, and immediately frozen at
II (ICDASII)
80  C for further analysis. The samples were grouped according to
no significance (ns) sampling type, gender, and dental period. The first grouping scheme was
principal coordinate analysis (PCoA) S and P subgroups. The two groups were further categorized by gender,
Severe early childhood caries (S-ECC) as follows: male in S (SMa), male in P (PMa), female in S (SFe), and fe-
Decayed teeth (DT) male in P (PFe). In addition, the S and P subgroups were divided ac-
Decayed teeth surfaces (DS) cording to dentition period as follows: deciduous dentition in S (SDD),
unstimulated saliva (S) deciduous dentition in P (PDD), mixed dentition in S (SMD), and mixed
supragingival plaque (P) dentition in P (PMD).
Male in S (SMa)
Male in P (PMa) 2.4. DNA extraction and ITS2 rRNA amplicon sequencing and analysis
Female in S (SFe)
Female in P (PFe) Total DNA was extracted using a bacterial DNA extraction mini kit
Deciduous dentition in S (SDD) (Mabio, Guangzhou, China), and the DNA quality and concentration
Deciduous dentition in P (PDD) were detected using a Thermo NanoDrop One (Thermo Fisher Scientific,
Mixed dentition in S (SMD) MA, USA). Briefly, the bead milling step was performed, and the lysis
Mixed dentition in P (PMD) time was extended by 15 s to dissolve the thick cell wall of fungi and
improve the success rate of DNA extraction. The ITS2 region of fungi was
amplified using PCR. The forward and reverse primer sequences were
GCATCGATGAAGAACGCAGC and TCCTCCGCTTATTGATATGC, respec-
In this study, we used high-throughput sequencing technology to tively. Primers were synthesized by Invitrogen (Carlsbad, CA).
target the ITS2 region of fungi in the S and P samples from 63 children For amplicon sequencing, PCR products were mixed in an equal
with caries. We aimed to explore the relationship between the myco- density ratio according to the Gene Tools Analysis software (version
biomes of the S and P samples, as well as investigate the effects of gender, 4.03.05.0; SynGene). The pooled PCR products were purified using an E.
dentition stage, decayed teeth (DT), decayed teeth surfaces (DS), and oral Z.N.A. Gel Extraction Kit (Omega, USA). The NEBNext® Ultra™ II DNA
hygiene behaviors on the fungal composition of both samples. The Library Prep Kit for Illumina® (New England Biolabs, USA) was used for
findings of this study will serve as a foundation for future investigations library construction. The constructed amplicon library was sequenced for
on the relationship between oral fungal communities and caries in chil- PE250 using the Illumina Nova 6000 platform (Guangdong Magigene
dren, and how to select appropriate research samples. Biotechnology Co., Ltd., Guangzhou, China).

2. Material and method 2.5. Mycobiome analysis

2.1. Population study Raw data were filtered to remove primers and junction contamina-
tion, the clean reads were sorted into tags based on the overlap in the
This study was approved by the Ethics Committee of the Shenzhen reads, and sequence splicing was performed using Fast Length Adjust-
Samii Medical Center (Ethics Number: SSMC-202011-R01) in Shenzhen, ment of Short reads (FLASH, v1.2.11). The tags were clustered into OTUs
China. Sixty-three children with caries aged 2–9 years, who were patients and compared with the ITS chimera reference database UNITE (v20147
of the dental outpatient clinic of Shenzhen Samii Medical Center, were 03). Species annotation was performed based on the OTU and annotation
encouraged to participate in this study. The guardians signed the results, species complexity analysis, and species difference analysis be-
informed consent form. Individuals who had systemic diseases, used tween groups.
antibiotics within three months, suffered from periodontitis or oral
mucosal disease, received fluoridation within three months, used fixed 2.6. Statistical analysis
orthodontic devices, or could not cooperate with clinical examination
and sample collection were excluded. The general and lifestyle charac- Species compositions are presented in bar charts and crop species
teristics and oral health of children were examined using questionnaires abundance histograms for each sample at the phylum, genus, and species
answered by their guardians. The gender, dentition stage, DT, and DS levels. All species with abundance below 0.5% in all samples and no
data of each participant are listed in Supplementary Table 1. annotation were categorized as Others. R software (v3.4.1) was used.
Independent sample t-test was used to compare the mean age, DT, and
2.2. Clinical examination DS between the male and female groups, and Chi-Square was used to
evaluate sample population differences. The top 10 species based on
Two experienced dentists performed the oral examinations according relative abundance were compared using the Wilcoxon rank-sum test.
to the International Caries Detection and Assessment System II (ICDASII) Significant differences were set as p-value＜0.0001, marked with “****“,
standard [25]. Examiners were rigorously trained and regularly recali- 0.0001  p-value <0.001, marked with “***“, 0.001  p-value <0.01,
brated at the measurement point to reduce errors. Standard oral scopes, marked with “**“; 0.01  p-value <0.05, marked with “*“, and p-value＞
headlights, and community periodontal index (CPI) probes were used in 0.05, marked with no significance (ns). False discovery rate (FDR) values
the examinations. were calculated for the p-values. The results were screened for significant
differences according to p < 0.05 and FDR <0.05.
2.3. Sample collection Alpha diversity was measured using the Wilcoxon Rank-Sum Test
performed in the R software (v3.2.1). To compare the overall variability
The children were informed to stop brushing the night before sam- in the microbial community structure between the two groups, beta di-
pling and refrain from eating and drinking 2 h before sampling. Sampling versity was analyzed using principal coordinate analysis (PCoA) and a
was generally scheduled at 2:00–5:30 p.m. The spit method was box chart in QIIME (v1.80) using unweighted UniFrac distances.

