Farber, Matthew - Barth, Roger - Mastering Brewing Science - Beer Production and Quality-John Wiley & Sons (2019)

MASTERING BREWING
SCIENCE
MASTERING BREWING
SCIENCE
Quality and Production
Matthew Farber
Department of Biology
University of the Sciences
Philadelphia, PA 19063, USA
Roger Barth
Department of Chemistry
West Chester University
West Chester, PA 19383, USA
This edition first published 2019
© 2019 John Wiley & Sons, Inc.
All rights reserved. No part of this publication may be reproduced, stored in a retrieval system,
or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording or
otherwise, except as permitted by law. Advice on how to obtain permission to reuse material
from this title is available at http://www.wiley.com/go/permissions.
The right of Matthew Farber and Roger Barth to be identified as the authors of this work has
been asserted in accordance with law.
Registered Office
John Wiley & Sons, Inc., 111 River Street, Hoboken, NJ 07030, USA
Editorial Office
111 River Street, Hoboken, NJ 07030, USA
For details of our global editorial offices, customer services, and more information about Wiley
products visit us at www.wiley.com.
Wiley also publishes its books in a variety of electronic formats and by print‐on‐demand. Some
content that appears in standard print versions of this book may not be available in other formats.
Limit of Liability/Disclaimer of Warranty
In view of ongoing research, equipment modifications, changes in governmental regulations,
and the constant flow of information relating to the use of experimental reagents, equipment,
and devices, the reader is urged to review and evaluate the information provided in the package
insert or instructions for each chemical, piece of equipment, reagent, or device for, among other
things, any changes in the instructions or indication of usage and for added warnings and
precautions. While the publisher and authors have used their best efforts in preparing this work,
they make no representations or warranties with respect to the accuracy or completeness of the
contents of this work and specifically disclaim all warranties, including without limitation any
implied warranties of merchantability or fitness for a particular purpose. No warranty may be
created or extended by sales representatives, written sales materials or promotional statements
for this work. The fact that an organization, website, or product is referred to in this work as a
citation and/or potential source of further information does not mean that the publisher and
authors endorse the information or services the organization, website, or product may provide
or recommendations it may make. This work is sold with the understanding that the publisher is
not engaged in rendering professional services. The advice and strategies contained herein may
not be suitable for your situation. You should consult with a specialist where appropriate.
Further, readers should be aware that websites listed in this work may have changed or
disappeared between when this work was written and when it is read. Neither the publisher nor
authors shall be liable for any loss of profit or any other commercial damages, including but not
limited to special, incidental, consequential, or other damages.
Library of Congress Cataloging‐in‐Publication Data
Names: Farber, Matthew, 1984– author. | Barth, Roger, author.
Title: Mastering brewing science : quality and production / Matthew Farber,
Department of Biology, University of the Sciences, Roger Barth, Department
of Chemistry, West Chester University.
Description: First edition. | Hoboken, NJ : John Wiley & Sons, Inc., 2019. |
Includes bibliographical references and index. |
Identifiers: LCCN 2019007045 (print) | LCCN 2019011200 (ebook) | ISBN 9781119456049
(Adobe PDF) | ISBN 9781119456032 (ePub) | ISBN 9781119456056 (pbk.)
Subjects: LCSH: Brewing. | LCGFT: Cookbooks.
Classification: LCC TP570 (ebook) | LCC TP570 .F33 2019 (print) | DDC 663/.3–dc23
LC record available at https://lccn.loc.gov/2019007045
Cover Design: Marcy Barth
Cover Image: Naomi Hampson and Dorothy Ringler
Illustrations: Roger Barth
Set in 10/12pt TimesTen by SPi Global, Pondicherry, India
Printed in the United States of America
10 9 8 7 6 5 4 3 2 1
CONTENTS
About the Authors xi

Preface xiii
Acknowledgments xv
1 BREWING QUALITY OVERVIEW 1

1.1 Ingredients 2
1.2 Brewing Overview 4
1.3 A Scientific History of Brewing 16
1.4 Introduction to Beer Quality 27
Check for Understanding 32
Case Study 33
Case Study Questions 34
Bibliography 34
2 CHEMISTRY FOR BREWING 37
2.1 Atoms 37
2.2 Bonding and Compounds 44
2.3 Molecules 50
2.4 Intermolecular Forces 54
2.5 Structure of Molecules 57
v
vi CONTENTS
2.6 Organic Chemistry and Functional Groups 59

2.7 Chemical Reactions 62
Bibliography 67
3 BIOLOGY FOR BREWING 69
3.1 Macromolecules 69
3.2 Membranes 90
3.3 Cellular Structures 93
3.4 The Central Dogma 95
Bibliography 104
4 RAW MATERIALS 107

4.1 Water 108
4.2 Malt 125
4.3 Hops 148
Bibliography 164
5 GRAIN HANDLING AND MILLING 167

5.1 Malt Storage and Transfer 167
5.2 Milling 177
Case Study 185
Bibliography 186
6 MASHING 187
6.1 Starch Hydrolysis 187
6.2 Enzymes 189
6.3 Mashing Process 196
6.4 Mash Conversion Vessel Design and Operation 200
6.5 The Use of Adjuncts 209
6.6 Enzymes and Processing Aids 211
Case Study 215
Bibliography 216
7 WORT SEPARATION 217

7.1 Wort Separation Processes 217
7.2 Flow and Pressure 225
CONTENTS vii
7.3 Lipid Removal 227

7.4 Management of Spent Grains 228
Case Study 229
Bibliography 229
8 BOILING, WORT CLARIFICATION, AND CHILLING 231

8.1 Heat Transfer 233
8.2 Boiling Technology 236
8.3 Boiling Chemistry 247
8.4 Chilling 250
Case Study 252
Bibliography 253
9 FERMENTATION 255
9.1 Fermentation Process 255
9.2 Fermentation Reactions 275
9.3 Energy and Atp 278
9.4 Oxidation, Reduction, and Nad 280
9.5 Fermentation Equipment 282
9.6 Temperature Monitoring and Control 287
9.7 Yeast Handling and Repitching 293
9.8 Yeast Propagation 299
Case Study 306
Bibliography 307
10 CONDITIONING 309
10.1 Warm Conditioning 310
10.2 Clarification 313
10.3 Carbonation 319
10.4 Beer Aging 323
10.5 Analytical and Quality Control Procedures
for Conditioning 325
Case Study 329
Bibliography 329
11 PACKAGING AND SERVING 331

11.1 Kegs and Casks 332
11.2 Gas Laws 337
viii CONTENTS
11.3 Keg Dispense System 341

11.4 Bottles 350
11.5 Cans 351
11.6 Filling Bottles and Cans 353
11.7 Beer Service and Packaging Quality 360
Case Study 367
Bibliography 368
12 FLAVOR 369
12.1 Flavor Anatomy and Chemistry 370
12.2 Flavor Compounds 373
12.3 Off‐Flavors 378
12.4 Analysis and Quality Control to Monitor Flavor
Consistency 388
Case Study 392
Bibliography 393
13 COLOR, FOAM, AND HAZE 395

13.1 Light 395
13.2 Color 399
13.3 Foam 403
13.4 Haze 414
Case Study 423
Bibliography 424
14 BIOLOGICAL STABILITY 427

14.1 Identifying Spoilage Microorganisms 428
14.2 Microbial Stabilization Methods 440
14.3 Analytics and Quality Control of Microorganisms 446
Case Study 458
Bibliography 458
15 MATHEMATICS OF QUALITY 461

15.1 Statistics for Quality 461
15.2 Control Charts 466
15.3 Dimensions, Units, and Conversions 469
15.4 Brewing Calculations 471
CONTENTS ix

Case Study 476
Bibliography 476
16 CLEANING, CIP, AND SANITIZATION 477

16.1 Cleaning a Brewery 478
16.2 Clean in Place 480
16.3 Cleaning Chemicals 484
16.4 Sanitizers 487
16.5 Analysis and Quality Control of Cleaning Effectiveness 489
Case Study 491
Bibliography 492
Glossary 493
Index 551
ABOUT THE AUTHORS
Matthew Farber, PhD, is the program director of the Brewing Science

Certificate program at the University of the Sciences in Philadelphia where
he is also an assistant professor of biology. He received a BS in Biology with
a minor in writing from Seton Hall University and a doctorate in molecular
and cellular biology with a minor in teaching from the University of Pittsburgh.
His research focuses on innovative applications of biotechnology for the
improvement of beer production, and he is an inventor on two pending
patents in brewing. He is an active member of the American Society of
Brewing Chemists, the Master Brewers Association of the Americas, and the
Brewers Association.
Roger Barth, PhD, has been a faculty member in the chemistry depart-
ment at West Chester University in Pennsylvania since 1985. He created a
course entitled The Chemistry of Beer and is the author of its textbook.
Barth’s research interests center upon brewhouse processing and beer and
malt analytical methods. He has a BA in Chemistry from La Salle College.
His doctorate is in physical chemistry from The Johns Hopkins University,
and he has done postdoctoral work in the area of catalysis at University of
Delaware and Drexel University. He is a member of the American Chemical
Society, the American Association for the Advancement of Science, Sigma Xi,
the American Society of Brewing Chemists, and the Master Brewers
Association of the Americas.
xi
PREFACE
Brewing is a creative art. Underlying that art is a framework of technical

knowledge, mostly in chemistry and biology, but with significant contribu-
tions from physics and engineering. To make five gallons of drinkable beer
requires little scientific background, with the definition of drinkable up for
debate. To make hundreds of batches of beer, each of which meets the expec-
tations of the customers, each of which is consistent with the last, sound
science is required. This is the goal of modern brewers.
This book is written as an instructional resource for teaching or learning
brewing practice and theory with a focus on the underlying science. We try to
strike a balance between critical scientific concepts, beer production, and
day‐to‐day practical issues in beer quality. By understanding the science of
beer production, readers will be better equipped to troubleshoot problems in
the brewery, one of the most critical skills for a successful career in beer. We
have produced hundreds of illustrations to demonstrate key concepts and to
demonstrate the numerous pieces of equipment commonly used in breweries.
Unlike drawings provided by equipment suppliers, our drawings do not
inform operation or maintenance. Rather, they illustrate essential design
elements and concepts as they pertain to the process.
In this book, we first introduce a high‐level view of the brewing process.
Then we dive into the fundamentals of biology and chemistry with appropri-
ate application to the brewing process. These concepts will be critical to b
etter
understanding of subsequent chapters. The remaining material is presented in
xiii
xiv PREFACE
order, from raw materials, through the brewing process, and on to methods
for quality. All employees at a brewery should be trained in basic concepts of
quality. Quality is best managed at the source where response time is quick.
As more and more brands line the shelves, the consumer has more and
more options. If one batch of beer is flawed in the eyes (and palate) of the
consumer, it is easy to move on to another brewery. Brewing with quality
requires a high level of awareness of the procedures, the materials, and the
equipment used in brewing. Our goal in this book is to address essential con-
cepts in quality and consistency to help the readers become better brewers.
At the conclusion of most chapters are review questions to check for under-
standing, followed by a case study for critical analysis and discussion.
We make extensive use of primary and secondary references, but we
deliberately omitted all in‐line references and any citations that might be
distracting to the student. Useful and critical references are mentioned at
the end of each chapter under “Bibliography.” Many of the facts that we
present were won by the brilliant insights and very hard work of thousands of
scientists. We herewith acknowledge their contributions, even if, for the
benefit of readers, we did not give them citations. We hope that this approach
will be more effective than voluminous citations in putting the work of our
colleagues into the hands of students, who will be the next generation of
brewers and brewing scientists.
ACKNOWLEDGMENTS
We gratefully acknowledge our wives, Dr. Grace Farber and Marcy Barth, for
their love and support. Marcy provided outstanding expertise and artistry in
the photography, design, and execution of illustrations. Grace provided guid-
ance and advice in the teaching of essential concepts in biology. We humbly
thank our families for their patience, encouragement, and love.
Donna‐Marie Zoccoli and Dr. David Barth, our eagle‐eyed copy readers,
read the manuscript multiple times, corrected errors, and made countless sug-
gestions that make the book easier to read and understand. Dr. Naomi
Hampson took some outstanding photographs. Kent Pham, Dave Goldman,
Michelle McHugh, and Eric Jorgenson provided additional pictures. Our
friends at Deer Creek Malt House, Philadelphia Brewing Company, Sly Fox
Brewing Company, Susquehanna Brewing Company, Victory Brewing
Company, Yards Brewing Company, and Yuengling Beer Company were gen-
erous with their time and gave us insights, explanations, and access for photo-
graphs. Our professional societies, The American Society of Brewing Chemists
(ASBC) and the Master Brewers Association of the Americas (MBAA)
maintain outstanding resources and networking opportunities that were criti-
cal to our own development as brewing chemists. Our institutions (University
of the Sciences in Philadelphia and West Chester University) and their librar-
ies and librarians provided essential support. Our editors at Wiley, Jonathan
Rose, Aruna Pragasam, and Viniprammia Premkumar, have been supportive,
helpful, and responsive. Our students motivated the entire project with their
enthusiasm and unquenchable desire to learn.
xv
xvi ACKNOWLEDGMENTS
We are forever grateful to the supporting words and actions of our own
teachers and mentors in years past. Dr. Farber acknowledges Dr. Peter Berget
for his mentorship and Dr. Angela Weisl for the inspiration to pursue writing.
Dr. Farber is incredibly thankful for his parents, Dr. Phillip and Larice Farber,
for instilling endless curiosity and creativity in him. Dr. Barth acknowledges
his physical chemistry teacher and father, the late Dr. Max Barth; his high
school chemistry teacher, Mr. Dugan; and his high school English teacher,
Mr. Martini, who taught the importance of clarity and precision in writing.
Chapter 1
BREWING QUALITY OVERVIEW
We wrote this book to help you to better understand, appreciate, and apply
the science behind the materials and processes of making beer. The better
your grasp of brewing science, the more dependably you will be able to
make delicious beer, and the more reliably you will be able to devise new
beers to meet changing consumer preferences. So what is beer? How does
beer differ from its fermented beverage brethren? There are legal and
marketing definitions, but in a book on brewing science, we will use a sci
entific definition. Beer is an undistilled alcoholic beverage derived from a
source of starch. “Derived from” covers a complex series of interacting
steps, each of which influences the character of the final product and is
ultimately the focus of this book. Brewing beer differs from fermentation
of wine in that for brewing, a source of starch must first be converted into
fermentable sugars. The brewer is responsible for management and con
trol of all steps of the brewing process to produce a beer of reliable and
reproducible quality.
There are four main ingredients in beer: water, malt, hops, and yeast. If
randomly combined, these four ingredients might turn into an alcoholic
beverage of questionable quality, but in this chemical process, the brewer is
like an enzyme, a substance that guides and speeds up a reaction. Mastering
Mastering Brewing Science: Quality and Production, First Edition.

Matthew Farber and Roger Barth.
© 2019 John Wiley & Sons, Inc. Published 2019 by John Wiley & Sons, Inc.
1
2 BREWING QUALITY OVERVIEW
the science of raw materials and the process steps of beer production is
essential to making quality beer. Here, we will start with a broad overview of
the brewing process followed by a scientific history of beer and the scientific
method. In learning how to conduct an experiment, you will begin to under
stand the process of troubleshooting problems in the brewery. And finally, as
our major goal is to brew beer of excellent quality and consistency, we will
discuss beer quality as defined in several contexts. Each of these topics will be
discussed further in depth in the chapters that follow.
1.1 INGREDIENTS
In addition to the main ingredients, beer is often brewed with other ingredi
ents. These can include adjuncts, which are sources of starch or sugar other
than malt, and processing aids, which are materials used to help give the beer
desirable characteristics. Some common processing aids are finings, which
help to clarify the beer; carbon dioxide, which carbonates the beer; foam
enhancers, which provide desirable foam properties; and colored materials,
which are used to adjust the color of the beer. In this introduction we
will touch upon the main four ingredients. Adjuncts and processing aids are
covered in later chapters.
Water
Beer is usually more than 90% water. It can take as much as 12 volumes of
water to make 1 volume of beer. Some breweries have been able to cut
this ratio to three or less. Less water means less energy use, less waste m aterial
to dispose of, and less negative impact on the environment. Water itself
is a characterless compound of fixed composition. Water supplied to b reweries
is a mixture with many desirable and undesirable components present
in trace amounts. The nature and amount of these trace com ponents
is important to the character and quality of the beer. Water is usually processed
to adjust the trace components. Water that is to be made into beer is
sometimes called brewing liquor. Chapter 4 discusses brewing water
in detail.
Malt
Brewing beer requires starch, the source of which is cereal grain. At least
some of the grain is ordinarily processed to give malt, a process called malting.
Malt is seeds of grain that are germinated and then dried. The most common
grain for malting is barley, but wheat, rye, and oat malt are available. Rice and
INGREDIENTS 3
maize (corn) can be malted, but these malts are strictly specialty items; they
are rarely used in beer brewing. Since medieval times, malting has been a
separate craft from brewing, and malt is produced in specialized facilities.
Brewers need a basic understanding of the malting process to make the most
effective use of the available varieties of malt.
Malting begins by cleaning live seeds of grain over a series of sieves.
The grain is then steeped (soaked in water) at a controlled temperature,
typically in two to three stages of steeping and draining. The grain is then
permitted to germinate. It must be kept in contact with air to support res-
piration and to carry away heat generated by the life processes. The seeds
are regularly turned to expose them to oxygen and to maintain a uniform
temperature, avoiding hot or cold spots. Regular turning also prevents
sprouting roots from becoming tangled. The germination process produces
several changes in the seeds, collectively called modification. Enzymes are
produced that assist the modification process. Some of these enzymes are
also critical to the brewing process in that they are responsible for convert
ing the starch to sugar during mashing. Certain polymers, including pro-
teins and beta‐glucan, are hydrolyzed into smaller molecules under the
influence of the enzymes. After modification, the seed loses its pebble‐like
hardness and becomes friable (easily crushed). Some of the starch in the
seeds is consumed as fuel to power the life processes of the embryo. This is
called malting loss. When the maltster judges that germination has pro
ceeded far enough, the seeds are transferred to an oven, called a kiln, and
heated with moving air. Different grades of malt are produced by varying
the degree of modification and the temperature and duration of heat treat
ments. Shorter kiln times at lower temperatures yield malt with more
starch‐hydrolyzing enzymes and less flavor. Longer, higher temperature
kiln treatment yields darker, more highly flavored malts, but with a lower
enzyme content. Some malt is subjected to additional heating, called roast
ing, to give dark, highly flavored but nonenzymatic malt. Chapter 4 covers
the malting process in detail.
Hops
The hop is a climbing plant, Humulus lupulus. The fruits of the hop plant,
hops, are boiled with the beer wort to provide bitterness and other flavors.
Hop compounds also have an antibacterial effect that can help preserve the
beer. Sometimes hops are added at other points in the brewing process to
provide desired flavor effects. There are many varieties of hops with different
flavor profiles. In addition, there are products derived from hops that are
often used instead of or in addition to the natural hops. Chapter 4 provides
details about hops and their processing.
Yeast
Yeast is the single‐cell fungus that converts sugar to ethanol and carbon
dioxide. The action of yeast on sugar is fermentation. Most beer fermentation
is carried out by one of two species of yeast, Saccharomyces pastorianus,
used for lager beer, and Saccharomyces cerevisiae, used for ale. Some
specialty beer styles are fermented with Brettanomyces bruxellensis,
Brettanomyces lambicus, or related species. Within a particular yeast species,
there are many variations, called strains. The species and strain of yeast affects
the character of the beer. Yeast is often cultivated at the brewery. Processes
and practices involving yeast are covered in detail in Chapter 9.
1.2 BREWING OVERVIEW
A graphical overview of the brewing process is provided in Figure 1.1. In brief:
• Malt and other grains are crushed in the mill. Crushed grain is called
grist.
• The grist is loaded into the grist case until mashing.
• The grist is mixed with hot water in the premasher on its way into the
mash tun.
• In the mash tun, enzymes from the malt cause the starch in the grist to
be converted to soluble extract, which contains sugars that the yeast can
ferment.
• The solution of extract, called wort, is separated from the remaining
grist particles in the lauter tun. Extract that sticks to the particles is
washed out with hot water in a process called sparging.
• The clear wort is boiled in the kettle. Hops are added.
• The remains of the hops and solids that form during boiling (hot break
or trub) are removed in the whirlpool.
• The clear, boiling hot wort is cooled in a heat exchanger called the
chiller.
• The cool wort is pumped into a fermenter. Yeast is added (pitched).
• After several days of fermentation and conditioning, the yeast is
removed from the beer, and the beer is pumped into the bright beer
tank. Carbon dioxide is added under pressure.
• The beer is served or packaged.
A summary of the duration and temperature ranges for each step in the
brewing process is provided in Table 1.1. This table represents a general
summary and overview; different breweries using different equipment and
brewing different styles of beer may have quite different programs.
BREWING OVERVIEW 5
mashing wort separation
premasher grist case

milling water water
sparge
grain
m
alt
mash
tun lauter tun
mill
boiling
chilling hops
clarifying
cool wort heat
exchanger
whirlpool
kettle
hot wort
fermenting
yeast
conditioning
CO2
fermenter filtering
bright beer
to
packaging
centrifuge
Figure 1.1 Overview of the brewing process for a four‐vessel brew house.
TABLE 1.1 Brewing Steps, Durations, and Temperatures

