Research Article

Candidemia: A Hospital Based Study in Haematological Patients in

Adult Population of Northern India
Shivangi Tripathi1,2, Gopa banerjee1*, Anil Kumar Tripathi3, Shailendra Prasad Verma3, Anunaya Manoj4
1Department
of Microbiology, King George’s Medical University, Lucknow, Uttar Pradesh , India
2Department
of Biosciences, Integral University, Lucknow, Uttar Pradesh, India
3Department of Clinical Hematology, King George's Medical University, Lucknow, Uttar Pradesh, India

4Department of Statistics, University of Lucknow, Uttar Pradesh , India

*Correspondence author: Gopa Banerjee, Department of Microbiology, King George’s Medical University, Lucknow, Uttar Pradesh, India;
Email: [email protected]

Abstract
Citation: Banerjee G, et al. Background: Candidemia has become a common cause of fungal infection in bloodstream
Candidemia: A Hospital Based Study
infection throughout the world. In hematological malignancies, patients have high rate of
in Haematological Patients in Adult
morbidity and mortality due to Candidemia. Objective: Early diagnosis and specific
Population of Northern India. J Clin
Immunol Microbiol. 2023;4(1):1-10. identification of Candida species in hematological patients is main purpose of the proposed
http://dx.doi.org/10.46889/JCIM.2023.
study.
4102 Methods: In present study we enrolled patients with hematological malignancies (duration
November 2018- April 2022). For early diagnosis of Candidemia we did conventional method,
Received Date: 09-03-2023
antigen detection and PCR. We compared the conventional, automated, antigen detection test
and PCR method for diagnosis of Candidemia and then we performed antifungal susceptibility
Accepted Date: 27-03-2023
testing for treatment in hematological patients.
Published Date: 03-04-2023
Results: Total 229 patients were enrolled on the basis of febrile neutropenia. Total 152/229 male
(66.37%) and 77/229 (33.62%) were participated in present study followed by age range from
10- 77 years (Mean=33.65, Standard deviation=16.40). Prevalence of the Candidemia was 2.1 in
Copyright: © 2023 by the authors.
the present study. Five patients (2.6%) were positive from blood culture and nine patients
Submitted for possible open access (4.8%) were positive by PCR. Among 4 patients of AML, there were 3 Candida troicalis (3;
publication under the terms and 1.60%) and 1 Candida auris (1; 0.5%) were present followed by 1 patient of pancytopenia
conditions of the Creative Commons Candida tropicalis (1; 0.5%) present.
Attribution (CCBY) license Conclusion: This present observational study recognizes main association of Candidemia in
(https://creativecommons.org/li hematological malignancies. Automated methods are more sensitive and specific for species
censes/by/4.0/).
identification. We try to apply Non culture method like PCR and mannan antigen in routine
laboratories to diagnose early stage Candidemia infection for better treatment to cure the
disease.

Keywords: Candidemia; Diagnosis; Hematological Patients; Polymerase Chain Reaction; Treatment

Abbreviations
PCR: Polymerase Chain Reaction; Mn: Mannan antigen; A-Mn: Anti-Mannan antibodies; ECIL: European Conference on
Infections in Leukemia; DMSO: Dimethyl Sulfoxide; MALDI-TOF: Matrix-Assisted Laser Desorption/Ionization; CLSI: Clinical
Laboratory Standards Institute

Introduction
Candida is well-known, potentially pathogenic yeast and it is a frequent cause of nosocomial bloodstream infection in humans.
It may lead to fungal infection, that have been associated with the prevalent cause of hospital infection [1-2]. In several nations,
Candidemia (or bloodstream infection with Candida spp.) is among the top five illnesses acquired from the hospitals [3-7]. Due
http://dx.doi.org/10.46889/JCIM.2023.4102 https://athenaeumpub.com/journal-of-clinical-immunology-microbiology/
 2