2
M. Yin et al. Medicine in Microecology 15 (2023) 100076

Functional annotation was performed using the FUNGuild software. 3.2. Differential analysis between unstimulated saliva and supragingival
Redundancy analysis (RDA) was performed using the vegan package [26] plaque
in R (http://cran.r-project.org/) with the normalized OTU abundances of
fungal data. The length of the lines represented the magnitude of each 3.2.1. Fungal community composition and diversity
factor ‘s relative influence. Angles between lines <90 , indicated factors In both the S and P subgroups, 7, 8, and 10 taxa were detected at the
with the same influence, angles >90 , indicated factors with opposite phylum, genus, and species level, respectively; the remaining taxa were
influence. classified as Others (Fig. 1A).
In the S subgroup, at the phylum level, Basidiomycota (48.7%) was the
3. Results most abundant, followed by Ascomycota (28.6%). At the genus level,
Cryptococcus (47.9%) was the most abundant, followed by Wick-
3.1. Fundamental analysis erhamomyces (8.5%), Candida (7.7%), Cladosporium (3.4%), Aspergillus
(1.8%), and Hyphopichia (1.4%). At the species level, Cryptococcus_longus
A total of 63 children (36 males and 27 females; 24 with deciduous (47.9%) was the most abundant, followed by Wickerhamomyces_anomalus
dentition and 39 with mixed dentition) with a mean age of 80.27  21.06 (8.5%), Candida_albicans (1.7%), Candida_intermedia (2.2%), Candida_-
months (ranging from 2 to 9 years) were included in this study. The sake (2.2%), Saccharomyces_cerevisiae (1.5%), and Hyphopichia_burtonii
number of DT in each of the 63 children ranged from 1 to 20, with a mean (1.4%).
value  SD of 7.41  4.27, and the number of DS ranged from 1 to 48, In the P subgroups, at the phylum level, Ascomycota (30.3%) was the
with a mean value  SD of 13.51  10.82. No significant differences were most abundant, followed by Basidiomycota (26.7%). At the genus level,
observed in the number of samples of deciduous and mixed dentition Cryptococcus (25.9%) was the most abundant, followed by Candida
between the male and female groups (Table 1). (14.6%), Wickerhamomyces (4.4%), Cladosporium (4.1%), and Hypho-
pichia (2.2%). At the species level Cryptococcus_longus (26.1%) was the
most abundant, followed by Candida_albicans (9.8%), Wick-
Table 1 erhamomyces_anomalus (4.5%), Hyphopichia_burtonii (2.2%), Candida_
Demographic and clinical characteristics of the study participants. intermedia (1.5%), Candida_sake (1.4%), and Candida_dubliniensis (1.4%)
Variable Male (n ¼ 36) Female (n ¼ 27) p- (Fig. 1A).
value The Sobs, Chao, and ACE indices of the S subgroup were significantly
Age in months (mean  SD) 78.61  21.66 82.48  21.10 0.475a lower (p < 0.05) than those of the P subgroup. In contrast, the coverage
Dentition period 0.131b indices of the S subgroup were significantly higher (p < 0.05) than those
Deciduous dentition 16 7 of the P subgroup (Fig. 1B, Supplementary Table 3). This indicated that
Mixed dentition 20 20
the alpha diversity of the P subgroup was significantly higher than that of
Decayed teeth (mean  SD) 8.05  4.71 6.48  3.42 0.344a
Decayed teeth surfaces (mean  SD) 14.61  11.62 11.92  9.60 0.158a the S subgroup. PCoA plots showed that the samples were clustered by
a
plaque or saliva, indicating variability in fungal composition between
Independent-Sample T Test.
b plaque and saliva samples (p < 0.05) (Fig. 1C).
Chi-Square.