Process Step Duration Temperature
Milling 1–2 hours Ambient
Mashing 1–2 hours 45–67 °C
Lautering/sparging 1–2 hours 75–78 °C
Boiling 1–2 hours 105 °C
Whirlpool 15–30 minutes 76–74 °C
Fermentation (ale) 4–10 days 15–25 °C
Conditioning (ale) 2–14 days −1 to 6 °C
Filtration 2–12 hours 2–6 °C
Packaging <12 hours 2–6 °C
Duration of typical shelf life ~6 months 2–6 °C
Figure 1.2 Brew house at Victory Brewing Company.
Brew House
The brew house (Figure 1.2) is the facility that makes beer wort out of water,
malt, adjuncts, and hops. Brew house operations involve hot water or hot
wort, so the brew house is sometimes called the hot side. Because one of the
last steps in this process is boiling the wort, the brew house presents less of a
concern for microbial spoilage than the cellar. The brew house operations are
milling, mashing, wort separation, boiling, and chilling.
Milling Malt is delivered to breweries in bulk or in bags. Before use in

brewing, malt must be crushed into small pieces to extract the starch. The
physical operation involved is milling. Crushed grain is called grist. The device
BREWING OVERVIEW 7
Figure 1.3 Mill at Susquehanna Brewing Company.
that performs the operation is a mill (Figure 1.3). The primary purpose of
milling is to allow starch from the grain, enzymes from malt, and water to come
into contact during the mashing step. A seed of grain is protected by a water‐
resistant seed coat, also called the testa. Milling breaks open the seed coat and
crushes the interior of the seed, producing additional surfaces at which water
can react with starch. Milling details have a significant effect on the character
of the beer and the efficiency of the process. It is essential that the malt hulls
be split but not pulverized. They will aid in a later step, wort separation.
Mashing During the mashing step, starch is converted to smaller sugars

that brewing yeast can ferment. Yeast cannot ferment starch, so this step is
essential. During mashing, hot water, sometimes called brewing liquor, is
mixed with the grist to give a temperature in the range of 60–70 °C (140–
158 °F). Sometimes mashing starts at a lower temperature, and the temperature
is raised continuously or in steps to influence the protein or carbohydrate
profile. Mashing is conducted in a mash conversion vessel (MCV), also called
a mash tun (Figure 1.4). The mash tun may contain an agitation paddle for
gentle mixing. The details of the time–temperature profile, the activities of
Figure 1.4 Inside the mash tun at Victory Brewing Company.
enzymes derived from malt, and the pH of mashing have a decisive effect on
the character of the beer.
Three processes must occur for effective mashing. The first is gelatiniza-
tion, in which starch granules absorb water, swell, and burst, giving the starch
molecules access to water. Some grains, including barley and wheat, gelati
nize readily in the normal mashing temperature range. Others, like maize
(corn) and rice, must be cooked in a separate vessel before addition to the
mash. The second process is liquefaction, in which starch molecules are hydro
lyzed in the interior of the molecular chain to give soluble, but still too large
for fermentation, fragments. The third process is saccharification, in which
starch chains and fragments are further broken down at the ends of the chains
to yield the fermentable sugars: glucose, a monosaccharide; maltose, a disac-
charide; and maltotriose, a trisaccharide. Mashing temperature plays a key
role in determining the fraction of starch that is liquefied and the fraction of
dissolved carbohydrate that is fermentable.
The amounts of unfermentable and fermentable carbohydrates are
determined during mashing, influencing the character of the finished beer.
The generation of more fermentable sugars results in a thinner, dryer beer
with more alcohol. A mash with less fermentable sugars leads to less alcohol
but more body and texture.
BREWING OVERVIEW 9
Wort Separation After mashing, the wort, the insoluble material, and
the broken hulls remain in a slurry. Wort separation is required to obtain
clear wort. The solids remaining after separation are called draff or spent
grain. Two methods of wort separation are in common use. The most
popular is the lauter process [Ger: clear, pure]. In this process the solids
are supported on a perforated false bottom above the true bottom of the
vessel. Liquid is drawn through the grain and the false bottom via valves in
the true bottom. The actual filtration is accomplished by the grain bed, the
split hulls from the malt. The false bottom supports the grain bed and
facilitates separation. In the first minutes of wort separation, wort is
recirculated to the top of the vessel. Recirculation, called vorlauf [Ger:
forerun], is maintained until the wort runs clear, indicating the grain bed is
set. If the mash and lauter are accomplished in the same vessel, this is
called a mash/lauter tun. Often the entire mash, liquids and solids, are
pumped into a separate, dedicated vessel called the lauter tun (Figure 1.5).
The lauter tun is equipped with knives or rakes that slowly dig into the
grain bed to increase the filtration speed. A different lautering device, less
common in small breweries, is the mash filter. Here the entire mash,
including liquids and solids, is pumped into compartments from which the
liquid is driven by pressure through filtration material.
During or after lautering, the grain is rinsed with hot water, a process
called sparging. Sparging recovers sugar that is held up in the grain bed, so
more beer can be made from less grain.
Figure 1.5 A peek into the lauter tun at Urban Village Brewing Company. Source:
Photo: Dave Goldman.
Boiling The clarified wort is sent to a vessel called a brew kettle, also called
a copper, or a wort boiler (Figure 1.6) and heated to boiling. The wort is
usually boiled for 60–90 minutes with evaporation of up to 20% of the wort
volume. Boiling consumes the most energy of any step of the brewing process.
Hops or hop products are generally added before or during boiling, often in
stages so that different portions of the hops are subjected to different boiling
durations. Boiling serves several purposes, including the following:
• Isomerization of hop compounds for bitterness.

• Sterilization.
• Dissipation of off‐flavors.
• Removal of proteins and lipids that affect beer clarity and stability.
• Concentration of wort.
Boiling generates solid material called hot break or trub (“troob”).

Sometimes the hot break material is removed before chilling, either by
allowing it to settle (sedimentation) or in a vessel called a whirlpool, in which
Figure 1.6 Brew kettle at Yuengling Beer Company.

BREWING OVERVIEW 11
the wort is made to move in a horizontal circular pattern that drives the solids
into a compact mound at the bottom center of the vessel. In some breweries
the kettle itself also serves as the whirlpool.
Chilling Before fermentation, the temperature of the wort must be lowered

from near boiling (100 °C or 212 °F) to the fermentation temperature
(typically 9–20 °C or 48–68 °F), a process called chilling. The standard
equipment for chilling is a countercurrent plate heat exchanger. The unit
consists of a series of closely spaced and parallel heat‐conducting plates, as
shown in Figure 1.7. The hot wort flows through half of the channels between
the plates, and a coolant, typically water or an antifreeze mixture, flows
through the rest. Each plate has wort on one side and coolant on the other.
Typically, the outgoing water, which is now hot, is added to the hot liquor
tank, to be used for later brewing operations.
In some traditional breweries, the hot wort is drawn into a wide, shallow
vessel called a coolship, where it is slowly cooled by convection. A few brew
eries use this method to capture wild bacteria and yeast, but most brewers
prefer a closed chiller to avoid the risk of contamination.
At the beginning of fermentation, the yeast needs dissolved oxygen (as a
nutrient, not for respiration) to help prepare cell membranes. Because the
Figure 1.7 Chiller at Philadelphia Brewing Company.

boiling process strips the wort of all dissolved gases and because gases are
more soluble at cooler temperatures, oxygen is injected into the wort as it
exits the chiller. The oxygen requirement depends on the solids content of the
wort and on the strain of yeast.
Cellar
Before the days of mechanical refrigeration, fermentation and conditioning
were often carried out in an underground room, or even a cave, called the
cellar. Figure 1.8 depicts the underground caves at the Yuengling brewery in
Pottsville, PA, where beer was formerly lagered and conditioned. Today, fer
mentation and conditioning temperatures are usually controlled artificially in
the tanks themselves, and the “cellar” can be at any level of the brewery. The
cellar is sometimes called the cold side.
Fermentation Cooled, aerated wort from the chiller is transferred to a

fermenter, also called a fermentation vessel (FV). The most widely used
configuration for the fermenter is the cylindroconical vessel (CCV), shown in
Figure 1.9. A selected strain of yeast is added or pitched into the wort.
Fermentation converts certain sugars to ethanol and carbon dioxide. The
reaction is carried out by yeast, a single‐celled fungus, as a means for the yeast
to make cellular energy in the absence of oxygen. Fermentation occurs in 12
distinct steps. The overall reaction is C6H12O6 → 2C2H5OH + 2CO2. In addition
Figure 1.8 Caves at Yuengling Beer Company.

BREWING OVERVIEW 13
Figure 1.9 Fermentation vessels in the cellar at Susquehanna Brewing Company.
to the main reaction, fermentation is accompanied by a variety of side reactions

whose products can affect the flavor profile of the beer. The types and amounts
of flavor‐active side products depend strongly on the fermentation temperature,
the species and strain of yeast, and the presence of bacteria. The fermentation
reaction generates heat, so fermenters usually have provision for cooling.
Beer that is fermented at a temperature higher than 15 °C (59 °F) is
classified as ale. Ale is usually fermented with a species of yeast called
S. cerevisiae, also called top fermenting yeast. Beer fermented at lower tem
perature is lager beer, usually made with a species called S. pastorianus, also
called bottom fermenting yeast.
Conditioning After fermentation, the new beer, called ruh beer, or green
beer, is held in contact with the yeast for a period that can be as short as a few
days for a low‐strength ale to several months for some types of lager beer.
This is the first part of the conditioning process, sometimes called secondary
fermentation. In lager beer, the secondary fermentation is called lagering.
During this period the flavor of the beer matures, mainly because the yeast
absorbs off‐flavor compounds. This part of conditioning can take place in the
original fermenter or in a dedicated conditioning vessel. Once flavor
maturation is achieved, the beer is cooled, which facilitates separation of
yeast and clarification of the beer.
Filtration Beer is often, but not always, subjected to one or more clarification
processes. Materials called finings may be added to beer to bind and remove
haze‐forming compounds. The beer may be kept in a tank to allow solids to
sediment. It may be clarified in a centrifuge. It may be filtered, often through

a bed of diatomaceous earth (DE) or cellulose‐containing membranes. It may
be treated for microbial stability before packaging by filtering out microbes
or after packaging by a heat process called pasteurization.
After filtration, the beer is pumped into the bright beer tank, so named
because the beer at this stage is free of yeast and haze, that is, it is bright.
Usually carbon dioxide is dosed into the beer, either in the bright beer tank
or in the line to the packaging unit, to provide characteristic carbonation. At
this point the beer is ready to be served directly from the bright tanks or to be
packaged in kegs, bottles, or cans.
Unfiltered beer is common in small breweries that lack filtration equip
ment. Here beer is chilled after fermentation, carbonated, and served directly.
Brewers should make sure that fermentation is complete before packaging
unfiltered, unpasteurized beer to avoid the risk of excessive pressure from
secondary fermentation.
Packaging
The major purpose of beer packaging is to protect the beer until it is served.
Beer must be kept under pressure to maintain carbonation. Light and oxygen
must be excluded to avoid (or at least defer) the development of off‐flavors.
Small pack refers to packaging that is intended for single servings or direct
consumer use. About 2 L (~0.5 US gallon) is considered the upper limit of small
pack. Standard small packaging is aluminum cans and glass bottles. Plastic PET
bottles are also on the rise. In addition to protecting the beer, small pack has the
very important function of enhancing sales. Small pack is invariably decorated
with branding material. Bottles are festooned with paper or plastic labels. Some
have front labels, back labels, neck labels, and cap covers (often made of foil).
Cans, if purchased in quantity, can be preprinted directly on the aluminum.
Alternatively, breweries may apply a label or plastic shrink wrap to an unlabeled
aluminum can. Bottles and cans are packed in branded secondary packaging
such as six packs and cases, usually made of cardboard or plastic.
The other type of packaging is kegs and casks (Figure 1.10). Kegs typically
contain 50 L or 15.5 US gallons (58.7 L), although smaller sizes are available.
Casks usually contain 40.9 L or 1 firkin (9 imperial gal). Casks and kegs are
used to serve beer in bars or at parties where large volumes of a particular
brand of beer will be dispensed. A full US‐size keg of beer weighs about 73 kg
(160 lb); the empty keg alone weighs 13.5 kg (30 lb) (Table 1.2).
The handling of the beer and the packaging process are designed to
minimize oxygen entry. Oxygen causes staleness and off‐flavors in beer.
Because air is 20% oxygen by volume, the requirement to exclude oxygen is
technically demanding. The packages are purged with carbon dioxide before
and after filling and are sealed within seconds.
BREWING OVERVIEW 15
Figure 1.10 Kegs (straight‐sided vessels) and casks at Philadelphia Brewing.
TABLE 1.2 US Beer Packages

12 oz bottle 12 oz can 15.5 gal keg 1 firkin cask
Gross weight per liter beer 1.61 1.05 1.24 1.25 kg/L
Admit light Yes No No No
Admit oxygen Slow No Slow Yes
Recycle value per liter beer 0.01 $0.044/L Reuse Reuse
The packaging process involves unpacking the containers, rinsing and sani
tizing them, conveying them to the filling station, purging out air, filling, and
then sealing the packages. Often the beer is pasteurized just before or after
packaging or subjected to microbial filtration before packaging. Labels and
their adhesives are applied. Secondary packaging is unloaded from its pack
aging and folded into shape. The filled cans or bottles are gently loaded into
the cases, which are then sealed with adhesive and stacked on pallets. The
complexity of the packaging operation and its potential for breakdowns rival
all the rest of the brewery combined (see Figure 1.11).
Serving
Beer service can be as simple as handing the customer a bottle or can, but the
usual expectation is that the beer will be delivered in a glass. Glasses for beer
must be extraordinarily clean. Small traces of fats found on nominally clean
glassware can interfere with the desirable appearance of the head of foam.
Figure 1.11 Packaging line at Victory Brewing Company.
For this reason, special procedures are needed for cleaning beer glasses. The
beer must be served at the proper temperature and with the correct presenta
tion of foam. The elaborate rituals in some establishments for wine service
are trivial in comparison to the routine requirements for serving beer.
For economics as well as esthetics, beer is often held under pressure in
bulk containers, like kegs, transmitted through tubing called a beer line to a
dispensing valve called a beer faucet. Beer served from casks or kegs is called
draft or draught beer. Although the standards for beer from casks forbid it,
beer from kegs is driven from the keg to the tap by gas pressure, usually
carbon dioxide. The requirements for keg service include a cold locker for the
kegs, pressure tanks and regulators for the driving gas, lines that hold pres
sure and exclude permeation by oxygen, and faucets. It is often necessary to
provide chilling to the beer lines to maintain the proper service temperature
and carbonation. The entire system must be amenable to regular and thor
ough cleaning to maintain beer quality.
1.3 A SCIENTIFIC HISTORY OF BREWING
The word beer is derived from the Latin verb bibere, which means “to drink.”
But what is the true definition of beer? A modern, Western‐culture definition
of beer might be an alcoholic beverage produced from malted cereal grain,
A SCIENTIFIC HISTORY OF BREWING 17
TABLE 1.3 Traditional Beers from Around the World

Beer Country Description
Aca Peru Maize beer
Bilbil Ancient Egypt Sorghum beer, also known as Indian millet
Bi‐se‐bar Ancient Sumeria Light barley beer
Boza Ancient Babylonia Millet beer
and Egypt
Chi India Millet beer
Chibuku Southeastern Africa Sorghum beer, also made with maize and millet
Chicha South and Central Maize beer, also made with quinoa, peanut,
America cassava, palm fruit, or potato
Chiu China Wheat beer
Dolo Burkina Faso, Africa Millet or sorghum beer, flavored with sisal,
castor oil, cassia, pimento, and tobacco
Kaffir Southern Africa Sorghum beer
Kava Polynesia Dried roots of the Piper methysticum tree are
chewed, spat, and fermented
Kvas Russia Low alcoholic beer made by fermenting rye
bread
Maltøl Norway Farmhouse beer brewed with Kveik yeast
Okolehao Hawaii Fermented ti root
Pachwai India Rice beer
Pulque Mexico; Central Fermented juice of maguey agave cactus
America
Tiswin North America Maize beer
flavored with hops, and produced through fermentation. But to consider the
history of beer, the use of this modern definition severely limits our scope of
understanding. By requiring the use of “malted grains” and “hops,” we limit
the historical context for which modern beer was derived. These are the
major ingredients in modern European‐style beer, but not necessarily in all
beer. Recall from Section 1.1 that brewing beer requires the conversion of
starch into a fermentable sugar. Therefore, a more appropriate, historically
accurate definition of beer is “an alcoholic beverage derived from a source
of starch.” This seemingly simple definition of beer covers the breadth of
alcoholic beverages indigenous to regions across the world, local beers that
can vary widely from the modern European‐style beer with which we are
familiar (Table 1.3).
To understand the history of beer, we must rely upon the availability of
artifacts and documents. Presumably Paleolithic (Old Stone Age) humans
experienced an otherworldly euphoria after accidentally eating fermented
fruit or drink, with mind‐altering affects both captivating and terrifying. But
when did humans learn to harness the power of fermentation? The earliest
written documents display familiarity with beer, indicating that beer was
being brewed before there was a written language. The origins of beer lie in
prehistory.
Origins of Beer
The domestication of plants and animals was first undertaken about 12 500
years ago in what was considered the Fertile Crescent. This “cradle of civiliza
tion” spanned the region of the Middle East from the Persian Gulf to northern
Egypt and through Iraq, Syria, Lebanon, Jordan, and Israel. Agriculture made
it possible for the land to support larger communities, then cities.
There are three requirements for large‐scale beer‐making. First, there
must be a means to grow and process fermentable grains in quantity. Second,
there must be a controllable source of energy via a fireplace. Finally, there
must be appropriate brewing vessels for fermentation, such as pottery. In the
Fertile Crescent region, pottery is believed to have been invented around
8500 years ago.
The first chemical evidence of barley beer, consisting of deposits of oxalic
acid (beer stone) in pottery jars, comes from a 5500‐year‐old Bronze Age site
called Godin Tepe in present‐day Iran. Earlier evidence of a mixed fruit–grain–
honey beverage was discovered as residue in pottery from Jiahu in north central
China, dating to 9000 years ago. Very recently, analysis of several 13 000‐year‐
old microscopic starch granules recovered from stone mortars in a burial cave
at Mount Carmel in northwestern Israel suggested that the mortars had been
used to make beer. If further study confirms these preliminary findings, the
horizon for beer will have receded to the Paleolithic Age (Old Stone Age),
showing that beer was brewed (presumably on a small scale) before grains were
even cultivated as an agricultural product.
Fermentation and Science
In addition to its important function at gatherings of political revolution,
beer and other fermented beverages have played a central role in science
and technology. Because alcoholic products were embedded in societies
across the world, particularly Europe, economic pressures for consistency
and reliability were central to economic success, prompting serious study
and innovation. In the 1700s commercial innovations such as cast iron k
ettles,
steam for heating, the thermometer, and the hydrometer were directly due to
the brewing industry. Steam engines were used in brewing before they were
used in weaving.
The science behind the process of fermentation was not described until
1789. The process of making alcohol from sugar was simply referred to as the
“putrefaction of sugar.” In 1697, Georg Ernst Stahl (1659–1734), the founder
Figure 1.12 Drawing of yeast by Antonie van Leeuwenhoek in 1680 after viewing
beer through his primitive microscope. Source: Image courtesy of the National Library
of Medicine.
of the phlogiston theory of combustion, postulated that the violent activity