to their relationship with high mortality rate and enormous medical expenses for governments and patients with fungus infection
are gaining attention in the medical field. Increasing incidences of invasive systemic infections and septicemia, especially in
immunocompromised patients, are accountable for the rise in fatality rates [8-10]. The geographical and temporal diversity of
India influences the prevalence of different Candida species [11]. Among many candida species, C. albicans, C. glabrata, C.
tropicalis, C. parapsilosis and C. krusei are all capable of infecting healthy hosts. When a person's immune system is compromised,
these microorganisms can cause severe systemic diseases. Due to the increasing number of immunocompromised patients, the
quick development of new illness medicines has heightened the risk of spreading Candidiasis. C. albicans is the most common
cause of Candidemia, despite the fact that other Candida species are responsible for over 50% of bloodstream infection in certain
region of the world [12]. This is because these people are more likely to have undergone surgery, spent time in critical care units,
or been treated with broad-spectrum antibiotics [8,11,13,14]. In Japan (2009) and India (2013), multidrug-resistant C. auris was
first discovered [15]. In clinical research laboratory to get an accurate diagnosis and effective treatment for Non-Albican Candida
(NAC) species using standard method is a significant barrier [16]. There has been evidence of resistance to a number of drugs,
including azoles, echinocandins, and amphotericin B. The Indian Council of Medical Research (ICMR) in 2017 emphasized the
necessity of active surveillance of C. auris infection in Indian institutions [17]. C. tropicalis has emerged as a prominent agent of
nosocomial infection. C. auris causes candidemia 40% more often than C. albican [18]. With C. tropicalis dominant, a diverse array
of pathogenic agents was discovered, showing the growing pathogenic potential of NAC species. The majority of cases in India
are attributable to C. tropicalis, but outbreaks caused by previously unidentified pathogens such as Kodamaeaohmeri and Pichia
anomala have also been documented [19,20]. Echinocandins are now strongly advised for use as first-line drugs for the treatment
of Candidemia regardless of primary predisposing factors [21].

Non-cultured diagnostic methods are considerably used for the identification of invasive Candidiasis which is used for routine
laboratories. In previous studies, serological test, β-D glucan, Mannan antigen (Mn), Anti-Mannan antibodies (A-Mn), enolase,
and arabinitol were used for the diagnosis of Invasive Candidiasis. Cell walls of C. albican have Mn consisting of 7% of the cell
dry weight and circulating Candida antigen during infection [22]. The 28S rDNA region of the large ribosomal subunit
(LSUD1/D2) was the target of the oligonucleotide primers NL-1 and NL-4 [24]. In this region, fungal species are exceptionally
well protected. Primers P4501 and P4502 recognize the target Candida species' P-450 lanosterol 14-demethylase gene, according
to previous research [25]. Healthcare facilities are rampant with the fungus C. albicans, which regularly colonizes human skin,
the oral cavity, and the vagina. A patient's immune system is weakened and made more vulnerable to infection by factors like
prolonged hospital stays excessive use of broad-spectrum antibiotics and chemotherapy for cancer patients, diabetes, and
surgery. Patients who have central venous catheters and neutropenia are more likely to develop blood fungus infection [26]. The
European Conference on Infections in Leukemia (ECIL) gives guidelines regarding diagnostic procedures and treatment therapy
strategies in hematological patients [21]. The prevalence of Candidemia has increased along with the development of
immunosuppressive medications and surgical techniques. Due to the absence of standardization of molecular techniques in
routine laboratories, Candidemia still has a significant mortality rate (35-60%) despite medical breakthroughs. We are seeking to
address the issue of diagnosing Candidemia from blood in cancer patients by contrasting the conventional method and the
molecular way. The PCR approach of directly identifying Candida species from blood which take less time to diagnose can help
to reach this goal. The mortality rate of patients with Candidemia can be reduced with early detection and treatment with a
specific antifungal medicine. Finding out how prevalent Candidemia is among patients who have been admitted to the Clinical
Hematology department is the aim of this study.

Methods
This prospective observational study was carried out in the department of Microbiology, King George’s Medical University,
Lucknow (UP), India. A total of 187 hematological malignancy patients were recruited and the blood samples were collected.
This study was carried out from November 2018 to October 2021. This study was approved in 2018 by the Institutional Ethics
Committee of King George’s Medical University, Lucknow, Uttar Pradesh, INDIA (letter no. 223/Ethics/R. Cell-18).

a. Inclusion criteria
1. ≥ 15 years
2. Suffering from high-grade fever or with febrile neutropenia (<500 neutrophils/mm2) (3) not responding to broad-spectrum
antibiotics for 5 days

http://dx.doi.org/10.46889/JCIM.2023.4102 https://athenaeumpub.com/journal-of-clinical-immunology-microbiology/
 3

b. Exclusion criteria
1. Patients received chemotherapy
2. Already used an antifungal prophylaxis course

Blood Sample Collection

Whole blood sample were withdrawn from patients with their informed consent and collected 2 ml in EDTA vial form DNA
extraction and 8-10 ml of blood sample BACTECTM Mycosis IC/F blood culture bottles for convention method (Becton,
Dickinson, and Company Sparks, MD 21152 USA and Benex Limited Dun Laoghaire, Ireland).