Fig. 1. Composition and diversity of the fungal community. (A) Composition of the fungal community at the phylum, genus, and species level (species abundance
below 0.5% and no annotation in all samples were combined into Others). (B) Alpha diversity analysis of the S and P subgroups. (C) Beta diversity analysis (PCoA
analysis) of the S and P subgroups.

3
M. Yin et al. Medicine in Microecology 15 (2023) 100076

3.2.2. Differential species analysis 3.4. RDA of the relationship between fungal communities and function and
The top 10 species, in terms of their relative abundances, were phenotypes
selected at the phylum, genus, and species levels to show the mean
relative abundance and variability of each group (Fig. 2A). The relative The use of fluoride toothpaste, the frequency of teeth brushing, and
abundance and p-values of the species are presented in Supplementary the frequency of sweet consumption may affect the distribution of oral
Tables 2A and B, and C. At the genus level, the first and second most fungi [27]. An increase in the number of DT and DS may also affect the
abundant taxa in the S subgroup were Cryptococcus (47.9%) and Wick- composition of the microorganisms. In this study, we collectively cate-
erhamomyces (8.5%), respectively, whereas Candida (7.7%) was third, gorized the following as phenotypes: frequency of eating sweets (Eat_-
which was only 1/6th the abundance of Cryptococcus. Meanwhile, the freq), frequency of brushing teeth (Brush_freq), frequency of fluoride
first most abundant taxa at the genus level in the P subgroup was Cryp- toothpaste use (Fluoride freq), DT, and DS. We performed RDA to explore
tococcus (26.1%), which was approximately twice as abundant as Candida the relationship between these phenotypes and the top 10 oral fungal
(14.6%). species in childhood caries. Among the five factors, Eat_freq had the
Species differences analysis suggested that Basidiomycota at the relatively lowest effect on the top 10 fungi. Eat_freq, Brush_freq, and the
phylum level; Cryptococcus, Wickerhamomyces, Aspergillus at the genus use of handiwork toothpaste (Fluoride) exhibited the same trend of
level; and Cryptococcus_longus and Wickerhamomyces_anomalus at the positive or negative effects on the flora, and the effects of DT and DS on
species level were significantly different between the S and P subgroups. fungal flora showed the same trend (Fig. 5A). These results suggest
In contrast, no significant differences were observed for Candida measures to prevent childhood caries at the microbiological level by
(Fig. 2B). improving dietary and oral hygiene.
Fungal functional annotations were performed according to the
3.3. Influence of gender and dentition period on S and P subgroups guidelines of the guild prediction system in the FUNGuild software [28]
(Fig. 5B). The annotation function was the sum of the relative abun-
At the genus level, species differences analysis indicated no signifi- dances of all samples within the subgroup.
cant differences between the mycobiome of the SFe and SMa subgroups
or the PFe and PMa subgroups (Fig. 3A, C). Alpha diversity analysis 4. Discussion
showed that the Shannon and Simpson indices in the SFe and SMa sub-
groups, as well as in the PFe and PMa subgroups were not significantly The role of fungi in the microbial composition of dental caries has
different (p > 0.05) (Fig. 3B, D). Furthermore, Chao1, Ace, Coverage, and recently become a popular topic, and high-throughput sequencing is now
Sobs indices were not significantly different (p > 0.05) (Supplementary commonly used for fungal detection [24]. This study was conducted to
Table 3). Beta diversity unweighted-unifrac index was also not significant investigate the differences in fungal communities between unstimulated
(p > 0.05) (Fig. 3B, D). These results indicate that there was no signifi- saliva and supragingival plaque in childhood caries, and to determine the
cant difference between alpha and beta diversity. Overall, gender exerted effect of gender, dental stage, DT, DS, and oral hygiene behaviors on the
no effect on the fungal composition of unstimulated saliva and plaque. fungal composition of the two groups.
Species differences were detected between the SDD and SMD sub- In this study, Cryptococcus was the most abundant genus in both the S
groups for Ascomycota and Basidiomycota (Fig. 4A), The Shannon and and P subgroups, which differs from previous studies that reported
Simpson indices, as well as the beta diversity unweighted-unifrac index, Candida to be the most dominant fungal genus detected [9,19,29]. In the
in the SDD and SMD subgroups were significantly different (p < 0.05) S subgroup, the second and third most abundant genera were Wick-
(Fig. 4B). In contrast, no significant differences were observed between erhamomyces and Candida, respectively, whereas the two microbes were
the PDD and PMD subgroups (Fig. 4C and D). reversely ranked in the P samples. Cryptococcus and Wickerhamomyces are
less frequently mentioned in caries-related literature. Only a few studies