and heat generation associated with fermentation caused a “loosening” of
particles present in the medium; thus the formation of alcohol was simply a
process of separation. The microscopic nature of yeast cells was first recorded
by Antonie van Leeuwenhoek (1632–1723) in 1680 after examination of
fermenting beer, but the role of yeast in fermentation was still unknown
(Figure 1.12). Yeast was considered a “carrier of activity,” participating in, but
not responsible for, the separation of alcohol during putrefaction.
The alchemy theory of fermentation held firm until 1789 when Antoine
Lavoisier (1743–1794), the founder of modern chemistry, realized that during
fermentation, sugar was directly converted to carbon dioxide and ethanol.
He performed an elemental analysis of sugar, alcohol, and yeast. Significantly,
he noticed 19% nitrogen in dry yeast. Lavoisier considered fermentation to
be separation of sugar into two parts, carbon dioxide in an oxidized state and
the other, ethanol, in a reduced (deoxygenated) state. Lavoisier, being a
member of the French nobility, studied fermentation in wine rather than
beer. Also, being a nobleman, he was beheaded during the French Revolution.
Around 1803, British chemist John Dalton (1766–1844) put forward the
modern atomic theory that serves as the basis for all chemistry today. In the
period from 1803 to 1815, French academic chemists Joseph Gay‐Lussac
(1778–1850) and Louis Thenard (1777–1857) developed improved analytical
methods and used them to refine Lavoisier’s analysis of fermentation.
Nonetheless, the chemical equation for fermentation could not be deter
mined until the molecular formula of glucose was published in the 1870s.
In the seventeenth and eighteenth centuries, there was a major contro
versy in biology, spilling into related chemistry, between the mechanists and
the vitalists. Mechanists held that life processes were governed by the same
physical laws as those of inanimate matter. Vitalists held that life possessed a
special life force, or élan vital, that could not be explained by laws derived
from dead matter. Alcoholic fermentation served as a weapon for both sides
of the controversy and, ultimately, was its resolution. One argument favoring
vitalism was that many compounds that occurred in living organisms could
not be made in the laboratory from dead matter. In 1828 Friedrich Wöhler
(1800–1882) delivered a setback to vitalism by synthesizing urea, an organic
substance, from ammonium cyanate, considered dead matter. Another piece
of evidence for vitalism was that only living organisms were able to make
and use ferments, which we now call enzymes. In 1833, Anselme Payen
(1795–1871) and Jean Peroz (1805–1868) delivered another setback to vital
ism by precipitating amylase (which they called diastase) from barley malt.
They demonstrated that isolated diastase could hydrolyze starch. Several
other enzymes were found shortly thereafter. The vitalists then made a dis
tinction between simple ferment that catalyzes simple hydrolysis reactions
and organized ferment that is alive and responsible for complex reactions in
organisms.
In the 1830s improvements in light microscopes paved the way for the
study of fermentation as a biological process. From 1836 to 1838, Charles
Cagniard de la Tour (1777–1859), Friedrich Traugott Kützing (1807–1893),
and Theodor Schwann (1810–1882) used microscopes to demonstrate that
yeast is a living organism and is required for fermentation. These contribu
tions are often mistakenly attributed to Louis Pasteur.
The great chemists of the nineteenth century such as Justus von Liebig
(1803–1873), Friedrich Wöhler (1800–1882), and Jacob Berzelius (1779–
1848) vehemently opposed and ridiculed the idea that fermentation was a
life process, even at first rejecting evidence that yeast was a living organism.
Their arguments were implausible and their experimental evidence was
nonexistent. Nonetheless, the weight of their authority set the field of
biochemistry back by two decades. Ironically, 60 years later, fermentation
was achieved without intact yeast cells (but with a yeast extract).
Another argument against the mechanist approach was optical rotation of
compounds. Certain compounds, all of which originate in living organisms,
are optically active; they can rotate a plane of polarized light. The same com
pounds, when prepared synthetically, do not rotate light. The first major
insight into this phenomenon came in 1847 from the graduate thesis of Louis
Pasteur (1822–1895). Pasteur separated synthetic sodium ammonium tartrate
into two fractions, one of which rotated polarized light to the left and the
other rotated it to the right. This showed that optically active compounds can
exist in two forms, right and left handed. Living systems can selectively make
one of these, but synthetic methods invariably make a mixture of both. This
difference still has no generally accepted explanation. It may have been this
issue that led Pasteur, whose training was in chemistry and physics, to become
a founder of the field of microbiology.
Figure 1.13 An illustration in Louis Pasteur’s book, Études sur la Bière (Studies on
Beer), 1876, described the physical appearance of healthy and worn out yeast cells
during fermentation. Source: Image courtesy of the National Library of Medicine.
Pasteur was an outstanding experimentalist. He established that fermenta

tion carried out by different microorganisms produces different products,
usually giving off‐flavors to beer and wine. He convinced English brewers to
get microscopes to monitor the quality of their yeast (Figure 1.13). Pasteur
regarded fermentation as life without oxygen. He discovered the process of
pasteurization for the reduction of microbial load in wine and beer. Ultimately,
his experiments reduced the fermentation theories of the German chemists
to rubble. He further argued that fermentation is not possible without life.
But like Liebig, Wöhler, and Berzelius, Pasteur would be proven wrong; alco
holic fermentation can occur without live cells, given the right enzymes.
The final blow to vitalism, cell‐free fermentation, was discovered by lucky
accident in 1887. Eduard Buchner (1860–1917), while developing methods for
an entirely different project, ground several kilograms of brewer’s yeast in a
large mortar with fine quartz powder as an abrasive. He wrapped the result
ing paste in cloth and pressed it in a hydraulic press. Buchner called the
resulting cell‐free liquid press juice. Today we call it yeast extract or lysate.
Sugar was added to the lysate to suppress the growth of bacteria. Afterward,
Buchner noticed the formation of bubbles, which he correctly interpreted as
fermentation of the sugar by an enzyme in the yeast lysate. He called this
enzyme zymase. We now know that there are 12 enzymes involved. Evidently,
these enzymes produced by yeast performed this reaction independently of
the live cells. Fermentation was carried out by isolated enzymes in the same
way as Payen and Peroz carried out starch hydrolysis. No mysterious élan vital
was needed. Importantly, Buchner demonstrated that fermentation could be
studied by the ordinary methods of chemistry and biology.
MUSINGS ON THE HISTORY OF BEER…
“It is much more productive to study a process in chemical glassware than in

living cells.”
—Dr. Barth, chemist
“After drinking beer from said process, my neurons say otherwise.”

—Dr. Farber, biologist
Building upon Buchner’s discoveries, Arthur Harden (1865–1940) dis

covered that phosphate is a requirement of fermentation. In another key
experiment, Harden separated yeast lysate into a protein fraction that would
not go through a membrane and nonprotein fraction, which Harden called
coferment, that did pass through the membrane. Fermentation required both
fractions. We now identify coferment as NAD+, a key molecule responsible for
transfer of hydrogen in cells. This discovery led to an understanding of the
role of ATP as energy currency. The discovery of NAD+ also led to a revolu
tion in the understanding of biological oxidation processes. One of the factors
that contributed to this progress was the discovery that the fermentation
reactions are identical to those occurring in muscles when oxygen is not
available. Muscles turn chemical energy into mechanical work, making them
useful for tracking energy. In 1934 the link between glycolysis and ATP pro
duction was identified. By 1938, the fermentation reactions, now called the
glycolysis pathway, had been revealed, although some of the enzymes had not
yet been isolated. It was not until 1941 that the role of ATP as energy currency
was proposed. Many outstanding scientists made decisive contributions to
elucidating glycolysis, the first complete biochemical pathway to be revealed.
Glycolysis is often called the Embden–Meyerhof–Parnas pathway after three
of its discoverers, Gustav Georg Embden (1874–1933), Otto Fritz Meyerhof
(1884–1951), and Yakov Oskarovich Parnas (1884–1949). Glycolysis in some

form occurs in every living cell. It could be said that the discipline of bio
chemistry was born in a glass of beer.
The Scientific Method

Today, brewing is a scientific process. The term science is derived from the
Latin word scientia, meaning “to know.” The scientific method is a systematic
way of thinking about and investigating processes to generate new knowl
edge. In academic science, this might be the discovery of new enzymes and
applications, the development of new hop varieties, or the engineering of a
new aeration device. In these examples, new information or new knowledge
is generated. In brewing, this might be problem‐solving or troubleshooting, in
which needed information is identified and new information is sought to help
correct an issue.
To generate new knowledge, scientists must take a systematic and logical
approach. Often the observations made, the questions posed, and experiments
designed require creativity from the scientist, an ability to think outside of the
box. The process is creative, but the approach must be systematic. The scien
tific method involves six steps:
1. Make an observation.
2. Pose a question.
3. Generate a hypothesis and testable prediction.
4. Design and run an experiment. Record results.
5. Analyze the data. Determine whether it supports or refutes the
hypothesis.
6. Repeat the process as needed to further support or refute the
hypothesis.
Let us use troubleshooting an issue in the brewery as an example of the

scientific method.
1. Make an observation. You have noticed that fermentation stalled in the

brewery. Most beers finish at 3 °P, but this beer stopped fermenting at 6 °P.
2. Pose a question. Why did fermentation stall?
3. Generate a hypothesis and testable prediction. A hypothesis is a testable
statement. It must also be rational and based upon well‐established
facts. A prediction is a deductive consequence of a hypothesis, typically
an “if, then” statement. In this example, the hypothesis is “Fermentation
stalled because there were not enough yeast cells.” The prediction
is “If too few yeast cells were pitched before fermentation, then the
fermentation will stall.” It is important to consider that the hypothesis

may or may not be correct. And there may be additional hypotheses.
With appropriate experimentation and analysis, we can decide if the
hypothesis is supported or refuted.
4. Design and run an experiment; record results. A hypothesis must be test
able. In this example, for a subsequent brew, we triple check that yeast
is pitched at the appropriate rate ensuring that there are enough cells
for fermentation.
5. Analyze the data. If the fermentation stalls again, the hypothesis is
incorrect or refuted. Some other process change affected fermentation.
If the fermentation is now completed as normal, the hypothesis is
supported.
6. Repeat the process to further support or refute the hypothesis. The results
from a test never prove an idea as correct but rather “support the
hypothesis.” On the other hand, if a test fails and refutes the hypothesis,
then a new hypothesis and experiment are proposed. Let us assume that
after ensuring a proper yeast count, the fermentation stalls again. In this
case, the hypothesis is refuted, and additional hypotheses are generated.
What are some other issues that may cause fermentation to stall? The
scientific method and the process of troubleshooting are cyclical; it may
take several cycles of hypothesis and experiment to move closer to a
solution.
For many problems, there are multiple plausible explanations for the issue.
After generating additional hypotheses and possibilities, scientists need to
prioritize which ideas should be tested. Unfortunately, time and money
typically are major limitations to the most thorough testing, especially in a
production environment such as a brewery. Therefore, scientists must test the
most probable hypotheses while also considering good experimental design.
Good experimental design requires the following:
• A testable hypothesis.
• One or more dependent variables.
• Only one independent variable or change.
• Experimental controls.
• Statistical significance.
Clearly, if a hypothesis cannot be tested, it cannot be supported by evi

dence. For an experiment to serve as a test of a hypothesis, an outcome of the
experiment is measured. This is called the dependent variable. In the stalled
fermentation experiment described above, the dependent variable is the
measurement of the wort density during fermentation. Other measurements,
or dependent variables, that might be taken during this experiment are yeast
cell count in suspension, carbon dioxide production, and pH.
The independent variable describes what is being manipulated or changed
in the experiment. In the stalled fermentation experiment described above,
the independent variable is the yeast count in the pitch. It is the only param
eter being changed or manipulated. A successful scientific experiment must
have only one independent variable. This also applies when troubleshooting
a problem. Use of a single variable is critical because if several variables are
changed, how will we know which was responsible? To troubleshoot a prob
lem, a brewer might try to fix an issue by changing four conditions. While the
problem may have been solved, how will he or she learn from the problem
and prevent its occurrence in the future? The exact cause of the issue is still
unidentified because of a poorly designed experiment. In experimentation or
troubleshooting, only change one variable at a time.
A well‐designed experiment must be controlled. In typical experiments an
experimental group would get various levels of a certain treatment, and a
negative control group would not get the treatment under test, but its treat
ment would be otherwise identical. The two groups are compared to deter
mine the effect of the treatment. In some experiments it is useful also to
include a positive control, which is a treatment known to influence the
dependent variable. If the positive control fails to yield the expected result,
we suspect that there is something wrong with the experiment. For example,
we might study the question of whether the addition of zinc chloride increases
the fermentation rate. We would set up several flasks with identical wort
composition. To the experimental group, we could add various concentra
tions of zinc chloride solution, but to the negative control group, we could
add an equal amount of pure water. The positive control group could be
treated with yeast nutrient, known from previous experiments to increase the
fermentation rate. We place all the flasks in baths at the same temperature.
We add the same amount of the same yeast into each flask. We do all we can
to make sure that the experimental group and the two control groups are
treated identically except for the independent variable, zinc chloride. If the
positive control flasks do not ferment faster than the negative control flasks,
we would suspect that there is something wrong with the way the experiment
was run. Maybe there is a leak, or the yeast was no good. If the zinc chloride
flasks differ from the negative control flasks, it would be evidence that zinc
chloride influences the fermentation rate.
In addition to control groups in an experiment, good experimental design
includes a tightly controlled environment. Every condition of the experiment,
other than the independent variable, should be kept as precisely consistent as
possible. In studying the effect of zinc chloride on fermentation, what are
some of the environmental controls? This experiment is best controlled by
running all experiments at the same time, using the same wort, and at the same
temperature. The list continues, but the point is that only the independent
variable should be different. Any other difference could influence or change
the results. Eliminating uncontrolled variables in laboratory‐scale experi
ments can be difficult, but it is much more difficult in practical settings like a
brewery where time, space, and money are critical.
During experimentation scientists gather data, interpret results, and for
mulate conclusions. What if the experiment was only run once? What is the
significance of the experiment? For an experiment to be significant, it must
have some type of statistical probability of being correct, and it must be
repeatable by others.
Many measurements rely on a representative sample. If, for example, you
were checking package oxygen, you could only test a small fraction of the
bottles or cans. If you tested them all, you would have no beer to sell. The
packages selected for testing are the sample. For a sample to be representa
tive, it must be random. If you select 15 bottles in a row as they emerge from
the filler, you may miss a problem that emerges later in the run or that is
intermittent. If you pick the whole sample from one side of the conveyor, you
may introduce a bias into the sample that could affect the conclusion. Here, it
is best to select a representative sample of bottles randomly throughout the
production run from start to finish.
The other sampling issue is sample size. Larger samples give more accu
rate results, but they are more expensive in terms of analysis cost and lost
beer. To illustrate the effect of sample size, we will use an artificial example
involving a large bin of glass marbles, 60% of which are red and the rest blue.
Figure 1.14 shows the total percentage of red marbles as we randomly draw
marbles one by one. It takes over 100 draws to reach a steady‐state value
near 60%. Larger sample sizes give more trustworthy results, but even for a
60
percent red
40
20
0
50 100 150 200
sample number
Figure 1.14 Cumulative outcomes of marble draws.

INTRODUCTION TO BEER QUALITY 27
large sample, the outcome is subject to error. In this circumstance, the word
“error” refers to the difference between the accepted, “true,” or expected
value and the measured value. “Error” does not imply that anyone did any
thing wrong.
Throughout this book, you will have an opportunity to apply the scientific
process through troubleshooting potential problems in the brewery. Case
studies are provided in select chapters as a way to critically think about
problems that may arise in the brewing process and to propose potential solu
tions. The ability to troubleshoot, to think scientifically about problems, is one
of the greatest skills you can bring to any job.
1.4 INTRODUCTION TO BEER QUALITY
It is often said that a glass of beer is best at the source. This is unfortunately
true; beer is a perishable product whose quality slowly diminishes with time
after production. As brewers our goal is to provide as close to “brewery fresh”
beer as possible to all consumers whether on draft at the brewery or at home
from a bottle or can. With increasing competition in the brewing industry
comes a need for consistency and quality product for the consumer. If we
want to provide fresh and high‐quality beer to the consumer, we must first
define quality.
In 2014, a Brewers Association subcommittee on quality defined quality
beer as “…a beer that is responsibly produced using wholesome ingredients,
consistent brewing techniques, and good manufacturing practices, which
exhibits flavor characteristics that are consistently aligned with both the
brewer’s and beer drinker’s expectations.” In this definition, consistency is
key as is responsibility and safety. To make quality beer, a brewer must master
the brewing process, have a deep familiarity with the raw materials, and have
a solid understanding of the underlying science.
Mary Pellettieri (cited in the Bibliography) lays out three fundamental
aspects of beer quality that take the definition of quality one step further.
First, beer should be free from defect. Second, beer should be well defined
as fit for use. And finally, beer quality should match the brand values of the
company; in other words, the artistic side of brewing also represents
quality.
Quality as Freedom from Defect

Beer quality as freedom from defect is defined by laws and government regu
lations. The best‐known historical food safety and quality government regula
tion was the Bavarian Reinheitsgebot or German Purity Law, decreed in 1516.
Although not the first such regulation, it was the first to cover more than a
single city. Still in place today, this law placed strict specifications on the
production of beer, allowing only three ingredients – barley, hops, and water.
The fourth ingredient, yeast, is now included in the law, but was absent in the
original, because yeast was not understood as the causative agent of fermen
tation until the nineteenth century. It is thought that the purity law was put
into place because some German brewers used alternatives to hops, such as
gruit, and alternative cereal grains such as wheat and rye. At the time, brewers
were taxed on malt and not on beer produced, so crafty brewers could skirt
taxation by brewing with alternative sources of starch. Furthermore, the use
of wheat and rye depleted the supply for the baking industry; thus the
Reinheitsgebot protected the German economy. The far‐reaching impact was
to define a specific flavor profile for German beer with a standard of quality
still held in high esteem and tradition in Germany today.
Beer quality as freedom from defect has evolved in the United States over
the years. Today beer is defined as a food, and breweries are required by law
to produce products that are free from defects. These laws are designed to
protect consumer safety. US laws require four specific parameters to define
beer as free from defect:
1. The Tax and Trade Bureau (TTB) requires accurate reporting of fill
levels in bottles and cans.
2. The TTB also requires accurate reporting of alcohol by volume (ABV)
to within 0.3% if printed on labels.
3. The US Food and Drug Administration (FDA) requires sulfite con
centrations to be less than 10 ppm, unless specifically reported on the
package.
4. American breweries are now required by the Food Safety Modernization
Act, administered by the FDA, to follow good manufacturing practices
(GMPs) with strong recommendations for a hazard analysis and criti
cal control points (HACCP) plan. GMPs provide safety standards for
the facility, employees, and visitors to help ensure that products are
free from defect. HACCP is a system of risk assessment that evaluates
risk potential across all production processes with a focus on chemical,
physical, and biological risks.
Quality as Fitness for Use