Culture bottles were incubated in BD BACTEC 9120 machine (Becton Dickinson) for 15 days unless the machine shows a positive
or negative signal. Positive blood Samples were cultured on Mackonky (Himedia) and coulambia agar (5% sheep blood agar)
[BIOMERIUX] plates. Plates were incubated overnight at 37 ◦C. All isolates were identified by using microscopy, Germ Tube Test
CHROMagar (Himedia, Mumbai, India), Corn meal agar (Hyphae formation) and Sugar assimilation. Blood culture was
considered as negative for Candida after 15 days of incubation. Species Identification of Candida was also confirmed by Matrix-
Assisted Laser Desorption/Ionization (MALDI-TOF) Mass Spectrometry (MS) Biotype CA System (Bruker DaltonicK GmbH,
Germany). All Candida isolates were stored at -80◦C in 50% glycerol till further use.

Antifungal Drugs and Stock Solution

The testing of antifungal susceptibility was performed for voriconazole (Sigma Aldrich, St. Louis), Amphoterecin B (Sigma
Aldrich), Fluconazole (Sigma Aldrich), Caspofungin (Sigma Aldrich) powder. A stock solution of 1600 μg/ml was prepared in
Dimethyl Sulfoxide (DMSO) for all drugs and stored at -80◦C till further use. The sensitivity was done according to the Clinical
Laboratory Standards Institute (CLSI) guideline M27-A3 reference document for broth microdilution [23]. Antifungal
susceptibility was also done with Vitek® MS (bioMerieux Inc.).

Serological Test: Sample was collected in is a sterile plain vial. Mn Ag was measured for each sample using PlateliaTM Candida
Ag Plus immunoenzymatic assay kit (Bio Rad, Platelia, Marnes, La Coquette, France). Experiment was performed according to
the manufacturer’s instructions. Results were calculated as sample with concentrations that are equal or greater than 125 pg/ml
considered as positive, less than 62.5 pg/ml considered as Negative and Sample with concentrations between 62.5 and 125 pg/ml
Intermediate.

Molecular Methods for Diagnosis of Candidemia

DNA extraction: 2 ml blood sample were withdrawn from patient immediately prior to the antifungal administration. DNA
extraction was performed from Whole blood collected in EDTA vials (2 ml). DNA extraction was done according to manufacturer
guidelines of the Qiagen DNA extraction kit. The above steps were performed in Laminar Air Flow (Science TECH, INDIA)
Extracted DNA was stored at -20◦C (VESTFROST SOLUTIONS) for amplification. DNA concentration was checked at 260-280
nm in Bio Spectrometer (Eppendorf, Germany).

Polymerase Chain Reaction (PCR)

1st Reaction-The primer forward-NL-1(5’ GCATATCAATAAGCGGAGGAAAAG 3’ and reverse - NL-4 (5’
GGTCCGTGTTTCAAGACGG 3’ (Eurofins Genomics India Pvt. Ltd.) were used, included D1/D2 region of 28S rDNA of large
ribosomal subunit [21]. PCR was performed on Bio Rad C1000 touch thermal cycler in a total volume of 25µl by using a 2 x PCR
master mix (Thermo Scientific, Wilmington, DE). PCR conditions with an initial denaturation at 95 ◦C for 5 min, denaturation at
94◦C for 1 min; annealing at 55◦C for 30 sec and extension at 72◦C for 2 min followed by 34 cycles and final extension 72 ◦C for 5
min. PCR product was electrophoreses in an agarose gel (1.5%) for 1 h at 70 V at room temperature in TBE (Tris Borate EDTA)
buffer, the gel was stained with Ethidium bromide and the bands were visualized in the gel documentation system (Bio-Rad).
PCR product size was compared directly with a 100-basepairs molecular size marker (Next Gen, Genetix, India).

2nd Reaction- Positive samples from reaction 1st were further processed further. The primer forward-
P45015’ATGACTGATCAAGAAATYGCTAA3’ and reverse-P4502 5’TAACCTGGAGAAACYAAAAC 3’ (Eurofins Genomics

http://dx.doi.org/10.46889/JCIM.2023.4102 https://athenaeumpub.com/journal-of-clinical-immunology-microbiology/
 4

India Pvt. Ltd.) were used in the current study including genus Candida specific for P-450 lanosterol 14α-demethylase gene [25].
PCR was performed in a total 25μl volume of reaction by 2 X Master Mix (Thermo Scientific, Wilmington, DE) and PCR
conditions were performed on Bio-Rad C1000 touch thermal cycler with an initial denaturation at 94 ◦C for 3 min, denaturation
at 94◦C for 40 sec; annealing at 59◦C for 1 min, extension at 72◦C for 1 min for 34 cycles final extension at 72 ◦C for 1 min 30 sec.
Both reactions were performed ESCO PCR Cabinet (ISOCIDETM, Singapore). PCR product was electrophoreses in an agarose
gel (1.5%) for 1 h at 70 V at room temperature in TBE (Tris Borate EDTA) buffer, the gel was stained with Ethidium bromide and
the bands were visualized in the gel documentation system (Bio-Rad). PCR product size was compared directly with a 100-
basepair molecular size marker (Next Gen, Genetix, India).