Fig. 2. Differential species analysis. (A) Key species differences analysis of the top 10 fungal species at the phylum, genus, and species level in the S and P subgroups.
(B) Species differences analysis at the phylum, genus, and species level in the S and P subgroups.

4
M. Yin et al. Medicine in Microecology 15 (2023) 100076

Fig. 3. Influence of gender on the S and P subgroups. (A) Species differences analyses of the SFe and SMa subgroups at the phylum, genus, and species level. (B) Alpha
and beta diversity of the SFe and SMa subgroups. (C) Species differences analyses of the PFe and PMa subgroups at the phylum, genus, and species level. (D) Alpha and
beta diversity of the PFe and PMa subgroups.

have reported the presence of Cryptococcus in the oral cavity [9,19,22]. A imbalance. A mildly acidic environment is favorable for the growth
thick cell wall is a typical feature of the genera Cryptococcus and Wick- and reproduction of microorganisms [16]. Second, thiamine salts, io-
erhamomyces [30]. The bead milling step was performed in this study, dides, and nitrates in saliva exert antibacterial effects and limit the
and the lysis time was extended by 15 s to dissociate the thick cell wall of growth of microorganisms [32]. This suggests that the plaque is an
the fungi and improve the success rate of DNA extraction. This may optimal environment for supporting the diversity of microorganisms. Our
explain the high abundance of Cryptococcus and Wickerhamomyces study suggests different fungal compositions and diversities between the
detected in this study. S and P subgroups, which is consistent with the results of many previous
Research on Wickerhamomyces is still in its infancy, and it has studies [33–35]. Similarly, the beta diversity indices showed significant
currently only been identified as a human opportunistic pathogen [31]. differences in fungal composition between the two subgroups.
Whether they constitute the core fungal flora in children with dental Gender, age, and other factors may affect the oral fungal population
caries requires further research. of childhood caries. Jesus et al. [36] suggested that gender might be a
Combining the results of key species differences analysis and species critical determinant of severe early childhood caries (S-ECC). In contrast,
differences analysis, the abundance of Cryptococcus and Wick- our study did not observe any effect of gender on the fungal microbiome
erhamomyces were significantly higher in the S subgroup than in the P in the S and P subgroups. These inconsistent findings may be due to the
subgroup. No relevant studies explain this phenomenon, but we specu- following variables: (1) sample geographical location, wherein the
late that salivary microhabitats may be more suitable for the growth of former findings were collected in Canada, whereas the present study was
these two genera; however, this topic warrants further investigation. conducted in China; (2) the age range, wherein the former study popu-
In the alpha diversity analysis, the P subgroup were more abundance lation was younger than 72 months of age, while that in the present study
and had higher homogeneity than the S subgroup. This may be due to two was between 2 and 9 years of age; (3) the former study investigated the
factors. First, unstimulated saliva has a neutral PH environment [32], influence of gender on the supragingival plaque fungal community in
whereas supragingival plaque in dental caries is usually mildly acidic caries-free and S-ECC children, and the present study focused on whether
owing to acid production by microorganisms, resulting in an acid-base gender had any effect on the respective microbial composition of saliva

5
M. Yin et al. Medicine in Microecology 15 (2023) 100076

Fig. 4. Influence of dentition period on the S and P subgroups. (A) Species differences analyses of the SDD and SMD subgroups at the phylum, genus, and species level.
(B) Alpha and beta diversity of the SDD and SMD subgroups. (C) Species differences analyses of the PDD and PMD subgroups at the phylum, genus, and species level.
(D) Alpha and beta diversity of the PDD and PMD subgroups.