“Fitness for use” describes quality from the perspective of the consumer. These
are the traits that drive a particular beer or brand. Establishing a d
efinition of
quality as fitness for use emphasizes consumer preferences. Often the consum
ers’ preferences are less stringent than the brewer’s. For example, variation in
slight to moderate haze might be perceptible, but otherwise disregarded by the
general consumer population. By contrast, if a slight haze is accompanied by

large particles of protein that sink to the bottom of the glass, consumer opinion
of quality may plummet. If consumer perception of quality dips into unfavora
ble territory, the brewery will lose customers. If you consistently produce beers
with high quality in fitness for use, consumers will know what to expect in your
product, potentially building brand loyalty. Those traits commonly defined
under fitness for use include flavor, shelf stability, and aspects of perception
like color, clarity, and foam. Understanding these traits, how they are influ
enced by the brewing process, and how they can change over time in finished
beer is essential for the delivery of a high‐quality product.
For each beer, a brewery should describe these traits as being “true to
type.” Being true to type means that for a given brand and style of beer, each
production lot of that beer is as similar as possible. Key aspects of the beer
such as perception and flavor should be considered before a beer is released
to market. Any defects or deviations should be subject to troubleshooting
and root‐cause analysis.
Perception Consumers first drink with their eyes. Perception, or the physical
quality, of the beer makes the first impression and can underlie the overall
reception of the beer. Beer should always be poured into an appropriate and
clean glass to fully appreciate this quality. Drinking directly from a bottle or
can obscures judgment (which in some cases might be intentional!). Specifically,
a number of metrics play a key role in the overall physical quality and
perception of the beer, metrics that influence the overall organoleptic quality
of beer, specifically color, clarity, foam, aroma, and texture.
Color – Beer color can range from light yellow to black with varying shades
of red. Generally, beer color should be appropriate to the style. A study by
Carvalho et al. demonstrated that when two identical beers are artificially
colored so that one resembles a pale beer and the other a dark beer, signifi
cant differences were found in consumers’ expectations of flavor and cost.
Clarity – Bright or clear beer is a beautiful thing. Significant effort during
production ensures a consistently clear product. Nonetheless, some styles
like wheat beers, hefeweizens, and New England IPAs are designed to be
hazy. In addition to physical appearance, haze, also called turbidity, can
alter the flavor profile of the beer. Beer haze generally results from aggre
gates of protein from barley and polyphenols from hops. Anecdotally, hazy
IPAs are said to be more flavorful than their clarified counterparts. A recent
hypothesis with supporting data from Dr. John Paul Maye has demon
strated that certain hop oils with low solubility are stabilized within haze
particles, keeping them in solution and thus changing the profile of
the product. This observation also explains why flavor profiles of beer can
be altered following filtration. The consistent haze found in certain styles is
also called permanent haze. Chill haze is a quality issue where haze parti
cles are formed at cold temperatures but disperse as the beer warms. Chill
haze that becomes worse over time is referred to as age‐dependent haze.
Foam – Beer is expected to have an attractive layer of foam, or head, that
persists during drinking. As the beer is consumed, lace or cling should gen
tly coat the sides of the glass. Foam enhances aroma as volatile compounds
are released as effervescence when the foam bubbles pop. Foam also
enhances the texture of the beer and has been shown to dampen the waves
in the beer, so it is less likely to spill.
Aroma – The aroma of beer is heavily influenced by raw material selection,
process, and handling of the beer. In addition, service temperature and car
bonation level influence aroma and consumer perception.
Texture – Beer provides different tactile sensations, typically sensed by the
trigeminal nerve. The trigeminal nerve is the main sensory nerve of the head,
innervating the face, mouth, and nasal cavity. It is responsible for sensations
of heat from peppers, the burn from alcohol, and the fizz from carbonation.
Beer is described as dry (thin) or full‐bodied, traits related to the residual
carbohydrate content of the beer remaining after fermentation.
Flavor Flavor is the greatest factor in consumer expectations. It might also

be considered an element of perception, and its impact on overall organoleptic
quality places it in high importance. A beer might look appetizing, but if it
tastes bad, the brewery’s reputation is at risk. Beer flavor is a complex synergy
of more than a thousand compounds that derive from raw materials and the
overall process. Some flavors are dominant and distinguishable in isolation,
but others fall below the limit of perception. Some flavors arise only as
combinations of multiple lesser flavors that would be difficult to distinguish
alone. To further complicate the issue, perception of flavor varies greatly
between individuals, as different people can discern different concentrations
of key flavor molecules.
In the brewery, flavors should always be matched as true to type. Flavors
not characteristic of a style are considered “off‐flavors.” Off‐flavors arise
from variations in raw materials, process, or microbial contamination. They
also develop over time as a beer ages, a process known as staling. A beer’s
exposure to oxygen, high temperatures, and mechanical agitation all affect
the flavor stability of a product.
Stability Beer flavor will start to decline the moment it leaves the brewery.
Beer served at a brewery taproom can be easily controlled, but once it leaves
the brewery in a package, its quality is much more difficult to manage. In
addition, the chemical processes that create staling off‐flavors develop more
quickly with heat. For this reason, beer has a typical shelf life of six to eight
months when kept refrigerated and shorter if kept at room temperature or
heated during summer months. Beer stability will depend on process and also
on style. Stale beer does not have a single characteristic flavor but rather a
suite of off‐flavors depending on the style, age, and handling.
As a beer ages, hop bitterness and flavor decline steadily. Key esters may be
reduced. The breakdown of free amino nitrogen (FAN) via Strecker degrada
tion can create off‐flavors such as sweetness with unpleasant notes of floral,
toffee, meat, or bourbon. Oxidation leads to sherry‐like aromas and ultimately
cardboard flavors. As hop compounds oxidize, they yield ribes aromas, often
described as catty, tomato leaves, or blackcurrant. The oxidation of lipids leads
to the formation of cardboard or paper flavors. Once oxidation and flavor stal
ing occur, there is no recovery. To forestall staling, best brewing practices mini
mize oxygen uptake throughout the brewing process, including packaging, to
prolong beer stability. And of course, beer must be free from microbial con
tamination of wild yeast and bacteria. Microbial contamination in a packaged
product can lead to off‐flavors or overcarbonation.
BEER QUALITY AND SCHLITZ BEER
At the start of the twentieth century, the Joseph Schlitz Brewing Company
(established in Milwaukee, WI, in 1849) was the largest producer of beer
in the United States. Their famous tagline was “The beer that made
Milwaukee famous.” But the company suffered great decline in the 1970s.
A few years earlier, at the edge of innovation, Schlitz championed a new
production process called accelerated batch fermentation (high tempera
ture fermentation) to increase yield and improve efficiency. To lower the
cost of raw materials, Schlitz substituted corn syrup for some of the
malted barley and hop pellets instead of whole hops (a practice that is
now widely accepted). Clarity issues were resolved by the addition of a
clarifier, possibly papain. The resulting foam issue was resolved by add
ing propylene glycol alginate (PGA). Looking back on it today, it seems
as though a business decision was made to cut costs and allow the quality
to decline in small increments that the consumers would not notice. This
approach is derisively called “salami slicing.” An unexpected interaction
between the clarifier and the PGA sometimes resulted in formation of
clouds of snowy particles after a few months in the packages. Schlitz
management was slow to deal with the issue. Customers found the bits to
be unacceptable. Ultimately Schlitz returned to its original recipe, but it
was too late. Sales never recovered.
The downfall of Schlitz is an unfortunate example of how quality as
fitness for use was not given adequate consideration in process changes
and innovations to improve efficiency. Furthermore, problem‐solving
strategies and attention to quality management were seemingly inade
quate with the result that poor quality product entered the market.
Quality as Art
While adherence to beer quality as freedom from defect is required in all
breweries by law, there is more flexibility in quality as fitness for use. But
what about the art of brewing? There are certainly small breweries who relish
the benefits of being small scale such as faster beer turnover, taproom‐only
beers, and the ease of innovation. Here, brewers may highly value the oppor
tunity to use new ingredients, to form exciting collaborations, and to push the
boundaries of traditional brewing practices. Is there quality in creativity?
Absolutely. Here quality as art is defined by how each beer matches the
brand values of the business. In this case, the leadership team at the brewery
should take time and care to define the overall brand values of the business,
clearly documenting them and sharing them with all employees. In addition
to beers being “true to type,” they should also be “true to brand.” Then as
each new product or innovation is planned, the team can assess its compati
bility with the overall brand of the company. In this sense, the quality of art
and creativity help define the quality of the beer.
CHECK FOR UNDERSTANDING
1. What is the definition of beer and how does it differ from other alcoholic
beverages?
2. Arrange the following units in order of use from start to finish, identify
the brewing step in which it is used, and describe the key purpose(s) of
the step in beer production.
Lauter tun Fermenter Centrifuge

Plate chiller Mash tun Mill
Whirlpool Boil kettle Bright tank
3. What are the four major ingredients in beer? At which stage(s) of the
brewing process is each added? Discuss all areas for variation.
4. Describe the major process inputs during each step of beer production
(i.e. time, temperature, etc.)
5. What are the most important quality goals for packaging operations?
6. Where and when were the origins of beer?
7. What were the three major technological advances that made routine
beer brewing possible?
8. What were some of Louis Pasteur’s major contributions to brewing science?
CASE STUDY 33
9. What is a controlled experiment? Discuss the difference between an

independent and a dependent variable.
10. What are some similarities and differences between the scientific method
and troubleshooting?
11. Why is it critical to change only one variable at a time during an experi
ment or while troubleshooting?
12. What government agencies regulate the beer industry in the United
States? By law, what metrics must brewers report?
13. Define the Reinheitsgebot and describe its influence on beer quality.
14. Quality is in the eye of the beer holder. What is meant by this statement?
15. What is meant by the phrase “true to type,” and how would you incorpo
rate it into a brewery?
16. You overheard someone at a bar say, “Hazy beer is poor quality beer.”
Agree or disagree and explain your position.
17. Describe some of the key changes in flavor during beer staling and
comment on their causes.
CASE STUDY
A brewery has made the same hefeweizen for years. But in the last several
production batches, flavor differences have been noted by a series of trained
panelists, particularly an increase in isoamyl acetate (banana) and an increase
in higher alcohols (unpleasant heat from alcohol). In thinking carefully about
what changes may have occurred that could have caused the flavor change,
the Director of Quality realized a new sound system was recently installed in
the brewery. Several speakers and a subwoofer were placed about a meter
from the fermentation tanks, and since installation, the staff enjoyed listening
to music throughout the day. In reviewing production records and sensory
notes, the Quality Director realized that the changes in flavor corresponded
to the date of the speaker installation. The Director then tried to explain to
the Operations Manager that the music could be affecting fermentation, but
the Manager argued that the music was good for employee productivity.
The Director then decided to conduct an experiment with four hefeweizen
fermentations in the laboratory. Two were subjected to electro‐swing music
via a waterproof speaker and two were kept in a quiet corner of the labora
tory. Fermentation rates were tracked each day by measuring the beer d ensity.
When fermentation was complete, the same sensory panel evaluated the
f lavors in the finished beers. Analysis of the data revealed that the two sam
ples subjected to music fermented faster. They reached terminal gravity a day
sooner, and the sensory panel noted an increase in banana flavor and alcohol
burn as compared with the quiet fermentation. These results convinced to
Operations Manager to remove the speakers from the fermentation cellar.
CASE STUDY QUESTIONS
1. What was the observation that prompted this scientific experiment? What
was the hypothesis? What was the prediction statement?
2. What were the independent and dependent variables?
3. Describe how this experiment was controlled. Are there any other controls
you might include in the experiment?
4. How confident are you in the results of this experiment?
5. How could the experiment be improved?
BIBLIOGRAPHY
Bamforth C. 2003. Beer Tap into the Art and Science of Brewing, 2nd ed. Oxford
University Press. ISBN 978‐0‐19‐515479‐5.
Barnett JA. 1998. A history of research on yeasts 1: work by chemists and biologists
1789–1850. Yeast 14:1439–1451.
Barnett JA. 2003. A history of research on yeasts 5: the fermentation pathway. Yeast
20:509–543.
Barth R. 2013 The Chemistry of Beer: The Science in the Suds. Wiley. ISBN
978‐1‐11867497‐0.
Barth R. 2015. The role of alcoholic fermentation in the rise of biochemistry. In Barth
R, Benvenuto M. (editors). Ethanol and Education: Alcohol as a Theme for
Teaching Chemistry. American Chemical Society. ISBN 978‐0‐8412‐3059‐0. Chap.
3. p. 25–46.
Briggs DE, Boulton CA, Brookes PA, Stevens R. 2004. Brewing Science and Practice.
CRC. ISBN 0‐8493‐2547‐1.
Carvalho FR, Moors P, Wagemans J, Spence C. 2017. The influence of color on the
consumer’s experience of beer. Front. Psychol. 8:2205–2214. doi:10.3389/
fpsyg.2017.02205.
Dalgliesh CE. 1977. Flavour Stability. Proc. Eur. Brew. Conv. Congr. Amsterdam. DSW.
p. 623–659.
Eßlinger H, Editor. 2009. Handbook of Brewing Processes, Technology, Markets.
Wiley‐VCH. ISBN 978‐3‐527‐31674‐8.
Bibliography 35
Hornsey IS. 2012. Alcohol and its Role in the Evolution of Human Society. RSC.
ISBN 978‐1‐84973‐161‐4. p. 89–111.
Liu L, Wang J, Rosenberg D, Zhao H, Lengyel G, Nadel D. 2018. Fermented beverage
and food storage in 13,000 y‐old stone mortars at Raqefet Cave, Israel: investigat
ing Natufian ritual feasting. J. Archaeol. Sci. Rep. 21:783–793.
McGovern PE. 2009. Uncorking the Past. University of California Press.
ISBN 978‐0‐520-25379‐7.
Pasteur L. 1879. Studies on Fermentation. Translation Faulkner F, Robe DC. Reprinted
BeerBooks.com. ISBN 0‐9662084‐2‐0. p. 148.
Pellettieri M. 2015. Quality Management Essential Planning for Breweries. Brewers
Publications. ISBN 978‐1‐938469‐15‐2.
Sauret A, Boulogne F, Cappello J, Dressaire E, Stone HA. 2015. Damping of liquid
sloshing by foams. Phys. Fluids. 27:022103.
Spedding G. Best Practices Guide to Quality Craft Beer. Brewers Association. Edu
cational Publications. https://www.brewersassociation.org/educational‐publications/
best‐practices‐guide/
Chapter 2
CHEMISTRY FOR BREWING
Chemistry is the science of matter. During beer production, we are most

interested in the substances in beer, its raw materials, and its processing aids
and in the equipment used to make it. In many instances, substances interact
to form new substances, processes termed chemical reactions. In most chemi-
cal reactions, energy is exchanged. Hydrolysis of starch to sugar during
mashing, isomerization of hop alpha acids during boiling, production of
ethanol and carbon dioxide during fermentation, and even the formation
of haze particles in packaged beer are examples of chemical reactions.
Understanding the principles of chemistry helps the brewer control beer pro-
duction and effectively troubleshoot any issues that may arise.
2.1 ATOMS
Chemistry is largely governed by the interactions of particles with electrical

charges, positive and negative. A pair of particles that are both positively
charged or negatively charged repel one another, that is, they experience a
force that drives them apart. A pair of particles with opposite charges, one posi-
tive and one negative, experience an attractive force that pulls them together.

37
38 CHEMISTRY FOR BREWING
Atoms, Elements, and Atomic Structure

Matter is organized into atoms. An atom is the smallest, most fundamen-
tal unit of bulk matter. There are about 100 different types of atoms, each
representing an element. Of these elements, 13 are of primary importance
in brewing, 6 of which account for nearly every atom in every compound.
These are hydrogen, carbon, oxygen, nitrogen, sulfur, and phosphorus. The
elements and, by extension, their atoms are represented by symbols made
up of letters of the Latin alphabet, that is, the same alphabet you are read-
ing now. The symbols are not merely abbreviations; they are used to make
pictorial representations of the underlying atomic structures of substances.
The symbol for an element consists of a capital letter, sometimes followed
by a lowercase letter. Not coincidentally, the six elements mentioned
above have one‐letter symbols. Table 2.1 shows the names, symbols,
and other information that we will discuss below for the 13 elements of
primary importance.
Atoms are not featureless balls; they have an internal structure. The two
main parts of an atom are the nucleus and the electrons. The nucleus has a
positive electrical charge and accounts for more than 99.9% of the mass of an
atom. The size of the nucleus is so small that we can think of it as virtually a
geometric point marking the center of the atom. The electrons, which have a
negative charge, surround the nucleus. The opposite charges of the nucleus
and the electrons give rise to a force holding the electrons near the nucleus.
The electrons orbit about the nucleus, behaving like a cloud of negative
charge; the extent of their travels, the size of the cloud, defines the size of the
atom, as shown in Figure 2.1.
TABLE 2.1 Elements

Molar Mass
Name Symbol Atomic Number Valence electron (g/mol) Valency
Hydrogen H 1 1 1.008 1
Carbon C 6 4 12.011 4
Nitrogen N 7 5 14.007 3
Oxygen O 8 6 15.999 2
Sodium Na 11 1 22.990 1
Magnesium Mg 12 2 24.305 2
Aluminum Al 13 3 26.982 3
Phosphorus P 15 5 30.974 3, 5
Sulfur S 16 6 32.066 2, 6
Chlorine Cl 17 7 35.453 1
Calcium Ca 20 2 40.078 2
Iron Fe 26 8 55.845 2, 3, 6
Copper Cu 29 11 63.546 1, 2, 4
ATOMS 39
nucleus
electron cloud
Figure 2.1 Atom.
1–8
electrons
1–8
electrons
1–2
electrons
Figure 2.2 Electron periods.
The nucleus also has distinct properties; it contains positive particles

called protons and uncharged (neutral) particles called neutrons. Protons
and neutrons have roughly the same mass, which is about 1800 times that
of an electron. The number of protons in an atom is called its atomic
number. The atoms of a particular element have a particular atomic
number, shown in Table 2.1. The positive charge on a proton exactly
balances the negative charge on an electron. An atom that has the same
number of protons and electrons is electrically neutral. It is possible for
atoms of the same element to have different numbers of neutrons.
Atoms that contain an equal number of protons but different numbers of
neutrons are called isotopes.
Electrons exhibit unfamiliar behavior when bound to atoms. They can only
take certain values of energy. These permitted values are called energy levels.
When an electron has an energy defined by a particular energy level, we say
that the electron is in that energy level. The electrons in low energy levels are
close to the nucleus and require a large amount of energy to pull them out of
the cloud and away from the atom. Electrons in higher energy levels are far-
ther from the nucleus and easier to remove from the atom. An unexpected
property of energy levels is that they can accommodate only a limited num-
ber of electrons. For example, the lowest energy level in an atom holds no
more than two electrons. Any additional electrons go into the next higher
energy level, which can hold no more than eight. The concept of electron
energy levels is depicted in Figure 2.2. The energy levels have sublevels.
Sometimes the sublevels of one level overlap those of another. We will group
the accessible levels/sublevel into groupings termed periods. The maximum
numbers of electrons that the first four periods can accommodate are given
in Table 2.2.
TABLE 2.2 Electron Period Capacities