Statistical Analysis
The Chi-square test of independence was used for data analysis to compare and test the association between data. All the data
were analyzed at a significant value of less than 0.05 (two-tailed). The IBM SPSS Statistics software version 21 was used for all of
the analyses (IBM Corp. Armonk, N.Y., USA).

Results
A total of 229 patients suspected of Candidemia with different hematological malignancies were enrolled in this study. Out of
229 patients, 152 were male and 77 were female ranging from 10 years to 77 years. The mean (±SD) age of the study group was
33.65 (±16.40) and the mean neutrophil count was 4.85 (4.19). All patients had received broad-range antibiotics for more than 72
hrs but did not respond to antibiotics.

We found 5 positive candida patients during this study from November 2018 to April 2022. Most common disease was AML 121
(52.8%), ALL 57 (24.8%) followed by aplastic anemia 19 (8.2%), Non-Hodgkin’s Lymphoma 10 (4.3%), Multiple Myeloma 6 (2.6%)
and pancytopenia 7 (3.0%) and 7 (3.0%) other hematological malignancies. The patient’s shows symptoms like cough, chest pain,
Pleural rub, weakness, Body ache, breathlessness, dyspnea, vomiting, and hemoptysis with hematological malignancies [Fig. 1-
3].

5 (2.1%) patients’ sample was positive for blood culture (Table 1). Candida was positive in 11 (4.8%) patients detected by
polymerase chain reaction including 5 patients with positive blood culture. 13 (5.6%) serum samples were showing positive
results for Mn Ag value. In those 5 patients, Candidemia was confirmed by blood culture and non-culture method. The
Demographical data, clinical assessment and outcome interpreted of total 13 patients are shown in Table 2 and 3.

Budding yeast was seen under microscopy. For species identification dalamau technique, CCA, and sugar assimilation was
performed. C. tropicalis (4; 2.1%) was the most common species followed by C. auris (1; 0.5%) in the blood of Cancer patients. C.
tropicalis was identified in 24-48 by producing color on Candida Chrome agar. Sugar assimilation and CMA was done to identify
other non-albican candida species like C. auris were took 48-72 hrs. A conventional phenotypic method was also confirmed by
the Maldi-TOF.

Antifungal susceptibility was performed through the broth microdilution method for C. tropicalis and C. auris [1,4]. Four isolates
of Candida tropicalis were sensitive for drug VRC (80%), AMP (80%), FLU (60%), CAS (80%) and resistant pattern for FLU (20%).
Candida auris was resistant towards AMP (20%), FLU (20%) and sensitive for CAS (20%). 4 isolates of C. tropicalis were sensitive
to drug VRC (MIC range- 0.125μg/ml), AMP (MIC range- 1μg/ml), FLU (MIC range- 1μg/ml), CAS (MIC range- 0.25μg/ml) and
1 resistant pattern towards FLU (MIC range- 4μg/ml). C. auris was resistant towards AMP (MIC range- 2μg/ml), FLU (MIC range-
64μg/ml) and sensitive towards CAS (MIC range- 0.5μg/ml). MIC results were read after 24 hrs. Conventional methods give final
results minimum of 5-7 days after the blood culture was positive.

Antifungal susceptibility and species identification were also confirmed by with Vitek ® MS (bioMerieux Inc.). The automated
method for diagnosis of Candidemia, Maldi- TOF,and Vitek® MS (24 hrs) was less time-consuming rather than conventional
methods.

http://dx.doi.org/10.46889/JCIM.2023.4102 https://athenaeumpub.com/journal-of-clinical-immunology-microbiology/
 5

The mean (±SD) age of the PCR, Mn Ag and blood culture positive for candidemia was 37.91 (16.78) years, 39.00 (17.03) years
and 40.80 (18.18) years respectively. Blood culture positive variables are significantly (p- value < 0.05) associated with each other
PCR-positive patients and Mn Ag. 11 Out of 229 patients’ blood was positive for fungal infection, primer NL-1 and NL-4 were
able to amplify the D1/D2 region of 28S r- DNA of large ribosomal subunit which target rDNA yielding Product of PCR give 600
bp related to all fungus (Fig. 1). 5 out of 11 patients’ blood was positive for candida specific Primer P4501 and P4502 identify the
P-450 lanosterol 14α-demethylase gene which is target Candida species genes single band of around 350 bp [Fig. 2]. 13 patients
were positive for Mannan antigen for candida. The sensitivity and specificity of PCR 100% and 97.3% and Mannan Ag was 100%
and 96.4% respectively. In combination sensitivity and specificity of blood culture and PCR 55.5% (95% CI: 21.20%- 86.30%) and
100% (95% CI: 97.9%- 100 %). In current study higher sensitivity 84.6% was obtained in combination of PCR and Mn Ag.