Fig. 5. Redundancy analysis (RDA) of the relationship between fungal and phenotypes and fungal functional annotation. (A) Redundancy analysis (RDA) of the top 10
fungal flora and phenotypes. (B) Functional annotation of the S and P subgroups. (Function on the annotation is the sum of the relative abundance of all samples in
the group.)

6
M. Yin et al. Medicine in Microecology 15 (2023) 100076

and plaque in children with caries. These findings suggest that we are far Acknowledgments
from fully understanding the influence of gender on dental fungal com-
munities and further research is needed. This work was supported by grants from the President Foundation of
Mycobiome differences were detected between the SDD and SMD Shenzhen Stomatology Hospital (Pingshan) of Southern Medical Uni-
subgroups but not between the PDD and PPD groups, suggesting denti- versity (grant no. 2021A001) and Oral Infectious Disease Mechanism
tion is not an influential factor of supragingival plaque fungi. However, it Research and Clinical Translation Application Innovation team of
does affect the fungal distribution in saliva. Guangdong Province of China (grant no. 2021KCXTD033). We would
This may be attributed to the low biomass of fungi in the oral cavity like to thank Editage (www.editage.cn) for the English language editing.
and the fact that the fungal content in supragingival plaque may be lower
than that in saliva; thus, no differences were detected in the plaque [19, Appendix A. Supplementary data
37]. The composition of supragingival plaque may be relatively stable
once it is formed; therefore, it is not significantly affected by different Supplementary data to this article can be found online at https
dental periods. ://doi.org/10.1016/j.medmic.2023.100076.
The FUNGuild software currently lacks data on the fungal genome, so
we can only perform functional annotations but not pathway prediction. References
This suggests that most of the current studies have been based on
investigating ITS genes and have not investigated pathway analyses. [1] Pitts NB, Zero DT, Marsh PD, Ekstrand K, Weintraub JA, Ramos-Gomez F, Tagami J,
Twetman S, Tsakos G, Ismail A. Dental caries. Nat Rev Dis Prim 2017;3:17030.
Despite the progress in understanding the microbial composition of https://doi.org/10.1038/nrdp.2017.30.
oral fungi and their biological functions, several challenges remain and [2] Tinanoff N, Baez RJ, Diaz Guillory C, Donly KJ, Feldens CA, McGrath C,
require urgent resolution. In our study, a significant proportion of fungi Phantumvanit P, Pitts NB, Seow WK, Sharkov N, Songpaisan Y, Twetman S. Early
childhood caries epidemiology, aetiology, risk assessment, societal burden,
were classified as Others in the S and P subgroups as their taxonomic management, education, and policy: global perspective. Int J Paediatr Dent 2019;
levels were not annotated or their abundance was <0.5% in the samples. 29:238–48. https://doi.org/10.1111/ipd.12484.
We noted at least three problems. First, experimental biases introduced in [3] Seow WK. Early childhood caries. Pediatr Clin 2018;65:941–54. https://doi.org/
10.1016/j.pcl.2018.05.004.
key procedures may affect the experimental results [38], which may [4] Abranches J, Zeng L, Kajfasz JK, Palmer SR, Chakraborty B, Wen ZT, Richards VP,
suggest that appropriate experimental protocols should be developed for Brady LJ, Lemos JA. Biology of oral streptococci. Microbiol Spectr 2018;6. https://
different samples. Second, the NGS platform used in this experiment, doi.org/10.1128/microbiolspec.GPP3-0042-2018.
[5] Lamont RJ, Koo H, Hajishengallis G. The oral microbiota: dynamic communities
which only sequences ITS regions, has proven to be technically limited
and host interactions. Nat Rev Microbiol 2018;16:745–59. https://doi.org/
[24]. The current third-generation sequencing technologies, SGS PacBio 10.1038/s41579-018-0089-x.
RSII and Sequel, can sequence the complete ITS region and identify mi- [6] Krzy
sciak W, Jurczak A, Ko
scielniak D, Bystrowska B, Skalniak A. The virulence of
crobial communities more accurately than NGS [39,40]. Finally, Streptococcus mutans and the ability to form biofilms. Eur J Clin Microbiol Infect
Dis 2014;33:499–515. https://doi.org/10.1007/s10096-013-1993-7.
although UNITE is currently the most commonly used taxonomic data- [7] Xiao J, Alkhers N, Kopycka-Kedzierawski DT, Billings RJ, Wu TT, Castillo DA,
base for studying fungal biomes in different environments, there is a Rasubala L, Malmstrom H, Ren Y, Eliav E. Prenatal oral health care and early
growing concern about the inadequate taxonomic coverage of existing childhood caries prevention: a systematic review and meta-analysis. Caries Res