Period Capacity
1 2 electrons
2 8
3 8
4 18
If we were to load an atom with electrons one by one, each electron would
ordinarily go into the lowest available period. For example, carbon has an
atomic number of 6; thus an atom of carbon has six protons and six electrons.
The first two electrons are in the first period; the remaining four are in the
second period. The highest occupied period is called the valence period. The
electrons in it are valence electrons. The rest of the atom, including the lower‐
period electrons and the nucleus, is called the core. Carbon has two core
electrons and four valence electrons.
Periodic Table
It takes a very large amount of energy to remove a core electron, so core
electrons are not usually involved in chemical reactions. The number of
valence electrons in a neutral atom (one with the same number of electrons
as protons) is a key factor that determines the chemical behavior of the atom.
This number is so important that the periodic table, which is the standard
tabular arrangement of the elements, is organized in columns called groups,
which can be used to infer the number of valence electrons.
The periodic table, shown in Figure 2.3, is a listing of all known elements
organized primarily by atomic number (number of protons). The upper part
of the table has seven rows, representing the periods, arranged in 18 columns
called groups. There are two additional rows shown at the bottom. These rows
actually belong in the gaps between elements 56 and 71 in the sixth period
and between elements 88 and 103 in the seventh period. There are some other
complications, but fortunately our elements of interest, with the exceptions of
iron (Fe: 26) and copper (Cu: 29), are confined to elements 1–20, whose
behavior with respect to the periodic table is relatively straightforward. These
most important atoms fall into 1 of 8 columns (1A through 8A), which are
considered the main groups. In the main groups, the number of electrons in
the valence period is the same as the group number. For example, oxygen is
in group 6A and contains 6 valence electrons. Carbon is in group 4A and has
4 valence electrons. Like oxygen, sulfur is also in group 6A; thus it also
contains 6 valence electrons.
1A 8A
1 2.2 2
H He
1.008 4.003
Hydrogen 2A 3A 4A 5A 6A 7A Helium
3 1.0 4 1.6 5 2.0 6 2.6 7 3.0 8 3.4 9 4.0 10
Li Be B C N O F Ne
6.941 9.012 10.811 12.011 14.007 15.999 18.999 20.180
Lithium Beryllium Boron Carbon Nitrogen Oxygen Fluorine Neon
11 0.9 12 1.3 13 1.6 14 1.9 15 2.2 16 2.6 17 3.2 18
Na Mg Al Si P S Cl Ar
22.99 24.31 26.98 28.09 30.97 32.066 35.453 39.948
Sodium Magnesium Aluminum Silicon Phosphorus Sulfur Chlorine Argon
19 0.8 20 1.0 21 1.4 22 1.5 23 1.6 24 1.7 25 1.6 26 1.8 27 1.9 28 1.9 29 1.9 30 1.6 31 1.8 32 2.0 33 2.2 34 2.6 35 3.0 36 3.0
K Ca Sc Ti V Cr Mn Fe Co Ni Cu Zn Ga Ge As Se Br Kr
39.10 40.08 44.96 47.87 50.942 51.996 54.938 55.845 58.933 58.693 63.55 65.39 69.723 72.61 74.922 78.96 79.904 83.80
Potassium Calcium Scandium Titanium Vanadium Chromium Manganese Iron Cobalt Nickel Copper Zinc Gallium Germanium Arsenic Selenium Bromine Krypton
37 0.8 38 1.0 39 1.2 40 1.3 41 1.6 42 1.3 43 1.9 44 2.2 45 2.3 46 2.2 47 1.9 48 1.7 49 1.8 50 2.0 51 1.6 52
25 2.1 2.1 53 2.7 54 2.6
Rb Sr Y Zr Nb Mo Tc Ru Rh Pd Ag Cd In Sn Mn
Sb Te I Xe
85.47 87.62 88.91 91.22 92.91 95.94 98 101.07 102.91 106.42 107.87 112.41 114.82 118.71 121.76
54.94 127.60 126.90 131.29
Rubidium Strontium Yttrium Zirconium Niobium Molybdenum Technetium Ruthenium Rhodium Palladium Silver Cadmium Indium Tin Antimony Tellurium
Manganese Iodine Xenon
55 0.8 56 0.9 71 1.3 72 1.3 73 1.5 74 2.4 75 1.9 76 2.2 77 2.2 78 2.3 79 2.5 80 2.0 81 1.6 82 1.9 83 2.0 84 2.0 85 2.2 86 2.2
Cs Ba Lu Hf Ta W Re Os Ir Pt Au Hg Tl Pb Bi Po At Rn
132.91 137.33 174.97 178.49 180.95 183.84 186.21 190.23 192.22 195.08 196.97 200.59 204.38 207.2 208.98 209 210 222
Cesium Barium Lutetium Hafnium Tantalum Tungsten Rhenium Osmium Iridium Platinum Gold Mercury Thallium Lead Bismuth Polonium Astatine Radon
87 0.8 88 0.9 103 1.3 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118
Fr Ra Lr Rf Db Sg Bh Hs Mt Ds Rg Cn Nh Fl Mc Lv Ts Og
223 226 262 267 268 269 270 269 278 281 280 285 286 289 289 293 294 294
Francium Radium Lawrencium Rutherfordium Dubnovium Seaborgium Bohrium Hassium Meitnerium Darmstadtium Roentgenium Copernicium Nihonium Flerovium Moscovium Livermorium Tennessine Oganesson
atomic number electronegativity 57 1.1 58 1.1 59 1.1 60 1.1 61 62 1.2 63 64 1.2 65 66 1.2 67 1.2 68 1.2 69 1.2 70
1 2.2
La Ce Pr Nd Pm Sm Eu Gd Tb Dy Ho Er Tm Yb
138.90 140.12 140.91 144.24 145 150.36 151.96 157.25 158.92 162.50 164.93 167.26 168.93 173.04
H symbol Lanthanum Cerium Praseodymium Neodymium Promethium Samarium Europium Gadolinium Terbium Dysprosium Holmium Erbium Thulium Ytterbium
1.008 89 1.1 90 1.5 91 1.5 92 1.7 93 1.3 94 1.3 95 96 97 98 99 100 101 102
Hydrogen atomic molar mass Ac Th Pa U Np Pu Am Cm Bk Cf Es Fm Md No
nonmetal (g/mol) 227 232.04 231.04 238.03 237 244 243 247 247 247 252 257 258 259
metal Actinium Thorium Protactinium Uranium Neptunium Plutonium Americium Curium Berkelium Californium Einsteinium Fermium Mendelevium Nobelium
metalloid
Figure 2.3 Periodic table of the elements.
41
Most periodic tables include useful descriptive information about each

element. The elemental symbol and atomic number are invariably provided.
The periodic table in Figure 2.3 also includes the full elemental name, atomic
molar mass (g/mol), electronegativity, and color coding showing metallic
character, as shown in the key at the lower left. The arrangement of elements
by atomic number within the periodic table relates to their physical and
chemical properties. One major division is the metals, shown in Figure 2.3
with blue backgrounds, and the nonmetals, shown with orange backgrounds.
The metalloids, with green backgrounds, are placed in between, possessing
some properties of metals and some of nonmetals. Hydrogen, at the top left,
seems misplaced as a nonmetal; its placement in this sense is governed by the
need for one electron to fill its valence period, like the group 7A elements.
The valence electrons in metals are loosely bound; metal chemistry is dom-
inated by a tendency to lose electrons. The loosely bound electrons in metals
can move about, carrying electric charge and energy. This accounts for the
familiar metallic properties like conduction of electricity and heat. Even
metallic luster, chemistry jargon for shininess, and ductility (ability to deform
without shattering) results from the mobility of the valence electrons.
Nonmetals hold their electrons tightly and lose them only with difficulty.
Many nonmetals tend to gain electrons.
If a single group (vertical column) of elements is selected, as we move
down the group an additional layer of core electrons in each succeeding
period (row) is added. The valence electrons are farther from the nucleus. For
example, starting with hydrogen in group 1 and moving down to francium, the
valence electron of lithium is farther from the nucleus than that of hydrogen;
that of sodium is farther still, as so it goes with each succeeding element as we
move down. The more distant electrons are more loosely bound, hence easier
to remove. In the case of group 1 elements, whose chemistry is dominated by
removing electrons, reactivity increases with placement lower on the table.
For example, hydrogen does not react with water at all; lithium reacts visibly
with warm water; sodium reacts violently even with cold water; and potassium
reacts explosively with water at any temperature.
In group 7, the elements are nonmetals whose reactivity is characterized by
gaining electrons. The elements at the top of the chart accommodate extra
electrons in periods that are close to the nucleus. Further down the table, the
electrons are acquired further away from the nucleus. Because the distance
between the valence level and the nucleus is smaller in elements at the top of
the chart (i.e. fluorine), electrons are quickly acquired with high energy. As
we move down from fluorine to chlorine and then to bromine, the reactivity
decreases. Fluorine has such an extreme tendency to grab an electron to fill
its valence level that it is dangerous to handle.
For the first 20 elements, the main group number (i.e. 7A) is equal to the
number of valence electrons in the neutral atom. Elements in group 8A have
a filled valence level. This group, called the noble gases, shows little tendency
ATOMS 43
to engage in chemical reactions, even at high temperature. Helium and argon

are often used as blanketing gases to protect metal objects from air during
high temperature welding.
If a main group atom is made to fill (or empty) its valence period, it shows
extra stability, similar to the noble gases. For example, sodium (Na) is element
11. Its configuration is 2|8|1, with one electron in the valence period. If we can
induce the sodium atom to give up its single valence electron forming a positive
ion symbolized as Na+, it would have a 2|8 configuration identical to that of
neon (Ne). If an ion is formed, atoms in the main groups generally take the
most energetically favorable approach to gaining or losing electrons. If the
valence shell has fewer than four electrons, it is more energetically favorable to
lose the electrons. If the valence period has more than four electrons, it is more
energetically favorable to gain the electrons. The expected behavior of main
group elements is to react to lose, gain, or share electrons to give a configura-
tion like that of a nearby group 8 element. This is called the octet rule. Sharing
electrons results in covalent bonds, discussed in Section “Covalent Bonds.”
An atom that has gained or lost one or more electrons is called an ion
(Figure 2.4). If an atom gains one or more electrons, the atom becomes neg-
atively charged. If an atom loses one or more electrons, the atom becomes
positively charged. The charge on an ion is displayed as a superscript. If
multiple electrons are gained or lost, the number is included. For example,
the ion of O is O2−. The ion of Na is Na+.
–1 –1
–1 –1
–1 –1
–1 +8 –1 –1 –1 +8 –1 –1
–1 –1
–1 –1
O –1
O2– –1
(A)
–1
–1 –1
–1 –1 –1 –1
–1 –1 +11 –1 –1 –1 –1 +11 –1 –1
–1 –1 –1 –1
–1 –1
Na Na+
(B)
Figure 2.4 (A) Oxygen atom and oxide ion. (B) Sodium atom and sodium ion.
2.2 BONDING AND COMPOUNDS
Atoms stick to one another by forces called chemical bonds. The bonded
atoms have a lower potential energy than the separated atoms; otherwise
there would be no bond. Conversely, breaking a bond requires energy. This
amount of energy is called the bond energy. When atoms of different e lements
form bonds, new substances called compounds are formed. A compound is a
substance made up of more than one element. The relative amounts of each
element in a compound are fixed. For example, the elemental composition of
water is always 88.8% oxygen and 11.2% hydrogen by mass, whether the water
comes from the cytoplasm of a yeast cell or from the outer moons of Saturn.
This is because the atoms combine in fixed amounts, in the case of water, one
atom of oxygen to two atoms of hydrogen, yield the familiar formula H2O.
A mixture, by contrast, contains more than one substance, each called a
component. The substances can be elements or compounds, but they are not
chemically bound to one another, so the mixture has no fixed composition.
Oxygen and hydrogen are colorless, odorless gases that can be mixed in any
proportion, from 100% oxygen to 100% hydrogen (WARNING: mixtures
between 4 and 95% hydrogen in oxygen by volume are explosive). The behav-
ior and properties of the mixture are intermediate between those of the com-
ponents. For example, if 10 g each of hydrogen (density = 0.08 g/L at 1 atm
pressure and 25 °C) and oxygen (density = 1.38 g/L) are mixed, the mixture
would be a colorless odorless gas with a density of 0.15 g/L. If the mixture is
placed in a very strong vessel and ignited, after a dangerously violent reac-
tion, all of the oxygen is consumed, 11.3 g of water, a liquid whose density is
998 g/L, is produced, and 8.7 g of hydrogen remains. In this scenario, the num-
ber of hydrogen and oxygen atoms is the same before and after the reaction.
Some became bound together in water, while some remained as elemental
hydrogen. The mass of the system before and after the reaction (20 g) is
unchanged; this is called the law of conservation of matter. The properties of
the product, water, are completely different from those of hydrogen, oxygen,
and the mixture. Several key points are illustrated in this scenario. No matter
how much of each reactant is initially available, the elemental composition of
the product is not affected. The properties of a compound are not related in
any simple way to those of the elements that make it up. In a chemical reac-
tion some or all of the starting materials are used to produce new compounds.
The number and types of atoms are not changed in a chemical reaction.
Ionic Bonds
The simplest type of chemical bond is the attraction between ions (charged
particles) of opposite charge. Sodium ions, Na+, are attracted to chloride ions,
Cl−, because of their opposite charges. This force of attraction is called an
ionic bond. To maintain overall charge balance, there must be the same
BONDING AND COMPOUNDS 45
Figure 2.5 Sodium chloride model. Green: chloride ion. Gray: sodium ion.
amount of positive charge as negative charge – hence the same number of

sodium ions as chloride ions. The sodium and chloride ions form a new
substance called sodium chloride (NaCl) that does not resemble the original
elements, sodium and chlorine, at all.
The strength of an ionic bond increases with the amount of charge and
decreases with the center‐to‐center distance between the ions. Small ions that
can get very close to one another form strong bonds. Big polyatomic ions
form weak ionic bonds. Compounds whose atoms are held together by ionic
bonds are called ionic compounds. Most of the substances that lend character
to brewing water are ionic compounds.
The ions in ionic compounds take up positions that balance the attractions
of the oppositely charged ions with the repulsions of the like charged ions.
The result is a specific three‐dimensional pattern of ions to form a crystal.
Figure 2.5 shows the crystal structure of sodium chloride. Ionic crystals are
usually brittle; they cannot change shape without moving the ions out of
their optimal positions, so they usually break instead. When an ionic com-
pound melts or is dissolved in water, the crystal structure is disrupted. Most
ionic compounds are high‐melting solids, but it is possible to make very large
polyatomic ions yielding ionic compounds that are liquid at or near room
temperature.
The principle of charge balance governs the formulas of ionic compounds.
There must be the same amount of positive charge as negative charge. For
example, aluminum oxide, a compound of aluminum ions (Al3+) and oxide
ions (O2−), has the formula Al2O3, giving a +6 charge from the two aluminum
ions and a −6 charge from the three oxide ions. The formulas Al4O6 or Al6O9
fit the principle of charge balance, but it is conventional practice to simplify
the formulas of ionic compounds to the lowest whole number subscripts.
INORGANIC NOMENCLATURE: COMPOUNDS NAMED
AS IONIC
1. In naming, a compound is treated as ionic if it has a metal and a

nonmetal or if it includes a polyatomic ion.
2. The name of an ionic compound is the name of the positive ion
followed by that of the negative ion, leaving off the word “ion.”
3. One‐atom positive ions of the main group elements usually take a
charge equal to the group number. In this case, the name of the ion is
just that of the element: Na+ sodium ion and Ca2+ calcium ion.
4. Ions of elements that have more than one positive charge (a common
situation for transition elements like iron and copper) are named
with the charge shown as a Roman numeral in parentheses: Fe3+,
iron(III) ion, and Cu+, copper(I) ion.
5. There is an older system of naming positive ions of elements that
can take more than one charge. The name is constructed from the
Latin stem with the suffix ‐ous to indicate the lower charge and ‐ic
to indicate the higher charge, Cu+ = cuprous ion. Cu2+ = cupric ion
and CuCl2 = cupric chloride. This system is no longer approved by
chemists, but it is still sometimes used in trade.
6. Single‐atom negative ions take a suffix ‐ide, often with the end part
of the element name dropped (‐ine, ‐ogen, ‐orous, etc.): O2− = oxide
ion and Cl− = chloride ion.
7. Some ions, called polyatomic ions, have more than one atom bound
together by covalent bonding as discussed in the next subsection.
These have an irregular pattern of names shown in Table 2.3.
8. Numerical prefixes (di‐, tri‐, etc.) are not used unless they are part of
the name of one of the ions.
TABLE 2.3 Polyatomic Ions

Formula Name
CH3CO2− Acetate ion
NH4+ Ammonium ion
CO32− Carbonate ion
HCO3− Bicarbonate ion
OH− Hydroxide ion
NO3− Nitrate ion
NO2− Nitrite ion
C2O42− Oxalate ion
O22− Peroxide ion
PO43− Phosphate ion
HPO42− Hydrogen phosphate ion
H2PO4− Dihydrogen phosphate ion
SO42− Sulfate ion
HSO4− Bisulfate ion
SO32− Sulfite ion
HSO3− Bisulfite ion
O2− Superoxide ion
Covalent Bonds
An atom that needs one or more electrons to complete its valence period
can share electrons with another atom. The electrons are shared between
atoms. Hydrogen has one valence electron; it needs one more to complete its
first period. Chlorine has seven valence electrons; it also needs one electron
to complete its valence period. Each atom can provide an electron to a
shared pair. The shared pair is localized to some extent between the atoms,
and it binds them together in a covalent bond, as shown in Figure 2.6.
The resulting particle containing one chlorine atom and one hydrogen atom
is a molecule of hydrogen chloride. The forces holding the atoms together in
a molecule are much stronger than any forces between different molecules.
Covalent bonding is prevalent in nonmetal elements, but metals can also
form covalent bonds.
To help keep track of the valence electrons in covalent (and ionic) bonds, we
can use Lewis dot diagrams, named after G.N. Lewis, a founder of the shared
pair concept. In a Lewis dot diagram, we show the core of each atom with its
element symbol surrounded by dots representing the valence electrons.
Figure 2.7 shows Lewis dot diagrams for several elements. The number of elec-
trons that an element shares is called the valency of that element. For many
nonmetals, the usual valency is equal to 8 minus the group number. Some ele-
ments in the third or higher periods have several common valencies, usually
including the group number itself. Common valencies are given in Table 2.1. If
a single electron pair is shared, this is a single bond. If two or three pairs of
electrons are shared, these are double or triple bonds. Only atoms of carbon
(C), oxygen (O), nitrogen (N), sulfur (S), and phosphorus (P) are routinely
involved in the formation of multiple bonds.
Cl H
Figure 2.6 Covalent bond.
Figure 2.7 Lewis dot diagrams.