Identification of Candidemia by the conventional method was 100% accurate when correlate with the non-culture methods.
Conventional methods are time taking and need an expert in mycology to do all tests. There was a difference in time taken by
conventional, automated, and molecular methods Table 4.

Figure 1: ClinicalfFeatures and association with Candidemia.

Figure 2: Lane M showing 100 bp DNA Ladder, lane 1 as a negative control, lane 2 showing 600 bp amplified PCR product of
fungus DNA, Lane 3,4,5,6,7 showing 600 bp amplified PCR product of fungal DNA.

http://dx.doi.org/10.46889/JCIM.2023.4102 https://athenaeumpub.com/journal-of-clinical-immunology-microbiology/
 6

Figure 3: Lane M showing 100 bp DNA Ladder, lane 1 showing 350 bp amplified PCR product of Candida, Lane 2 showing as
a negative control. Lane 3,4,5,6 showing 350 bp amplified PCR product of Candida.

Characteristic Total Possible % Probable IFD % Proven IFD %

(n=229) IFD (n=13) (n=220) (n=5)
Age, median (year)
Malignancy
Multiple myeloma 06 01 7.69 6 2.72 01 20
Pancytopenia 07 01 7.69 7 3.18 00 00
Aplastic Anemia 19 00 00 19 8.63 00 00
Immune Thrombocytopenia purprra 01 00 00 1 0.45 00 00
CML with Blast 01 00 00 1 0.45 00 00
Philadelphia acute leukemia 01 00 00 1 0.45 00 00
Hematologic Malignancy
ALL 57 03 23.07 54 24.54 00 00
AML 121 6 46.15 115 52.27 04 80
Non Hodgkins Lymphoma 10 00 00 10 4.45 00 00
Myelodysplastic Syndrome 02 00 00 2 0.90 00 00
Auto immune hemolytic anemia 01 00 00 1 0.45 00 00
Mantle Cell lymphoma 01 00 00 1 0.45 00 00
Hemophilia A 01 00 00 1 0.45 00 00
Hodgkins Lymphoma 01 00 00 1 0.45 00 00
Table 1: Demographic profile of underlying disease of hematological patients enrolled in the study.

S. No. Age/Sex Type of Clinical Culture PCR Mn Ag Specimen Antifungal Outcome

Cancer Presentation Results Results Treatment

1. 65Y/M Multiple Pleural rub, Candida Positive 1.2 Blood AmphoterecinB Death
myeloma lesion in spleen tropicalis
2. 45Y/M AML Chest pain Candida Positive 0.38 Blood Posaconazoles Discharge
tropicalis
3. 40Y/M AML Fever, Chest Candida Positive 1.2 Blood Posaconazole Death
Pain, Cough, tropicalis
4. 40Y/M AML Pleural rub,Chest Candida Positive 0.4 Blood AmphoterecinB Death
Pain, Cough tropicalis

http://dx.doi.org/10.46889/JCIM.2023.4102 https://athenaeumpub.com/journal-of-clinical-immunology-microbiology/
 7

5. 14Y/F AML Cough, fever, Candida Positive 1.3 Blood Caspofungin Death
chest pain auris
PCR are polymerase chain reaction.
MnAg values are in pg/ml.
Table 2: Characteristic of hematological patients with blood culture positive for Candida spp.

S. No. Age/Sex Type of Cancer Clinical Blood PCR Mn Ag Speci Antifungal Outcome
Presentation Culture Results Results men Treatment
1. 17Y/M AML Chest pain, Negative Positive 0.321 Blood Caspofungin Death
Cough
2. 26Y/M T- ALL Pleural rub Negative Positive 0.901 Blood Lipo-AmphoB Death
3. 27Y/F AML Cough Negative Positive 0.289 Blood Lipo-Ampho Discharge
4. 65Y/M B-ALL Fever Negative Positive 1.246 Blood Lipo- Amhoterecin Death
5. 36Y/F ALL Fever Negative Positive 0.299 Blood Posaconazole Discharge
6. Pancytopenia Febrile Negative Positive 2.416 Blood AmphoB Death
42Y/F Neutropenia
7. 62 Y /M AML Fever Negative Negative 0.288 Blood Posaconazole Death
8. 28Y/F AML Fever, cough Negative Negative 0.298 Blood Voriconazole Discharge
MnAg values are in pg/ml.
AML: Acute Myeloid leukemia
Table 3: Characteristic of patients with PCR and Mannan Ag positive for IFIS.