2019;53:411–21. https://doi.org/10.1159/000495187.
databases, with many species being detected and unable to be classified [8] Lin Y, Chen J, Zhou X, Li Y. Inhibition of Streptococcus mutans biofilm formation by
to a meaningful taxonomic level outside the kingdom level. This limits strategies targeting the metabolism of exopolysaccharides. Crit Rev Microbiol 2021;
studies attempting to describe the human fungal biome [24]. 47:667–77. https://doi.org/10.1080/1040841X.2021.1915959.
[9] Ghannoum MA, Jurevic RJ, Mukherjee PK, Cui F, Sikaroodi M, Naqvi A,
Our findings revealed significant differences in the fungal composi- Gillevet PM. Characterization of the oral fungal microbiome (mycobiome) in
tion between unstimulated saliva and supragingival plaque. Dentition healthy individuals. PLoS Pathog 2010;6:e1000713. https://doi.org/10.1371/
period and oral hygiene behaviors may have affected these differences. journal.ppat.1000713.
[10] Fechney JM, Browne GV, Prabhu N, Irinyi L, Meyer W, Hughes T, Bockmann M,
However, as this was a cross-sectional study, to ensure reliability, the Townsend G, Salehi H, Adler CJ. Preliminary study of the oral mycobiome of
results need to be supported by longitudinal studies, and the bacterial children with and without dental caries. J Oral Microbiol 2019;11:1536182.
and viral communities should also be studied to obtain a more compre- https://doi.org/10.1080/20002297.2018.1536182.
[11] Xiao J, Moon Y, Li L, Rustchenko E, Wakabayashi H, Zhao X, Feng C, Gill SR,
hensive understanding of the microbial composition of the S and P
McLaren S, Malmstrom H, Ren Y, Quivey R, Koo H, Kopycka-Kedzierawski DT.
samples of childhood caries. Candida albicans carriage in children with severe early childhood caries (S-ecc) and
To the best of our knowledge, this is the first study to comprehen- maternal relatedness. PLoS One 2016;11:e0164242. https://doi.org/10.1371/
sively describe the differences and influencing factors in the fungal journal.pone.0164242.
[12] Du Q, Ren B, He J, Peng X, Guo Q, Zheng L, Li J, Dai H, Chen V, Zhang L, Zhou X,
composition in unstimulated saliva and supragingival plaque of child- Xu X. Candida albicans promotes tooth decay by inducing oral microbial dysbiosis.
hood caries. It provides a reference for further studies of fungal micro- ISME J 2021;15:894–908. https://doi.org/10.1038/s41396-020-00823-8.
biota of childhood caries to aid the selection of an appropriate sample [13] Willems HM, Kos K, Jabra-Rizk MA, Krom BP. Candida albicans in oral biofilms
could prevent caries. Pathog Dis 2016;74:ftw039. https://doi.org/10.1093/
source. In addition, it also serves as a foundation for future research of femspd/ftw039.
the correlation between oral fungi and childhood caries. [14] Cheung MK, Chan JYK, Wong MCS, Wong PY, Lei P, Cai L, Lan L, Ho WCS,
Yeung ACM, Chan PKS, Chen Z. Determinants and interactions of oral bacterial and
fungal microbiota in healthy Chinese adults. Microbiol Spectr 2022;10:e0241021.
Author contribution https://doi.org/10.1128/spectrum.02410-21.
[15] Belstrøm D. The salivary microbiota in health and disease. J Oral Microbiol 2020;
Mx.Y: Conceptualization, Methodology, Formal analysis, Investiga- 12:1723975. https://doi.org/10.1080/20002297.2020.1723975.
[16] Marsh PD. Microbial ecology of dental plaque and its significance in health and
tion, Project administ ration, Writing – original draft; Y.Y: Methodology, disease. Adv Dent Res 1994;8:263–71. https://doi.org/10.1177/
Software, Investigation. X.Z: Fo rmal analysis, Investigation, Review and 08959374940080022001.
Editing. Qy.L: Investigation, Software, Review and Editing. Wa.X: [17] Havsed K, Stensson M, Jansson H, Carda-Di
eguez M, Pedersen A, Neilands J,
Svens€ater G, Mira A. Bacterial composition and metabolomics of dental plaque from
Conceptualization, Resources, Review and editing, Funding acquisit ion.
adolescents. Front Cell Infect Microbiol 2021;11:716493. https://doi.org/10.3389/
Bl.W: Review and Editing, Visualization, Funding acquisition. fcimb.2021.716493.
[18] Dupuy AK, David MS, Li L, Heider TN, Peterson JD, Montano EA, Dongari-
Bagtzoglou A, Diaz PI, Strausbaugh LD. Redefining the human oral mycobiome with
Conflict of Interest
improved practices in amplicon-based taxonomy: discovery of malassezia as a
prominent commensal. PLoS One 2014;9:e90899. https://doi.org/10.1371/
The authors declare that they have no known competing financial journal.pone.0090899.
interests or personal relationships that could have appeared to influence [19] D. Baraniya, T. Chen, A. Nahar, F. Alakwaa, J. Hill, M. Tellez, A. Ismail, S. Puri, N.N.
Al-Hebshi, Supragingival mycobiome and inter-kingdom interactions in dental
the work reported in this paper.