H H
H O H O C O H C C O H
H H
(A) (B) (C)
Figure 2.8 Covalent bonding in compounds: (A) water, (B) carbon dioxide, and
(C) ethanol.
The concepts of bonding and of compounds are closely related but not
identical. It is common for atoms of the same element to form bonds and to
exist in the form of molecules. Oxygen, nitrogen, and chlorine form two‐atom
molecules, sulfur forms eight‐atom ring‐shaped molecules, and one form of
phosphorus exists as four‐atom molecules. Although there are bonds that do
not form compounds, for a compound to exist, atoms of one element must be
chemically bonded to those of another element.
Hydrogen has a valency of 1; oxygen has a valency of 2. The most common
compound of these elements is water: H─O─H. Here a dash represents a
shared pair of electrons, that is, a single covalent bond. Hydrogen and oxygen
can also form hydrogen peroxide, H─O─O─H, which also satisfies the valen-
cies of hydrogen and oxygen. Hydrogen peroxide is less stable than water; it
decomposes slowly under normal conditions. What about H─O─O─O─H?
This compound, called trioxidane, is very unstable.
The Lewis dot diagrams in Figure 2.8 demonstrate electron sharing in
water, ethanol, and carbon dioxide, all of which are significant components in
beer. This method of representing compounds more clearly demonstrates
the filling of valence periods for each atom. The overlapping circles show
the allocation of electrons; shared electrons are allocated to two atoms. In
Figure 2.8C, the hydrogen atoms (red circles) get two valence electrons, and
the carbon atoms (blue circles) and oxygen atom (green circle) get eight.
The dot diagram of water, Figure 2.8A, shows that two pairs of electrons
on the oxygen atom are shared with hydrogen atoms and two pairs belong
exclusively to the oxygen atom. The pairs of electrons that are shared
between two atoms are called bonding pairs; those that are not shared are
called unshared pairs (sometimes called lone pairs). Although the unshared
pairs do not participate in bonding, they can have important effects on the
geometry of the molecule. The diagram of carbon dioxide (Figure 2.8B)
shows that each oxygen atom shares two pairs of electrons with the carbon
atom. This arrangement is called a double bond. Carbon has a valency of
four, which is satisfied in carbon dioxide with two double bonds. Figure 2.8C
shows ethanol, also called ethyl alcohol, or just “alcohol” in which each
carbon atom has four single bonds.
INORGANIC NOMENCLATURE: BINARY COMPOUNDS

OF NONMETALS
Binary compounds are those with two elements. The binary compounds
of nonmetals have their own naming system, because they do not have
ions that are easily described by charge balance. Many of these com-
pounds have well‐established non‐systematic names. Compounds with
C─C or C─H bonds are called organic compounds; they follow yet
another naming system.
1. Each element is named with a prefix giving the number of atoms of

that element in a molecule, as shown in Table 2.4.
2. The element with the lower electronegativity is mentioned first.
The element with the higher electronegativity (Figure 2.3) gets an ‐ide
suffix.
3. The mono‐ prefix is only used when some other compound
with the same elements is better known: CO = carbon
m onoxide. PCl 3 = phosphorus trichloride (not monophospho-
rus trichloride).
4. As with negative ion names, the stem of the element that gets
the ‐ide is often shortened: CO2 = carbon dioxide (not carbon
dioxygenide).
5. Before a vowel, if the number prefix ends in “a,” it is dropped: P2O5 =
diphosphorus pentoxide (not pentaoxide).
6. Do not use number prefixes with compounds named as ionic: Na2O =
sodium oxide (not disodium oxide).
7. Many binary compounds, especially those with hydrogen, have well‐
established non‐systematic names: CH4 = methane, NH3 = ammonia,
H2O = water, and SiH4 = silane.
TABLE 2.4 Number Prefixes

Number Prefix Number Prefix
1 Mono‐ 7 Hepta‐
2 Di‐ 8 Hexa‐
3 Tri‐ 9 Nona‐
4 Tetra‐ 10 Deca‐
5 Penta‐ 11 Undeca‐
6 Hexa‐ 12 Dodeca‐
O H
Figure 2.9 Polar bond.
The electrons in a covalent bond are not always equally shared. Often the
electrons are attracted to one of the bound atoms more than to the other,
represented in Figure 2.9. In this case the bond is said to be polar. The tendency
of an atom to draw shared electrons toward itself is called electronegativity.
Electronegativity generally decreases in successive periods (rows) of the
periodic table, hence F > Cl > Br > I, and it increases in a period going to
higher atomic number (to the right) but not including group 8A, hence B < C
< N < O < F. Electronegativities are quantified on a scale originated by Linus
Pauling and shown on the periodic table in Figure 2.3. The more e lectronegative
atoms pull shared electrons close. If the electronegativities differ by more
than 0.3, the bond is regarded as polar. If the electronegativity difference
exceeds 1.7, the bond is predominantly ionic. This shows us that the distinction
between ionic and covalent bonding is not perfectly sharp; all bonds have
some ionic and some covalent character.
2.3 MOLECULES
Most compounds important in brewing consist of molecules. A molecule is a

discrete particle made of specific atoms covalently bound together in a specific
way. The forces holding the atoms together in a molecule are much stronger
than the forces between different molecules. The properties of molecules and
the interactions between them are a central concern in beer chemistry.
MOLES AND MASS
Atoms and molecules are too small to weigh and too numerous to count.
The atoms of the elements have different masses, so a gram of one ele-
ment does not have the same number of atoms as a gram of another. In
the case of oxygen and hydrogen, the elements in water, an oxygen atom
weighs 16 times as much as a hydrogen atom. Looking at it another way,
1 g of hydrogen has 16 times as many atoms as 1 g of oxygen. One gram
of hydrogen, the lightest element, has about 6.022 × 1023 atoms, each
weighing 1.661 × 10−24 g. Chemists deal with particles like atoms and
molecules in groups that are large enough to weigh. The amount of a
MOLECULES 51
substance that has as many atoms, molecules, or ions as there are atoms
in 1 g of hydrogen (officially, exactly 12 g of the isotope of carbon that
has 6 neutrons) is called a mole of that substance.
The mass of a mole of anything is its molar mass. It is important to
clearly specify what particle is counted for the mole. Elemental hydro-
gen exists in two‐atom molecules. A mole of hydrogen molecules is twice
as much material as a mole of hydrogen atoms. The molar masses of
atoms of each element at their usual isotopic distribution have been
measured carefully and are reported to three decimal places in Table 2.1
and to two places in Figure 2.3. The molar mass of any combination of
atoms is the sum of the molar masses of the atoms. The molecular for-
mula of ethanol is C2H6O. The molar mass of ethanol is 2 × 12.011 g/mol +
6 × 1.008 g/mol + 15.999 g/mol = 46.069 g/mol. The number of moles, n, of
a substance can be calculated from the mass and molar mass:
mass
n
molar mass
Ten grams of ethanol comes to

10 g
0.217 mol
g
46 .07
mol
The number of ethanol molecules in a certain number of moles of
ethanol is identical to the number of water molecules, or carbon dioxide
molecules, or anything else with that same number of moles. Moles
refer to the number of particles.
Composition
The composition of a compound or mixture is the relative amount of
the elements or components, expressed in terms of mass, moles,
volume, or any other relevant measurement. The mass fraction of an
element in a compound or of a component in a mixture is given by
mass of stuff
mass fraction .
total mass
The mass fraction can be multiplied by 100 to give the mass percent
or by one million to give parts per million by mass (ppm). The carbon
in a mole of ethanol weighs 2 × 12.011 g = 24.022 g. The ethanol in
a mole of ethanol weighs 46.069 g (the molar mass of ethanol). The
24.022 g
mass fraction of carbon in ethanol comes to 0.5214, which
46.069 g
(continued )
c orresponds to 52.14% carbon by mass. Because mass is conserved, the

sum of the mass fractions of each element or component must be
exactly one. Suppose we need to know the mass of ethanol that contains
10 g of carbon, we solve the mass fraction for total mass:
mass stuff 10 g
Total mass 19.18 g
mass fraction 0.5214
Volume fraction, often used to express ethanol content of beer, is

given by
volume of stuff
Volume fraction
total volume
In contrast to mass, volume is not conserved; the sum of the volume

fractions does not come to exactly one. What volume of ethanol is in
one pint of 4.5% ABV beer? We solve the volume fraction equation for
volume of stuff:
Volume of stuff volume fraction total volume

0.045 1 pt 0.045 pt
In fluid ounces, this comes to 16 oz/pint × 0.045 pint = 0.72 oz.

A concentration is a measure of composition involving amount of
stuff per unit of volume. Trace materials in water and flavor compounds
in beer are often reported in milligrams per liter, also called ppm w/v
(weight/volume). The water treatment industry often uses grains per
gallon. Many chemical calculations use molar concentration, also
known as molarity, which is the number of moles per liter of solution.
The defining equation is c = n/V, where c is the molar concentration, n
is the number of moles, and V is the volume in liters. The units mol/L are
often symbolized M, but we will not follow this practice. If 330 mL
of beer contains 15 g of ethanol, what is the molar concentration of
ethanol?
Moles of ethanol: 15 g/46 g/mol = 0.326 mol

Volume in liters: 330 mL/1000 mL/L = 0.330 L
Molar concentration = 0.326 mol/0.330 L = 0.988 mol/L = 0.988 M
Molecular Geometry and Shape

The geometry of a molecule is governed by the repulsive forces between
valence electrons. In this context, we consider the valence electrons to be in
groups that travel together. One electron group can comprise a single elec-
tron, an unshared pair, a shared pair (single bond), two pairs shared between
MOLECULES 53
TABLE 2.5 Molecular Geometry

Number Electron
Groups Geometry Bond Angle (°) Figure
2 Linear 180 Figure 2.10A
3 Trigonal planar 120 Figure 2.10B
4 Tetrahedral ~109.5 Figure 2.10C
linear
trigonal planar
tetrahedral
Figure 2.10 Molecular geometry.
the same atoms (double bond), or three pairs shared between the same atoms
(triple bond). The repulsion of like charges drives the electron groups of an
atom away from one another, giving the molecule its underlying geometry. To
determine the geometry about a central atom (one that is bound to two or
more other atoms), we count the electron groups and apply the geometry
given in Table 2.5. The geometries are shown in Figure 2.10.
The central atom in water (Figure 2.8A) is oxygen. The oxygen atom has
two bonds and two unshared pairs for a total of four electron groups. The
geometry is tetrahedral; to a first approximation the expected H─O─H bond
angle is 109.5°. The actual bond angle is 105° because the unshared pairs repel
the bonding pairs more than the bonding pairs repel one another. If we con-
sider only the atoms, and not the unshared pairs, water has a bent shape. The
bent shape gives water an oxygen end, which is negatively charged, and a
hydrogen end, which is positively charged. This polarity of the water molecule
accounts for many of water’s important properties.
Carbon is the central atom in carbon dioxide (Figure 2.8B). The carbon

atom has two double bonds, each of which is an electron group. Two electron
groups give a linear geometry, so the O─C─O bond angle is 180°. Because
there are no unshared pairs, the shape is the same as the geometry. Although
the O─C bonds are polar, with the oxygen atoms more negative and the car-
bon atom more positive, the bond polarities are in opposite directions, so they
cancel one another. Because of its symmetric geometry, carbon dioxide is a
nonpolar molecule. Ethanol (Figure 2.8C) has three central atoms. The two
carbon atoms each have four single bonds, so they are tetrahedral both in
geometry and in shape. The oxygen atom has two single bonds and two
unshared pairs, adopting tetrahedral geometry, but its shape is bent.
Molecular Motion
Every part of a molecule is in constant motion. The atoms in a molecule move
with respect to one another, and the entire molecule rotates about axes and
travels through space from one place to another. The intensity of the motions
increases as the temperature increases. Motion of the entire molecule from
place to place is called translation. When a translating molecule strikes some-
thing, like a wall of the container, it produces a force. The force on a unit area
(square meter or square inch) is the pressure. The kinetic energy of a translat-
ing molecule is given by KE = ½mv2 where m is the mass and v is the speed of
the molecule. The average kinetic energy of all gas molecules is directly pro-
portional to the absolute temperature (Kelvin temperature = °C + 273.15). In
the case of a gas, the translational motion defines the temperature. Spinning
of a molecule about an axis is called rotation. Motion of the atoms within a
molecule, in which bonds bend or stretch, is called vibration. Translation,
rotation, and vibration of the molecules can cause molecules to collide, react,
and assume new forms characteristic of new substances. Because these
motions become more intense as the temperature increases, temperature is a
critical issue in controlling the reactions behind the entire brewing process.
2.4 INTERMOLECULAR FORCES
The physical properties of beer‐related substances play a large role in their

performance. If something has a taste, like hop bitter compounds, it must be
soluble in water. If it has an aroma, like malt, it must be able to get into the
gas phase. These properties result from the forces that molecules and ions
exert on one another, the intermolecular forces, also called van der Waals
forces. In principle, these forces can be attractive or repulsive, but attraction
is always dominant because the particles are pushed or pulled into positions
of net attraction. Intermolecular forces are like the behavior of a pile of small
INTERMOLECULAR FORCES 55
–
+
–
+
+
–
– + – + –
+ – +
+
– + –
+
+
–
–
–
–
–
+
+
+
– +
+
+
–
Figure 2.11 Ion–dipole force.
O
H H
O
H H
Figure 2.12 Hydrogen bond.
magnets. When you pick up one, it attracts others, even though individually
the magnets can both attract and repel one another.
The strongest intermolecular force is that between ions. In a pure ionic
substance, the force is strong enough to be a chemical bond; hence it does not
count as an intermolecular force. In solutions of an ionic substance, the force
is weakened because the ions are not as close together. The ion–dipole force
is a net attractive force between ions and polar molecules. The molecules tend
to pivot to bring the positive end close to negative ions and the negative end
close to positive ions, as shown (with some exaggeration) in Figure 2.11.
The ion–dipole force is strong enough to allow many ionic compounds to
dissolve in water. It is these dissolved ions that give brewing water its charac-
ter. Perfectly pure water does not make good beer.
Hydrogen bonding, shown in Figure 2.12, is a potentially strong force of
attraction involving ─NH, ─OH, or F─H groups. The small, strongly electron-
egative atom pulls the single electron from the hydrogen atom leaving the
nucleus virtually bare. This resulting concentrated center of positive charge is
attracted to any atom that has an unshared electron pair. Unlike other inter-
molecular forces, hydrogen bonds take specific directions in space, leading to
highly organized structures. The forces behind base pairing in DNA and RNA
are hydrogen bonds. If it were not for hydrogen bonding, water and ethanol
would be gases near room temperature.
The dipole–dipole force (Figure 2.13) arises from the interaction of polar
molecules with one another. The attraction of unlike charges pulls the positive
–
+ –
+
+
+ –
–
–
+
+ +
–
+ – + –
–
–
+
+
Figure 2.13 Dipole–dipole force.
+ – + –
Figure 2.14 Dispersion force.
ends of molecules to the negative ends of neighboring molecules giving a net

force of attraction. This force, as well as hydrogen bonding, plays a significant
role in solubility and surface interactions.
All molecules are affected by the dispersion force, also called the London
force or the induced dipole force. Dispersion forces result from temporary
polarity in ordinarily nonpolar regions of a molecule. The temporary polar-
ity arises from fluctuations in the positions of electrons, moving the center
of negative charge away from the center of positive charge. Alternatively,
dispersion forces may result from temporary changes in the relative posi-
tions of the atoms caused by molecular vibration. This temporary polarity
causes the electrons in nearby molecules to shift toward the positive end of
the induced dipole, as shown in Figure 2.14, causing an attraction. The
strength of the dispersion force depends on how easily the electrons in a
molecule can be displaced by a nearby electric field and by the extent of
molecular contact with one another. Electrons in high energy levels, which
are distant from the nucleus, are most susceptible to displacement.
Molecules containing atoms with high atomic numbers (above 20) have
electrons that are easily displaced. Even without distant electrons, long
molecules or those with flat rings can approach one another over a broad
area, maximizing the potential for dispersion forces. Compounds with rings
containing double bonds will stack like dishes to yield a dispersion force
STRUCTURE OF MOLECULES 57
called the stacking force. Certain finings make use of the stacking force to
bind and remove haze‐forming compounds in beer.
When a substance dissolves, its molecules push aside the molecules of
material in which it dissolves (called the solvent). If the solvent molecules
are polar and held together by strong dipole–dipole interactions, pushing
them aside requires a good deal of energy. If the interactions among the
solvent molecules are replaced by new intermolecular forces of about equal
strength, the energy cost is offset. In general, strongly polar and hydrogen‐
bonded s ubstances dissolve in one another. In addition, weakly polar and
nonpolar substances dissolve in one another. In contrast, strongly polar and
weakly polar substances are typically insoluble in one another. This gener-
ality is captured by the phrase “like dissolves like.” The same arguments
apply to parts of large molecules. Beer and beer wort are mostly water,
which is highly polar and hydrogen bonding. Proteins, which come mostly
from the malt, are large molecules that include polar and nonpolar regions.
In water, protein molecules coil and fold in ways that allow the polar
regions to be in contact with the water and the nonpolar regions to stick to
one another. During boiling, the proteins unfold, allowing the nonpolar
regions on different molecules to find one another. The protein molecules
stick together and drop out of solution as hot break. Polar or hydrogen
bonding molecules or parts of molecules that have strong intermolecular
forces with water are said to be hydrophilic (Greek: water loving). Molecules
or regions that interact weakly with water are said to be hydrophobic
(Greek: water fearing).
2.5 STRUCTURE OF MOLECULES
In many cases, the same set of atoms can be bound together in different ways
to make different compounds. Compounds with the same atoms in their mol-
ecules but that are arranged differently are called isomers. The molecule
C4H8O can form over 30 different isomers! The system of notation that distin-
guishes isomers is the structural formula or “structure.” There are several
types of structural formulas, each with advantages and disadvantages.
Figure 2.15 shows different types of structural formulas for (E)‐but‐2‐ene‐1‐
ol, one of the isomers whose molecular formula is C4H8O.
Lewis Structure
A Lewis structure shows every atom and bond and often unshared pairs.
Sometimes an effort is made to realistically show the geometry in two dimen-
sions. Figure 2.15A shows a Lewis structure of (E)‐but‐2‐ene‐1‐ol, also called
trans‐but‐2‐ene‐1‐ol. The advantage of the Lewis structure is that everything
is shown without simplification or abbreviation. Some disadvantages are that

they can be cluttered and hard to use and that Lewis structures must be
drawn; they cannot be typed.
Condensed Structure
The condensed molecular structure fits on a line of type. The main chain of
atoms, not including hydrogen, is shown with bonds between them. Atoms that
are attached to the main chain atoms are shown after the main chain atoms.
The condensed structure for (E)‐but‐2‐ene‐1‐ol is CH3─CH═CH─CH2─OH.
One major disadvantage is that the condensed structure does not always
distinguish isomers. In this case, there are two isomers that have the same con-
densed structure. Condensed structures are difficult to use when the molecule
has branches or rings.
Skeletal Structure
The skeletal structure greatly simplifies the formula by using the fact that car-
bon atoms always share four valence electrons to make four bonds. The struc-
tural formula is reduced to the bonds themselves. If the end of a bond is not
labeled as another element, it is assumed to be a carbon atom. Hydrogen
atoms that are bound to carbon are not shown. Any carbon atom with fewer
than four bonds is understood to have hydrogen atoms to make up the missing
bonds. The skeletal structure for (E)‐but‐2‐ene‐1‐ol is shown in Figure 2.15B.
The advantages of skeletal structures are that they can nearly always repre-
sent each isomer uniquely, especially when some conventions representing 3D
structure are added; the omission of hydrogen and carbon makes them less
cluttered; and the format emphasizes the heteroatoms (atoms other than C
and H), which often account for the main chemical properties of the substance.
The disadvantage is that preparing and interpreting skeletal structures requires
practice because of the implied atoms and bonds.
(A)
(B)
Figure 2.15 (E)‐But‐2‐ene‐1‐ol. (A) Lewis structure. (B) Skeletal structure.
ORGANIC CHEMISTRY AND FUNCTIONAL GROUPS 59
(A)
(B)
(C)
(D)
Figure 2.16 Isomers. (A) 2‐Methylprop‐1‐ene‐1‐ol. (B) 3‐Methyl oxetane. (C) (Z)‐
But‐2‐ene‐1‐ol. (D) (E)‐But‐2‐ene‐1‐ol.
Structural and Stereoisomers
Structural isomers are compounds with the same molecular formula but
whose atoms are connected in a different way. Stereoisomers are a specific
type of isomer in which the atoms are connected in a similar way but their
bonds are differently orientated in space, leading to a different 3D form.
Figure 2.16A–C shows structural isomers, all with the formula C4H8O. The
molecules in Figure 2.16A and C both have an OH group and a double bond,
but they are connected in different ways. The molecule in Figure 2.16B is
completely different; it has a ring, no double bond, and no OH group. The
molecule in Figure 2.16C is connected in the same way as that in Figure 2.16D,
but the bonds are differently directed in space. In Figure 2.16C the carbon
atoms on the left and right side of the double bond are both directed down; in
Figure 2.16D the carbon on the left is down and the one on the right is up. The
compounds in Figure 2.16C and D are stereoisomers. Stereoisomers typically
have similar chemical properties. Structural isomers can belong to totally
different classes of compounds with widely different properties.
2.6 ORGANIC CHEMISTRY AND FUNCTIONAL GROUPS
Organic chemistry is the chemistry of compounds that have carbon–carbon

bonds (single, double, or triple) or carbon–hydrogen bonds (always single).
Carbon has the virtually unique ability to form chains, rings, and branches of any
size and shape. There are millions of organic compounds, hundreds of which are
important in beer quality in a positive or negative sense. To make the study of
these compounds possible, we need to classify them by parts of their structure
that give the molecule particular chemical characteristics. These structural frag-
ments are called functional groups. By recognizing the functional groups, you
will better understand the form and function of essential chemicals in the brew-
ing process such as ethyl hexanoate (a fruity flavor from yeast), hydrochloric acid
(a cleaning chemical), and trans‐2‐nonenal (a staling flavor from oxidation).
Hydrocarbons
Compounds with only carbon and hydrogen are called hydrocarbons. Atoms
other than carbon and hydrogen are called heteroatoms, so hydrocarbons are
organic compounds without heteroatoms. Hydrocarbons with only single
bonds are alkanes, also called paraffins. Alkanes are unreactive, although
they burn well. They are seen by chemists as the framework upon which the
interesting parts, called functional groups, are attached. A hydrocarbon with
a double bond is an alkene, sometimes called an olefin. The double bond
serves as a center of reactivity; it is a functional group. Myrcene, shown in
Figure 2.17, is an important flavor alkene from hops. This alkene makes up
nearly 50% of the essential oil in Cascade hops.
The characteristic reaction of a double bond is addition, shown in Figure 2.18.
The double bond between E and D is now a single bond, and groups X and Y
become part of the original double‐bonded molecule. If, for example, X–Y is
H─OH (water), the product will have an OH group, making it an alcohol.
Addition is not restricted to carbon–carbon double bonds; it can occur with any
double bond, especially the C═O double bond. Hydrocarbons with a carbon–
carbon triple bond are called alkynes. Alkynes are also susceptible to the addi-
tion reactions, but they are not very important in beer brewing.
Aromatic Compounds
Aromatic compounds have rings with alternating single and double bonds.
Systems of single and double bonds are said to be conjugated. The rings are
flat, and the electrons in the double bonds are delocalized, that is, they are
spread out over the entire ring. Delocalization makes these bonds much less
Figure 2.17 Myrcene.
E D E D
+
X Y X Y
Figure 2.18 Addition to a double bond.