Test Sensitivity Specificity PPV NPV

Blood culture Mn 38.46 100 100 96.43
Ag assay
Blood Culture and 45.45 100 100 97.32
PCR
PCR and Mannan 84.62 100 100 99.08
Antigen Assay
Table 4: Sensitivity, specificity, positive predictive value and negative predictive values of blood culture, mannan Ag assay
and conventional PCR in combination for the diagnosis of IFIs.

Discussion and Conclusion

Candidemia is the fourth most common cause of all hospital-based blood stream infections which mainly affects
immunocompromised patients [27]. Immediate commencement of suitable antifungal treatment is required for controlling
invasive Candida infections, consequently rapid and early diagnosis is a requirement for ameliorating (better, improve) the
prediction of invasive Candidiasis. The present study focuses on the comparison of diagnostic methods for identification of
Candidemia to minimize the time and accurate species-specific is needed. Non- culture methods are less time-consuming than
blood culture or another automated method. The performance of Mn Ag and PCR was evaluated and compared with blood
culture as a golden standard for diagnosis of Candidemia [28]. Previous studies suggested that specificity of Ag diagnosis was
increased in patients during Candida infection [28].

In our present study, 2.1% (5/229) of blood culture samples received from suspected Candidemia cases were positive for 4 ◦C.
tropicalis (2.1%) and 1 isolate for C. auris (0.5%) in hematological patients in 3-year duration. The prevalence of Candidemia in
our study is 2.6% in hematological patients. In other studies prevalence of Candidemia varies in hematological patients ranging
from 1.6%,10% and 22.9% [11,13,20,30,31]. C. tropicalis was reported as the most frequent cause of Candidemia in the present
study [16,18]. C. tropicalis was sensitive to drug VRC, AMP, FLU, CAS, and 1 resistant pattern towards FLU [23,32]. C. auris was
resistant to AMP, FLU and sensitive towards CAS [15,23,34].The prevalence rate depends on the geographical conditions in a
particular area and also depends on the availability of diagnostic procedures in a particular laboratory. C. tropicalis and C. auris

http://dx.doi.org/10.46889/JCIM.2023.4102 https://athenaeumpub.com/journal-of-clinical-immunology-microbiology/
 8

were identified by Maldi-TOF MS with 100% accuracy [33,34]. The effectiveness of conventional PCR is more than the blood
culture method used in mycology laboratories.

In present study, Mn Ag positive (13/229) was find low threshold values (125 pg/ml), with high threshold values (500 pg/ml).
Similar findings were made by Mokaddas, et al., who discovered that when the Ag threshold was set at 500, there was no
discernible rise in the diagnosis of individuals with mucosal Candida colonisation in their Ag levels [35]. Children in the ICU
who potentially develop IC were studied in a study by Rao et al., and it was discovered that Ag was 100% sensitive [36].

In immune compromised patients, caspofungin is an ideal antifungal drug in minimum concentration for treatment of patients
on chemotherapy. Prior use of antifungal drugs for a long time is also a reason for the shifting of C. albican species to Non albicans
Candida and the drug resistance pattern of Candida is different.

Declaration of Patient Consent

All authors certify that the relevant patient information was obtained by consent forms. In the form the patient(s) have/ has given
her/his/their consent for her/his/theirs. The patients understand that their identities will not be published or disclosed.

Funding
This work was supported by Science and Engineering Research Board (SERB) (EMR/2017/003040 dated 16 Oct 2018) under the
Department of Science and Technology, New Delhi, India. Author Dr. Gopa Banerjee has received research support from SERB.

Conflict of Interest
The author has no conflict of interest to declare.

Availability of Data
All data generated during and/or analysed during the current study are not publicly available due to maintained confidentiality
of the patients, but are available from the corresponding author on reasonable request.

Ethics Approval
This study was approved in 2018 by the Institutional Ethics Committee of King George’s Medical University, Lucknow, Uttar
Pradesh, INDIA (letter no. 223/Ethics/R. Cell-18).