7
M. Yin et al. Medicine in Microecology 15 (2023) 100076

caries, J Oral Microbiol. 12 (n.d.) 1729305. https://doi.org/10.1080/200022 [30] Iyer KR, Revie NM, Fu C, Robbins N, Cowen LE. Treatment strategies for
97.2020.1729305. cryptococcal infection: challenges, advances and future outlook. Nat Rev Microbiol
[20] Hong BY, Hoare A, Cardenas A, Dupuy AK, Choquette L, Salner AL, Schauer PK, 2021;19:454–66. https://doi.org/10.1038/s41579-021-00511-0.
Hegde U, Peterson DE, Dongari-Bagtzoglou A, Strausbaugh LD, Diaz PI. The salivary [31] Nundaeng S, Suwannarach N, Limtong S, Khuna S, Kumla J, Lumyong S. An
mycobiome contains 2 ecologically distinct mycotypes. J Dent Res 2020;99:730–8. updated global species diversity and phylogeny in the genus Wickerhamomyces
https://doi.org/10.1177/0022034520915879. with addition of two new species from Thailand. J Fungi (Basel) 2021;7:957.
[21] Sim
on-Soro A, Mira A. Solving the etiology of dental caries. Trends Microbiol 2015; https://doi.org/10.3390/jof7110957.
23:76–82. https://doi.org/10.1016/j.tim.2014.10.010. [32] Proctor GB. The physiology of salivary secretion. Periodontol 2016;70:11–25.
[22] Ieda S, Moriyama M, Takeshita T, Takashita T, Maehara T, Imabayashi Y, https://doi.org/10.1111/prd.12116. 2000.
Shinozaki S, Tanaka A, Hayashida J-N, Furukawa S, Ohta M, Yamashita Y, [33] Sim
on-Soro A, Tom
as I, Cabrera-Rubio R, Catalan MD, Nyvad B, Mira A. Microbial
Nakamura S. Molecular analysis of fungal populations in patients with oral geography of the oral cavity. J Dent Res 2013;92:616–21. https://doi.org/10.1177/
candidiasis using internal transcribed spacer region. PLoS One 2014;9:e101156. 0022034513488119.
https://doi.org/10.1371/journal.pone.0101156. [34] Lee E, Park S, Um S, Kim S, Lee J, Jang J, Jeong H, Shin J, Kang J, Lee S, Jeong T.
[23] Hall MW, Singh N, Ng KF, Lam DK, Goldberg MB, Tenenbaum HC, Neufeld JD, Microbiome of saliva and plaque in children according to age and dental caries
Beiko RG, Senadheera DB. Inter-personal diversity and temporal dynamics of experience. Diagnostics 2021;11:1324. https://doi.org/10.3390/
dental, tongue, and salivary microbiota in the healthy oral cavity. NPJ Biofilms diagnostics11081324.
Microbiomes 2017;3:2. https://doi.org/10.1038/s41522-016-0011-0. [35] Shi W, Tian J, Xu H, Zhou Q, Qin M. Distinctions and associations between the
[24] Nilsson RH, Anslan S, Bahram M, Wurzbacher C, Baldrian P, Tedersoo L. microbiota of saliva and supragingival plaque of permanent and deciduous teeth.
Mycobiome diversity: high-throughput sequencing and identification of fungi. Nat PLoS One 2018;13:e0200337. https://doi.org/10.1371/journal.pone.0200337.