ORGANIC CHEMISTRY AND FUNCTIONAL GROUPS 61
Figure 2.19 Benzene.
OH
Figure 2.20 Ethanol.
OH
Figure 2.21 4‐Vinylguaiacol.
susceptible to addition reactions than isolated double bonds. Figure 2.19 shows

benzene, the simplest aromatic compound. Many compounds important in all
living systems, like the DNA nucleobases, are aromatic compounds.
Alcohols
Alcohols are organic compounds with an ─OH group bound to a carbon atom
that is not bound to any other heteroatom. The OH group can form hydrogen
bonds. The two‐carbon alcohol, ethanol, shown in Figure 2.20, is the psychoac-
tive component in beer and other fermented beverages. Alcohol with one
carbon is called methanol, which is naturally produced in small quantities by
yeast. Methanol is extremely harmful if concentrated through distillation, which
is one reason why home distilling is more tightly regulated than home brewing.
Alcohols with three or more carbon atoms are called fusel alcohols. They can be
precursors to important flavor compounds in beer. Alcohols in which the ─OH
group is bound to an aromatic ring with alternating double and single bonds are
called phenols. Figure 2.21 shows the structure of 4‐vinylguaiacol, a phenol that
gives a characteristic flavor to weizenbier, a German‐style wheat ale.
Carbonyl Compounds
The C═O double bond is called a carbonyl [CAR‐ben‐ill] group. Molecules
that contain a carbonyl group are called carbonyl compounds. These com-
pounds fall into several families, and many of them are of great importance in
brewing. Figure 2.22 shows the general formula for a carbonyl compound.
Figure 2.22 Carbonyl compound.
TABLE 2.6 Carbonyl Compounds

Functional Name
R1 R2 Group Example (Official Name)
─H ─H Aldehyde Formaldehyde
(methanal)
─CnHm ─H Aldehyde Acetaldehyde

(ethanal)
─CnHm ─CnHm Ketone Diacetyl

(butanedione)
─CnHm ─OH Carboxylic acid Acetic acid

(ethanoic acid)
─CnHm ─OCnHm Ester Isobutyl acetate

(2‐methylpropyl
ethanoate)
─CnHm ─NH2 Amide Acetamide

(ethanamide)
The specific functional group is determined by the nature of R1 and R2. Some
important cases with examples are given in Table 2.6.
2.7 CHEMICAL REACTIONS
Chemical Equations
A chemical reaction is a process in which one or more substances, the reactants,
are converted to one or more different substances, the products. The reaction
occurs by exchange and rearrangement of the atoms; no atoms are created or
CHEMICAL REACTIONS 63
destroyed. Chemical reactions are represented by chemical equations in which

the formulas of the reactants and products are shown with an arrow pointing to
the products, as shown in the equation for alcoholic fermentation of glucose
(C6H12O6) to give ethanol (C2H6O) and carbon dioxide: C6H12O6 → 2C2H6O +
2CO2. This equation shows that one molecule of glucose reacts to give two
molecules of ethanol and two of carbon dioxide. It can also be interpreted as
one mole (180 g) of glucose reacts to give two moles of each product. The num-
bers before the formulas are called coefficients. Equations are normally bal-
anced, where the same number of each atom is on both sides of the equation.
Suppose 1000 g of glucose is fermented, which is 1000 g/180.2 g/mol = 5.55 mol.
Based on the fermentation equation, 11.1 mol each of ethanol and carbon diox-
ide are produced. That comes to 11.1 mol × 46.07 g/mol = 511 g of ethanol and
11.1 mol × 44.01 g/mol = 489 g of CO2. Any calculation with a chemical equation
must be done in moles.
Equilibrium
Suppose we have a sealed jar partly filled with ethanol and the rest with vac-
uum. Ethanol is volatile, so the liquid begins to evaporate. This gives an increas-
ing concentration of ethanol molecules in the gas phase. Some of these strike
the surface of the liquid and condense. The tendency for ethanol to evaporate
depends on the amount of energy needed for evaporation and on the tempera-
ture. The tendency for ethanol to condense depends on the concentration in
the gas phase; more molecules flying around means more will condense every
second. Eventually, the concentration of ethanol in the gas phase will be high
enough so that number of molecules that condense is equal to the number that
evaporate. At this point the vapor concentration of ethanol, and hence the
pressure, is constant. The system is at equilibrium. The pressure or partial pres-
sure of a liquid at equilibrium with its vapor is called the vapor pressure of the
liquid. Even though the ethanol is actively evaporating and condensing, the
processes balance one another, so there is no net change.
The principal of equilibrium is important in many chemical reactions.
High concentrations of reactants give the reaction a tendency to proceed
forward, toward products. High concentrations of products give the reac-
tion a t endency to proceed backward, to reactants. Somewhere in between
is a position of equilibrium. The forward and reverse rates of the reaction
are equal. The position of a reacting system with respect to equilibrium is
evaluated with an expression called the reaction quotient. For the general-
ized reaction aA + bB → cC + dD, the reaction quotient, Q, is given by the
equation below:
c d
C D
Q a b
A B
where [X] represents the concentration of reactant or product X and a, b, c,

and d are the coefficients of the reactants and products in the balanced equa-
tion. Only concentrations of substances in solution or in the gas phase enter
the expression. Pure (or nearly pure) solids or liquids, including the solvent, do
not enter the expression. As the reaction proceeds from reactants to products,
Q increases. The equilibrium value of the reaction quotient is called the equi-
librium constant, designated K, often with a subscript indicating the type of
reaction. For example, acid dissociation equilibrium constants are designated
Ka. For technical reasons, neither Q nor K are considered to have units. When
Q is lower than K, the reaction is spontaneous in the forward direction. When
Q is higher than K, the reaction is spontaneous in the reverse direction.
Example: For the reaction 2H2O → H3O+ + OH−, a water sample at equi-
librium is found to be 55 mol/L in H2O, 1.0 × 10−8 mol/L in H3O+, and 1.0 ×
10−6 mol/L in OH−. Calculate K.
Answer: K = [H3O+][OH−] = [1.0 × 10−8][1.0 × 10−6] = 1.0 × 10−14 (no units).
Water, being the virtually pure solvent, does not come into the equilibrium
expression. This equilibrium constant is designated Kw.
Le Châtelier’s principle states that if a system at equilibrium is subjected
to a change, the system will respond in a way that, to some extent, undoes the
change. Consider the reaction CO2 (dissolved) → CO2 (gas). If we increase
the pressure, the system will shift to the low‐volume side, so more CO2 will
dissolve. Heat is absorbed when CO2 comes out of solution, so increasing the
temperature will cause CO2 to come out of solution, and removing some heat
will cause more CO2 to dissolve. This is exactly how carbonation behaves,
which is important in setting the pressure and temperature in bright beer
tanks and in beer dispensing lines.
Reaction Rate
The speed at which a reaction takes place is called the rate. Brewers often meas-
ure the rate of fermentation by the change in sugar concentration, which could
be reported in degrees Plato per hour. Reaction rates usually depend strongly
on temperature; in many cases a few degrees of temperature change can cause
the reaction rate to increase by a significant factor. Reaction rate is a different
issue from reaction equilibrium. A stainless steel vessel has a spontaneous
tendency to react with oxygen to yield metal oxides. If you wait long enough, all
metal brewery fittings will corrode. Fortunately, the rate of corrosion of stain-
less steel is low enough to give the equipment a useful lifetime. Nonetheless, if
the brewery allows conditions to develop that enhance the corrosion rate,
expensive damage will result.
In addition to temperature, the concentrations of reactants, physical contact
among the reactants, pressure, mixing, and catalysts will all influence the
reaction rate. A catalyst is a material that causes a reaction rate to increase,
CHECK FOR UNDERSTANDING 65
specificity selectivity
no yes
A + 2X AX2 A + 2X AX2
yes no
B + 2X BX2 A + 4X AX4
no
C + 2X CX2
Figure 2.23 Specificity and selectivity.
although the catalyst is not a reactant or product. Catalysts work by providing

lower‐energy pathways for the reaction or by helping to line up the reactants
into a favorable arrangement allowing them to react. Two key characteristics
that many catalysts possess to some degree are specificity and selectivity.
Specificity is the ability of a catalyst to enhance the rate of reaction of one or a
limited set of potential reactants to a much greater extent than other potential
reactants. Selectivity is the ability of a catalyst to enhance the rate of one reac-
tion over several to which the reactants could be susceptible. Figure 2.23 shows
this distinction graphically. Under specificity, A, B, and C are reactants that can
react with X. The catalyst only enhances the B reaction. Under selectivity, reac-
tant A could react with X to give either AX2 or AX4. The catalyst enhances only
the reaction to AX2. The major brewing processes of mashing and fermentation
depend on protein‐based catalysts called enzymes. A key feature of many
enzymes is outstanding specificity and selectivity, which allow reactions in
living cells to be controlled. All catalysts, including enzymes, speed up the rates
of reactions, but they have no effect on the position of equilibrium. The catalyst
will help Q (reaction quotient) reach K (equilibrium constant) faster, but K is
not changed. There is no such thing as a one‐way catalyst; if a catalyst can speed
up the forward reaction, it can also speed up the reverse reaction.
1. Identify the element in group 4A in the fifth period. Give its atomic num-
ber, molar mass, and electronegativity.
2. How many protons, valence electrons, and core electrons are present in
each of the following elements or ions: potassium, sulfur, Na+, O2−, I−, and
Sr2+?
3. Rank the following metals in order of increasing reactivity: barium, beryl-
lium, calcium, magnesium, and strontium.
4. Write formulas for calcium chloride, sodium carbonate, ammonium
sulfate, barium hydroxide, and aluminum oxide. What are their formula
weights (g/mol)?
5. What are the correct names for the following compounds: NaHSO4,
N2O4, KO2, ClO2, and Na3PO4?
6. Calculate the mass of manganese (Mn) in 10.0 g of KMnO4.
7. What is the difference between an ionic bond and a covalent bond?
8. Draw the Lewis structure and the skeleton structure for dimethyl ether,
CH3─O─CH3.
9. Draw the following compounds as Lewis structures:
10. Draw the following compounds as skeleton structures:
H
O
H
N C C
H
H O
C
H H
C
H H
C C
C C
H C H
H
11. Identify (name) the principal functional group for the following molecules:
O OH OH
C
H3C H O
Bibliography 67
12. Ammonia (NH3) is made from the elements H2 and N2. Balance the reac-
tion by inserting the coefficients __N2 + __ H2 → __NH3.
13. For the reaction 3BaCl2 + 2H3PO4 → Ba3(PO4)2 + 6HCl, calculate the
mass of H3PO4 required to react with 100.0 g of BaCl2.
14. Name and explain the three types of molecular motion.
15. What is the function of a catalyst? What is the difference between specific-
ity and selectivity?
BIBLIOGRAPHY
Barth R. 2013. The Chemistry of Beer: The Science in the Suds. Wiley. ISBN
978‐1‐118‐67497‐0.
Snyder CH. 2003. The Extraordinary Chemistry of Ordinary Things, 4th ed. Wiley.
ISBN 0‐471‐41575‐8.
Chapter 3
BIOLOGY FOR BREWING
Biology is the science of life; its role in brewing is unmistakable. Brewers rely
upon the biology of barley to produce seeds with traits that are optimized for
brewer’s malt. They rely upon hop plants to produce lupulin‐laden hops for
flavor and bitterness. They rely upon equipment cleanliness and control of
contaminating bacteria. And most importantly, without yeast, there is no
beer. They rely upon yeast and the biological process of fermentation to
produce ethanol, carbon dioxide, and a variety of flavors in beer.
3.1 MACROMOLECULES
Much of biology is rooted in chemistry. Organic compounds, along with some

inorganic compounds, are produced in a variety of structural configurations
depending on the atoms and arrangements of their bonds. The resulting
three‐dimensional structures lead to functionality that influences downstream
chemical change through chemical reactions. Many organic compounds found
in living systems have large molecules, termed macromolecules, that consist
of thousands of atoms. Most macromolecular substances are polymers.
Polymers are composed of long chains of molecularly linked repeating

69
70 BIOLOGY FOR BREWING
6 + 5 H2O
Figure 3.1 Synthesis of polyethylene glycol (antifoam) from ethylene glycol.
H H H H
O O
O O
C C C C
C + C C C + H 2O
H2N H 2N
CH3 OH H OH H2N CH3 N OH
H H
Alanine Glycine Alanylglycine
Figure 3.2 Condensation of two amino acids.
subunits termed monomers. This concept is illustrated in Figure 3.1 with six

ethylene glycol monomers. Polymers synthesized by cells are called biopoly-
mers. Most biopolymers can be broken down into monomers by the hydroly-
sis reaction. This reaction, like most biological reactions, is enhanced and
controlled by large protein molecules called enzymes, which serve as catalysts.
A specific enzyme recognizes the polymer and uses water to break the bonds.
The hydrogen from water is attached to one monomer, and the remaining
hydroxyl group is attached to the neighboring monomer. This hydrolysis reac-
tion breaks the covalent bond between the subunits. Details of the enzymatic
hydrolysis of starch are discussed in Chapter 6. The breakdown of complex
molecules in biology is called catabolism.
The covalent bond between subunits of a polymer is formed by a conden-
sation reaction. A specific enzyme binds to a growing polymer, recruits a new
monomer, and joins them by removing a water molecule. Unlike hydrolysis,
condensation reactions usually require energy. The synthesis of complex mol-
ecules in biology is called anabolism. The condensation of the amino acids
alanine and glycine to give a dipeptide is shown in Figure 3.2.
In the following sections, we will discuss the four major macromolecules in
biology: carbohydrates, proteins, lipids, and nucleic acids (DNA and RNA).
All are formed by anabolic reactions and broken down by catabolic
reactions.
Carbohydrates
Carbohydrates are a family of biological compounds containing carbon,
hydrogen, and oxygen. They have multiple ─OH groups and either carbonyl
or related functional groups. Many carbohydrates have names with the suffix
“‐ose.” Simple sugars have the formula (CH2O)n, where n is 3 or more. The
most important sugars for brewing are hexoses: n = 6. Of these, d‐glucose,
shown in Figure 3.3A and B, is the most important. Polymers of sugars include
MACROMOLECULES 71
OH
H
H 2C
H O
HO
HO OH
H OH
H H
(A) (B)
(C) (D)
OH
OH
H2C H
O
H
HO OH
H OH
H H
(E) (F)
Figure 3.3 Hexose structures. (A) Alpha‐glucose, ring form. (B) Glucose, open chain.
(C) Alpha‐fructose, ring form. (D) Fructose, open chain. (E) Alpha‐galactose, ring
form. (F) Galactose, open chain.
starches that provide energy reserves for cells and other carbohydrates like
cellulose and beta‐glucan (β‐glucan) that provide structural support in the
cell walls of plants like barley. Ultimately the catabolism of starch into simple
sugars will be the main process goal during the mashing step of beer
production.
Figure 3.3 shows the most common six‐carbon sugars in both linear and
ring structures. All three sugars have the same formula, C6H12O6, but differ in
their atom arrangement and structure. Glucose and fructose are structural
isomers; their atoms are connected in different ways to give different
s tructures. Despite the identical molecular formula, glucose and fructose are
clearly different compounds. Glucose is an aldehyde whose melting point is
141 °C compared with fructose, a ketone, that melts at 103 °C. Fructose is
noticeably sweeter than glucose (based on the concentration needed to evoke
the same perceived sweetness). Glucose and galactose are more similar. They
are diastereomers; the same atoms are connected in the same way in both
sugars, but the spatial orientations of the groups on carbon 4 differ. The open‐
chain forms, shown in Figure 3.3B, D, and F, can be thought of as parent forms,
although only a small fraction of hexose molecules in water solution take this
form. The open‐chain drawings are presented as Fischer projections, a two‐
dimensional representation of a three‐dimensional molecule. All vertical
bonds go into the plane of the drawing and all horizontal bonds come out of
the plane toward the viewer. The carbon atoms in a sugar molecule are num-
bered from the end of the open‐chain form nearest to the carbonyl (C═O)
group. The same numbering is used for the ring form. If the carbonyl group is
at the end of the carbon chain, the principal functionality is an aldehyde, and
the sugar is classified as an aldose. If the carbonyl group is not at the end, the
principal functionality is a ketone, and the sugar is classified as a ketose.
CHIRALITY: MOLECULES WITH HANDEDNESS
An object that is not the same as its mirror image is said to be chiral
[KYE r’l: Gk: χείρ, hand]. Many sugars are distinguished from one
another solely by chirality. A screw is a familiar example of chirality;
screws can be right or left handed. Our left and right hands themselves
are also chiral. The usual sources of chirality in molecules are asymmet-
ric carbon atoms. An asymmetric carbon atom is one with four single
bonds, each to a different group. Figure 3.4 shows an asymmetric carbon
atom and its mirror image. Groups B and D occupy corresponding
B B
C C
E E
D D
Figure 3.4 Asymmetric carbon.