References
1. Gudlaugsson O, Gillespie S, Lee K, Vande Berg J, Hu J, Messer S, et al. Attributable mortality of nosocomial candidemia,
revisited. Clin Infect Dis. 2003;37:1172-7.
2. Barros L, Dueñas M, Alves CT, Silva S, Henriques M, Santos-Buelga C, Ferreira IC. Antifungal activity and detailed chemical
characterization of Cistus ladanifer phenolic extracts. Industrial Crops and Products. 2013;41:41-5.
3. Chapman B, Slavin M, Marriott D, Halliday C, Kidd S, Arthur I, et al. Changing epidemiology of candidemia in Australia. J
Antimicrob Chemother. 2017;72(4):1103-8.
4. Kofteridis DP, Valachis A, Dimopoulou D, Andrianaki AM, Christidou A, Maraki S, et al. Factors influencing non-albicans
Candidemia: a case-case-control study. Mycopathologia. 2017;182(7-8):665-72.
5. Magill SS, Edwards JR, Bamberg W, Beldavs ZG, Dumyati G, Kainer MA, et al. Multistate point-prevalence survey of health
care-associated infections. N Engl J Med. 2014;370(13):1198-208.
6. Lockhart SR, Iqbal N, Cleveland AA, Farley MM, Harrison LH, Bolden CB, et al. Species identification and antifungal
susceptibility testing of Candida bloodstream isolates from population-based surveillance studies in two U.S. cities from
2008 to 2011. J Clin Microbiol. 2012;50(11):3435-42.
7. Rajendran R, Sherry L, Deshpande A, Johnson EM, Hanson MF, Williams C, et al. A prospective surveillance study of
Candidaemia: epidemiology, risk factors, antifungal treatment and outcome in hospitalized patients. Front Microbiol.
2016;7:915.
8. Nami S, Mohammadi R, Vakili M, Khezripour K, Mirzael H, Morovati H. Fungal vaccines, mechanism of actions and

http://dx.doi.org/10.46889/JCIM.2023.4102 https://athenaeumpub.com/journal-of-clinical-immunology-microbiology/
 9

immunology: a comprehensive review. Biomed Pharm. 2018;109:333e44.

9. Medici N, Poeta M. New insight on the development on fungal vaccines: from immunity to recent challenges. Mem Inst
Oswaldo Cruz. 2015;110:966e73.
10. Sakagami T, Kawano T, Yamashita K, Ymada E, Fujino N, Kaeriyama M, et al. Antifungal susceptibility trend and analysis
of resistance mechanism for Candida species isolated from bloodstream at a Japanese university hospital. J Infect Chemother.
2019;25:34e40.
11. Dewan E, Biswas D, Kakati B, Verma SK, Kotwal A, Oberoi A. Epidemiological and mycological characteristics of candidemia
in patients with hematological malignancies attending a tertiary-care center in India. Hematoloncol and Stem Cell Ther.
2015;1;8(3):99-105.
12. Badiee P, Kordbacheh P, Alborzi A, Zakernia M, Haddadi P. Early detection of systemic candidiasis in the whole blood of
patients with hematologic malignancies. Jpn J Infect Dis. 2009;62(1):1-5.
13. Spampinato C, Leonardi D. Candida infections, causes, targets, and resistance mechanisms: traditional and alternative
antifungal agents. BioMed Res Int. 2013;2013:204237.
14. Frías-De-León MG, Hernández-Castro R, Vite-Garín T, Arenas R, Bonifaz A, Castañón-Olivares L, et. al. Antifungal
resistance in Candida auris: Mol Det Anti. 2020;9(9):568.
15. Guinea J. Global trends in the distribution of C andida species causing candidemia. Clin Microbiol and Infect. 2014;20:5-10.
16. Shastri PS, Shankarnarayan SA, Oberoi J, Rudramurthy SM, Wattal C, Chakrabarti A. Candida auriscandidaemia in an
intensive care unit-Prospective observational study to evaluate epidemiology, risk factors, and outcome. J Crit Care.
2020;1;57:42-8.
17. Cortegiani A, Misseri G, Giarratano A, Bassetti M, Eyre D. The global challenge of Candida auris in the intensive care unit.
Crit Care. 2019;23(1):1-3.
18. Yapar N. Epidemiology and risk factors for invasive candidiasis. Ther Clin Risk Manag. 2014;10:95.
19. Wisplinghoff H, Seifert H, Wenzel RP, Edmond MB. Current trends in the epidemiology of nosocomial bloodstream
infections in patients with hematological malignancies and solid neoplasms in hospitals in the United States. Clin Infect Dis.
2003;36(9):1103-10.
20. Chowdhary A, Sharma C, Meis JF. Candida auris: a rapidly emerging cause of hospital-acquired multidrug-resistant fungal
infections globally. PLoSpathog. 2017;13(5):e1006290.
21. Leaw SN, Chang HC, Sun HF, Barton R, Bouchara JP, Chang TC. Identification of medically important yeast species by
sequence analysis of the internal transcribed spacer regions. J Clin Microbiol. 2006;44(3):693-9.
22. Morace G, Pagano L, Sanguinetti M, Posteraro B, Mele L, Equitani F, et. al. PCR-restriction enzyme analysis for detection of
Candida DNA in blood from febrile patients with hematological malignancies. J Clin Microbiol. 1999;1;37(6):1871-5.
23. Park SY, Lee JS, Oh J, Park JY. Delta neutrophil index as a predictive and prognostic factor for Candidemia patients: a
matched case-control study. BMC Infect Dis. 2020;20(1):1-9.
24. Kothalawala M, Jayaweera JA, Arunan S, Jayathilake A. The emergence of non-albicans candidemia and evaluation of
HiChrome Candida differential agar and VITEK2 YST® platform for differentiation of Candida bloodstream isolates in
teaching hospital Kandy, Sri Lanka. BMC Microbiol. 2019;19(1):1-0.
25. Pasqualotto AC, Rosa DD, Medeiros LR, Severo LC. Candidaemia and cancer: patients are not all the same. BMC Infect Dis.
2006;6(1):1-7.
26. Kumar CP, Sundararajan T, Menon T, Venkatadesikalu M. Candidosis in children with onco-hematological diseases in
Chennai, south India. Jpn J Infect Dis. 2005;58(4):218.
27. Pandey N, Tripathi M, Gupta MK, Tilak R. Overexpression of efflux pump transporter genes and mutations in ERG11 pave
the way to fluconazole resistance in Candida tropicalis: A study from a North India region. J Glob Antimicrob Resist.
2020;22:374-8.
28. Bertout S, Dunyach C, Drakulovski P, Reynes J, Mallie M. Comparison of the Sensititre YeastOne ® dilution method with the
Clinical Laboratory Standards Institute (CLSI) M27-A3 microbroth dilution reference method for determining MIC of eight
antifungal agents on 102 yeast strains. Pathol Biol. 2011;59(1):48-51.
29. Paul S, Singh P, AS S, Rudramurthy SM, Chakrabarti A, Ghosh AK. Rapid detection of fluconazole resistance in Candida
tropicalis by MALDI-TOF MS. Med Myco. 2018;56(2):234-41.
30. Vatanshenassan M, Boekhout T, Meis JF, Berman J, Chowdhary A, Ben-Ami R, et. al. Candida auris identification and rapid