Rev Microbiol 2019;17:95–109. https://doi.org/10.1038/s41579-018-0116-y. [36] de Jesus VC, Shikder R, Oryniak D, Mann K, Alamri A, Mittermuller B, Duan K,
[25] Ismail AI, Sohn W, Tellez M, Amaya A, Sen A, Hasson H, Pitts NB. The International Hu P, Schroth RJ, Chelikani P. Sex-based diverse plaque microbiota in children with
Caries Detection and Assessment System (ICDAS): an integrated system for severe caries. J Dent Res 2020;99:703–12. https://doi.org/10.1177/
measuring dental caries. Community Dent Oral Epidemiol 2007;35:170–8. https:// 0022034520908595.
doi.org/10.1111/j.1600-0528.2007.00347.x. [37] Kraneveld EA, Buijs MJ, Bonder MJ, Visser M, Keijser BJF, Crielaard W, Zaura E.
[26] Oksanen J., Blanchet F.G., Kindt R., Legendre P., O’Hara R.2010. Vegan: The relation between oral Candida load and bacterial microbiome profiles in Dutch
community ecology package. R package version 1.17-3. [online] URL: http older adults. PLoS One 2012;7:e42770. https://doi.org/10.1371/
://CRAN.R-project.org/package¼vegan. journal.pone.0042770.
[27] Hu Y, Amir A, Huang X, Li Y, Huang S, Wolfe E, Weiss S, Knight R, Xu ZZ. Diurnal [38] Vesty A, Biswas K, Taylor MW, Gear K, Douglas RG. Evaluating the impact of DNA
and eating-associated microbial patterns revealed via high-frequency saliva extraction method on the representation of human oral bacterial and fungal
sampling. Genome Res 2022;32:1112–23. https://doi.org/10.1101/gr.276482.121. communities. PLoS One 2017;12:e0169877. https://doi.org/10.1371/
[28] Nguyen NH, Song Z, Bates ST, Branco S, Tedersoo L, Menke J, Schilling JS, journal.pone.0169877.
Kennedy PG. FUNGuild: an open annotation tool for parsing fungal community [39] Singer E, Bushnell B, Coleman-Derr D, Bowman B, Bowers RM, Levy A, Gies EA,
datasets by ecological guild. Fungal Ecology 2016;20:241–8. https://doi.org/ Cheng J-F, Copeland A, Klenk H-P, Hallam SJ, Hugenholtz P, Tringe SG, Woyke T.
10.1016/j.funeco.2015.06.006. High-resolution phylogenetic microbial community profiling. ISME J 2016;10:
[29] Mn Z, F. M, T. T, S. Y, S. R, E. N, N. T, Y. Y. Oral mycobiome in community-dwelling 2020–32. https://doi.org/10.1038/ismej.2015.249.
elderly and its relation to oral and general health conditions. Oral Dis 2017;23. [40] Yang X, He L, Yan S, Chen X, Que G. The impact of caries status on supragingival
https://doi.org/10.1111/odi.12682. plaque and salivary microbiome in children with mixed dentition: a cross-sectional
survey. BMC Oral Health 2021;21:319. https://doi.org/10.1186/s12903-021-
01683-0.