http://dx.doi.org/10.46889/JCIM.2023.4102 https://athenaeumpub.com/journal-of-clinical-immunology-microbiology/
 10

antifungal susceptibility testing against echinocandins by MALDI-TOF MS. Front Cell Infect Microbiol. 2019;18;9:20.
31. Mikulska M, Calandra T, Sanguinetti M, Poulain D, Viscoli C. The use of mannan antigen and anti-mannan antibodies in the
diagnosis of invasive candidiasis: recommendations from the Third European Conference on Infections in Leukemia. Critical
Care. 2010;14(6):1-4.
32. Tissot F, Agrawal S, Pagano L, Petrikkos G, Groll AH, Skiada A, et al. ECIL-6 guidelines for the treatment of invasive
candidiasis, aspergillosis and mucormycosis in leukemia and hematopoietic stem cell transplant patients. Haematologica.
2017;102(3):433.
33. Clancy CJ, Nguyen MH. Diagnosing invasive candidiasis. J Clin Microbiol. 2018;56(5):e01909-17.
34. Chumpitazi BF, Lebeau B, Faure-Cognet O, Hamidfar-Roy R, Timsit JF, Pavese P, et al. Characteristic and clinical relevance
of Candida mannan test in the diagnosis of probable invasive candidiasis. Medical Mycol. 2014;52(5):462-71.
35. Mokaddas E, Burhamah MH, Khan ZU, Ahmad S. Levels of (1→3)-β-D-glucan, Candida mannan and Candida DNA in
serum samples of pediatric cancer patients colonized with Candidaspecies. BMC Infectious Dis. 2010;10(1):1-6.
36. Altintop YA, Ergul AB, Koc AN, Atalay MA. The role of combined use of mannan antigen and anti-mannan antibodies in
the diagnosis of invasive candidiasis in pediatric intensive care unit. Med. 2021;10(4):1368-72.

Publish your work in this journal

Journal of Clinical Immunology & Microbiology is an international, peer-reviewed, open access journal publishing original research, reports, editorials,
reviews and commentaries. All aspects of immunology or microbiology research, health maintenance, preventative measures and disease treatment
interventions are addressed within the journal. Immunologist or Microbiologist and other researchers are invited to submit their work in the journal. The
manuscript submission system is online and journal follows a fair peer-review practices.

Submit your manuscript here: https://athenaeumpub.com/submit-manuscript/

http://dx.doi.org/10.46889/JCIM.2023.4102 https://athenaeumpub.com/journal-of-clinical-immunology-microbiology/