MACROMOLECULES 73
ositions, but C and E are reversed. The molecules cannot be overlaid on

p
one another; they are different compounds. Chirality is not just a matter
of the first atom bonded to the asymmetric carbon, but rather the differ-
ences in the positioning of the different groups bonded to the asymmet-
ric carbon. So if A is ─CH3 and B is ─C2H5, they are different groups.
Isomers that are mirror images are called enantiomers. Enantiomers
have identical physical and chemical properties except for their interac-
tions with other chiral phenomena, such as other chiral molecules or
polarized light. Usually the enantiomers are given the same name with
prefixes denoting the specific enantiomer as “l‐” or “d‐.” In biological
systems, most carbohydrates are “d” form, while most amino acids are “l.”
Sugar molecules often have several asymmetric carbon atoms. For
example, the ring forms of the six‐carbon aldose sugars have five asym-
metric carbons. In a simpler example for this discussion, the four‐carbon
aldoses have two asymmetric carbons, C‐2 and C‐3. We refer to the con-
figurations of the asymmetric carbon atoms as R and S (for an explana-
tion of absolute configuration, see Barth 2013 p 117). There are four
possibilities for the two asymmetric carbons: RR, RS, SR, and SS. In a
mirror image, each R turns to an S and vice versa. So RR and SS are
enantiomers, and RS and SR are enantiomers. RR and RS are not
mirror images of one another; they are another sort of isomer called
diastereomers. They have different chemical and physical properties,
including different melting points. The two pairs of enantiomers are
called erythrose and threose. They are shown in Figure 3.5.
L-Erythrose (2S, 3S) D-Erythrose (2R, 3R)
L-Threose (2R,3S) R-Threose (2S,3R)

Figure 3.5 Diastereomers: threose and erythrose. Solid wedges are bonds
coming toward the viewer; dashed wedges go away from the viewer.
(A) (B)
Figure 3.6 Glucose anomers. (A) Alpha‐d‐glucose and (B) beta‐d‐glucose.
Open‐chain sugars with five or more carbon atoms spontaneously react to

form a ring. In the case of six‐carbon aldoses, like glucose, the most common
ring form results from carbon number five (counting from the C═O carbon)
connecting to the carbonyl oxygen. This chain‐ring interconversion is reversi-
ble. When the ring is formed, the C═O carbon becomes asymmetric, so instead
of 8 isomers, there are 16. The carbon atom that originated as the C═O is
called the anomeric carbon; it is bound to two oxygen atoms. The configura-
tion about the anomeric carbon changes when the ring cycles between ring‐
and open‐chain forms. Figure 3.6 shows the glucose anomers, forms that vary
by the configuration about the anomeric carbon. In the alpha (α) anomer, the
─OH group on the anomeric carbon extends in the axial direction, that is, in
the direction of the “axle” of the ring. In the beta (β) anomer, the ─OH group
extends in the equatorial direction, in the direction of the “spokes” of the ring.
About two‐thirds of dissolved glucose is in the beta form. The remaining one‐
third is mostly in alpha form with a small amount in the open‐chain form.
Glucose is the most abundant monosaccharide and is used as an energy
source in most living systems. Through glycolysis, fermentation, and aerobic
respiration, the bonds in glucose are broken down or oxidized to provide
energy for other cell functions. Glucose is so essential for energy production
that living systems have mechanisms to ensure that glucose reserves are
always available. In yeast, trehalose (a disaccharide) and glycogen (a polysac-
charide) serve as glucose reserves. Analysis of their concentrations can be
used as a measure of yeast vitality, as discussed in Section “Viability and
Vitality,” Chapter 9.
The six‐carbon aldoses in their open‐chain forms have 16 isomers in 8 pairs
of enantiomers. These are named allose, altrose, galactose, glucose, gulose,
idose, mannose, and talose. Only galactose, glucose, and mannose are com-
monly fermented by brewing yeast. The other six‐carbon aldoses are rare in
nature.
More complex carbohydrates are condensation products of simple sugar
molecules. These involve condensation of the anomeric ─OH group on one
sugar molecule with an ─OH group on another sugar molecule, releasing
MACROMOLECULES 75
Figure 3.7 Alpha‐glucose condensation to maltose.
water. The connection is called a glycosidic link. Figure 3.7 shows two glu-
cose molecules condensing to yield a disaccharide called maltose, the
most abundant sugar in barley wort. In maltose, the alpha‐configured
─OH group on carbon 1 of one glucose molecule has condensed with the
─OH group on carbon 4 of another; the link is named alpha(1→4). Because
there is no ─OH group on the anomeric carbon of the upper glucose unit,
the upper ring can no longer open, and the unit is locked in the alpha
form, leaving the maltose molecule bent. When there is a glycosidic link
between the anomeric carbons of two sugar units, the alpha/beta
configurations of both are locked. Thus in nomenclature of disaccharides,
the configuration of both must be specified, as in sucrose: glucose‐
alpha(1→2)‐alpha‐fructose. Therefore, specific disaccharides will be
defined by two parameters, the location of the glycosidic link and the
identity of the sugars. Table 3.1 shows common disaccharides. The differ-
ences among them seem subtle, but they behave very differently. For
example, maltose is easily assimilated by yeast, in contrast to lactose,
which is not usually assimilated at all.
Any number of sugar molecules can be joined by glycosidic links to give
polymers that are important in brewing, such as starches, gums like β‐glucan,
and structural materials like cellulose. A polysaccharide consists of repeating
units of one or more sugar monomers, typically glucose. Although the precise
number of glucose units of individual polysaccharides can vary, they often
number in the thousands! Polysaccharides may be branched or unbranched.
This structural arrangement, coupled with the glucose isomer involved and
the location of the glycosidic bond, defines the polysaccharide and its
functionality.
The most important polysaccharide in brewing is starch (α‐glucan). Starch
is the most abundant carbohydrate used for energy storage in plants such as
barley, making up 63% of all barley seed dry matter with granules containing
up to 98% starch. Starch is a polymer of glucose subunits connected by
TABLE 3.1 Most Common Disaccharides
Name Sugars Bond Structure
Glucose
Maltose α(1→4)
Glucose
Glucose
Trehalose α(1→1)‐α
Glucose
Glucose
Cellobiose β(1→4)
Glucose
Galactose
Lactose β(1→4)
Glucose
Glucose
Sucrose α(1→2)‐α
Fructose
MACROMOLECULES 77
alpha(1→4) bonds. There are two major types of starch in barley, amylose and
amylopectin. Of all starch in barley seeds, amylose makes up only about 20%.
It consists of long, unbranched chains of glucose subunits, all in the alpha(1→4)
configuration. Because of the angle of the glycosidic bond, amylose forms a
helical (spiral) structure (Figure 3.8A). Amylopectin makes up about 80% of
the total starch in barley. Unlike amylose, amylopectin contains branched
molecules composed of alpha(1→4) glucose polymers with occasional
alpha(1→6) branch points (Figure 3.8B). Glycogen, a starch storage molecule
in yeast and animals, is similar in structure to amylopectin but is more highly
branched.
Barley seed contains another carbohydrate called cellulose. Cellulose is an
insoluble polymer of beta(1→4) bonded glucose that serves as a structural
carbohydrate. It is an important part of plant cell walls and is found in the
biofilms produced by some bacteria. Cellulose makes up about 5–6% of the
dry weight of a barley seed and is located mostly in the husk. Unlike starch,
the orientation of the beta(1→4) bonds yields a straight‐chain polymer. As a
result, the hydroxyl groups on one chain form hydrogen bonds with oxygen
atoms on parallel chains, tightly holding adjacent polymers together
(Figure 3.9). This intermolecular bonding, coupled with the rodlike structure
of the polymer, contribute to the mechanical strength of cellulose. Because
the bonds of cellulose are structurally different than starch, the enzymes used
to break down starch into simple sugars for fermentation cannot act on cel-
lulose. After mashing, cellulose remains behind in the spent grain. Some bio-
technology companies are looking at ways to reuse spent grains by adding an
enzyme to break down the cellulose into simple sugars for subsequent
fermentation.
Hemicellulose resembles cellulose in having a backbone of sugar molecules
connected mainly by beta(1→4) linkages, but it contains sugars other than glu-
cose, especially mannose, galactose, and five‐carbon sugars including l‐arabinose
(A) (B)
Figure 3.8 Starch structure schematic. (A) Amylose and (B) amylopectin.
Figure 3.9 Cellulose stacking: hydrogen bonds dotted.
(A) (B)
Figure 3.10 Pentoses. (A) α‐l‐Arabinose and (B) α‐d‐xylose.
and d‐xylose (Figure 3.10) in addition to some modified sugars. Whereas the

sugars in cellulose are connected entirely by beta(1→4) linkages, those in
hemicellulose have frequent instances of other connections, like beta(1→3)
links, which introduce kinks in the chain. Because of the variety of sugars and
linkages in hemicellulose, it is much less crystalline than cellulose, and it is
readily degraded into soluble fragments. Hemicellulose is a major component
of the barley endosperm cell walls, with 80–90% β‐glucan and 10–20%
pentosan, a carbohydrate polymer made of mostly five‐carbon sugars.
β‐Glucan, also called mixed‐linkage glucan, is a glucose polymer contain-
ing mostly beta(1→4) bonded glucose with intermittent beta(1→3) links
every four to six subunits, as shown in Figure 3.11. This structural arrange-
ment creates kinks in the molecule that prevent the polymer stacking seen in
cellulose (Figure 3.9). In this structure, instead of all hydroxyl groups forming
hydrogen bonds with parallel polymers, they mostly hydrogen‐bond with sur-
rounding water, thus improving solubility. β‐Glucan is a gum; a small amount
of it dissolved in beer wort can greatly increase the viscosity, defined as resist-
ance to flow. Excessive wort viscosity can cause slow lautering or “stuck
sparges” where the wort flow completely stops during the lauter process.
Most β‐glucan in barley should be degraded during the malting process, but
insufficient malt modification or the use of adjuncts high in β‐glucan such as
unmalted barley, wheat, oats, or rye can increase wort viscosity. Raising the
MACROMOLECULES 79
Figure 3.11 Structure of β‐glucan.
mash temperature to a “mash‐out” temperature of ~76 °C (168 °F) helps to

decrease viscosity caused by gums and thus shortens total lauter time.
The pentosans in barley are polymers of pentose saccharides, typically
xylose and arabinose. Pentosans are key structural components of the starchy
endosperm cell walls; they must be degraded during malting to allow sufficient
access to the starch granules. Insufficient malt modification and enzymatic
degradation of pentosans can cause low mash extract and filterability issues
during the lauter. The degradation of pentosans in a ferulic acid rest during
mashing promotes the release of ferulic acid. The ferulic acid rest will be
further discussed in Chapter 6.
Lipids
Lipids are hydrophobic biological compounds defined by their solubility
in nonpolar solvents and relative insolubility in water, rather than by any
consistent molecular features. Their hydrophobicity is brought about

by an abundance of nonpolar groups with relatively few oxygen‐ or
Linoleate
Palmitate
Oleate
Figure 3.12 Triacylglycerol, acyl groups identified.
nitrogen‐containing functional groups. The most biologically important lipids

are classified as fats, phospholipids, fat‐soluble vitamins, steroids, and waxes.
Phospholipids are major components of cell membranes and will be discussed
in Section “Lipid Bilayer.” Much of the lipid content of beer is derived from
barley, which is 2–3% lipid by dry weight, mostly coming from the embryo por-
tion of the seed. Lipids make up about 6–12% of the dry matter in yeast cells.
About 90% of the lipid content in barley is triacylglycerols, also called
triglycerides, or fats. In animals and plants, triacylglycerols are an important
energy storage reserve that releases energy when catabolized. A triglyceride
molecule consists of a glycerol molecule joined by three fatty acids, each
bound to the glycerol through ester bonds (Figure 3.12).
Glycerol is a three‐carbon alcohol with three hydroxyl groups. Fatty acids
are long, unbranched hydrocarbon chains with a terminal carboxyl group. The
length of the hydrocarbon chain and the presence and locations of double
bonds in the chain define the identity of the fatty acid. Saturated fatty acids
have no double bonds; they are “saturated” with the most hydrogen atoms
possible. Unsaturated fatty acids include one or more carbon–carbon double
bonds; each double bond lowers the number of hydrogen atoms by two.
Fatty acids are sometimes described with a shorthand notation called lipid
numbers. The lipid number takes the form C:D, where C is the number of
carbon atoms in the molecule and D is the number of double bonds. The pres-
ence of double bonds affects the chemical and physical properties of fatty
acids and their derived compounds. Unsaturated fatty acids, which are those
with one or more double bonds, are much more reactive, especially with oxy-
gen, than saturated fatty acids; their physical properties are also greatly
affected. Saturated fatty acid molecules are mostly straight, as shown for
stearic acid (lipid number 18 : 0) in Figure 3.13A. They fit together well to
give well‐ordered structures. Double bonds introduce kinks in the molecules
of unsaturated fatty acids, as shown for linoleic acid (18 : 2) in Figure 3.13B.
They form disordered structures that remain fluid even at fairly low tempera-
tures. The melting point of stearic acid is 69.3 °C, compared with −5 °C for
linoleic acid. There are about 30 biologically relevant fatty acids; those most
abundant in barley are described in Table 3.2.
MACROMOLECULES 81
(B)
(A)
Figure 3.13 Fatty acids. (A) Stearic acid, saturated, and (B) linoleic acid, unsaturated.
TABLE 3.2 Fatty Acids in Barley

Name Lipid number Relative amount (%)
Linoleic acid 18 : 2 58
Palmitic acid 16 : 0 20
Oleic acid 18 : 1 13
Linolenic acid 18 : 3 8
Stearic acid 18 : 0 1
LIPID DEGRADATION AND STALING FLAVORS
The best‐known, and perhaps the most important, beer staling compound
is (E)‐2‐nonenal (also called trans‐2‐nonenal), an unsaturated nine‐
carbon aldehyde that contributes a stale cardboard flavor to beer at
concentrations as low as 50 ng/L (parts per trillion). Figure 3.14 shows
the overall reaction for the formation of (E)‐2‐nonenal from linoleic
acid, the most abundant fatty acid in barley. This reaction occurs in
multiple steps, some of which involve reactive oxygen species, like the
hydroperoxyl radical, HO2..
It is becoming clear that (E)‐2‐nonenal does not result from reactions
involving oxygen in the product packaging. Instead, it seems likely that
+ O2
Linoleic acid
(E)-2-Nonenal
Figure 3.14 (E)‐2‐Nonenal formation.
it and other staling compounds are formed by reactions with oxygen

earlier in the brewing process. The compounds become bound, possibly
to sulfites or amino acids, protecting them from being destroyed during
fermentation. The free compounds are then slowly released after pack-
aging, giving rise to stale off‐flavors in the beer.
Certain lipids are amphiphilic, meaning that they have both hydrophobic
and hydrophilic regions. Amphiphilic lipids can be water soluble, yet they
tend to associate with insoluble material. The majority of lipids are removed
during the brewing process with up to a 90% reduction in the lauter step.
Wort separation, specifically the lauter step, is the most important process
step for reduction of lipids and promotion of wort clarity. Wort turbidity is
specifically correlated with lipid content. The higher the concentration of
long‐chain fatty acids is in wort, the higher is the turbidity. Though greatly
reduced during the lauter, additional lipids are concentrated in the trub
after boiling. Lipids make up more than 50% of trub in the whirlpool. Some
trub carryover is beneficial to fermentation, because lipids are necessary
for yeast health. However, excessive lipids (i.e. turbid wort) will compro-
mise beer flavor and stability. For this reason, consistency in trub carryover
from the whirlpool to the fermenter is essential to ensure consistency in
fermentation and beer flavor.
Proteins
Proteins are easily the most complex of the biopolymer molecules, although
not the largest. Some proteins serve as structural components; some serve as
selective channels for molecules to pass through membranes; some respond
to molecules, light, or voltage and transmit information; some, called
enzymes, serve as catalysts that speed up reactions; and some of the smaller
ones serve as signaling molecules carrying messages from one part of an
organism to another.
MACROMOLECULES 83
Figure 3.15 Amino acid.
The basic structure of a protein is a linear polymer made from a sequence

of 20 different monomers called amino acids. The amino acids all have a car-
boxylic acid group, an amine group, and a group that is different for each
amino acid, known as the R‐group, because it is represented by the letter “R”
in the structure of a generic amino acid (Figure 3.15). The R‐group can be
classified by a variety of characteristics such as hydrophilic, hydrophobic,
positively or negatively charged, hydrogen bonding, bulky, or small. Structures
of the 20 amino acids and their chemical properties are shown in Figure 3.16.
Each amino acid may be specified by a single‐ or three‐letter code, which is
provided in Table 3.3. The amino (─NH2) group of one amino acid can con-
dense with the carboxyl (─COOH) group of another, as shown in Figure 3.2.
The resulting molecule still has a free amino group and a free carboxyl group,
so more amino acids can condense, giving a polymer of any length. Proteins
of any length have directionality; there is a single amino end, the N‐terminus,
and a single carboxyl end, the C‐terminus.
A linear, unbranched chain of amino acids is called a polypeptide. Short
polymers of 20–30 amino acids are called peptides. Polypeptides that are long
enough to fold into functional three‐dimensional structures can range from
100 to over 1000 amino acids and are called proteins.
In living systems, most proteins fold into three‐dimensional structures
based upon the specific sequence of amino acids and their chemical proper-
ties. There are four key components to a protein’s structure, which are illus-
trated in Figure 3.17:
1. The simple sequence of the amino acids in a protein is called the pri-
mary structure. Figure 3.17A shows the primary structure for the first 20
(of 639) amino acids in amylase from Aspergillus niger, a mold.
2. Defined, repeating structures within the whole protein are called the
secondary structure. Figure 3.17B shows an alpha helix (α‐helix) struc-
ture. Figure 3.17C shows a beta‐pleated sheet (β‐sheet) structure. The
α‐helix and β‐sheet are common motifs in protein secondary structure.
3. The folded three‐dimensional shape of the entire protein is called the
tertiary structure. Tertiary structure involves a specific arrangement of
secondary structures and results from interactions between amino acid
Polar R-groups
Asparagine Cysteine Glutamine
Proline Serine Threonine

Acidic R-groups (− charge)
Aspartic acid Glutamic acid
Basic R-groups (+ charge)
Arginine Histidine Lysine

Figure 3.16 The 20 amino acid monomers and their chemical properties.
MACROMOLECULES 85
Hydrophobic R-groups
Alanine Glycine
Isoleucine
Leucine Methionine Valine
Aromatic R-groups
Phenylalanine Tyrosine Tryptophan
Figure 3.16 (Continued)
R‐groups that hold parts of the chain together. These interactions may
consist of a hydrophobic core, electrostatic interactions, hydrogen bond-
ing, or disulfide bonds. In all cases, these key structural elements are
guided by the biochemical properties of the individual amino acids in
the sequence. For example, in a hydrophobic core, nonpolar amino acids
will cluster together to exclude water, while polar amino acids will ori-
ent to the water at the protein periphery. It is ultimately the tertiary
TABLE 3.3 The 20 Amino Acids and Their

Three‐ and One‐Letter Symbols
Name Symbols
Alanine Ala A
Cysteine Cys C
Aspartic acid Asp D
Glutamic acid Glu E
Phenylalanine Phe F
Glycine Gly G
Histidine His H
Isoleucine Ile I
Lysine Lys K
Leucine Leu L
Methionine Met M
Asparagine Asn N
Proline Pro P
Glutamine Gln Q
Arginine Arg R
Serine Ser S
Threonine Thr T
Valine Val V
Tryptophan Trp W
Tyrosine Tyr Y
structure that underlies the function of the protein. Figure 3.17D shows

the tertiary structure of a mashing enzyme, barley alpha‐amylase. If a
protein unfolds or denatures due to extreme conditions such as the
temperature of wort boiling, the tertiary structure is destroyed.
Denatured proteins are often unable to correctly refold; sometimes
they coagulate (form insoluble clumps) and precipitate out of solution.
Hot break during wort boiling is an example of protein denaturation
and coagulation.
4. Some protein complexes require multiple protein subunits to function.
This is called quaternary structure.
Free amine groups are essential to yeast health during fermentation. They
provide nitrogen to be used for synthesis of new organic molecules. Therefore,
it is essential to ensure that wort contains sufficient free amino nitrogen
(FAN). A large protein only contains one free amino group and thus does not
contribute significantly to FAN measurement. FAN primarily consists of
amino acids and short peptides. A minimum of 200 mg/L of FAN is needed
in wort to support healthy fermentation. FAN concentration greater than
M S F R S L L A L S G L V C T G L A N Y
(A)
O
R R R R
O C
-C-
-N R R R R
H
C
O
O C-N-C-
N-C- R R R R
C- H R H R
C-
R O R R R
O
N-C-C-N
C -C- H R H
- R
R R R R
N
H O
O
R R R
N-C-C
O
N -C-C- H R
C- H R
O R R R R
O -C-
C-C-NH R R R R
-N-
-C H R
C
R
H 2N-C
R
(B) (C) (D)

Figure 3.17 (A) Primary structure − first 20 amino acids in Apergillus niger amylase. (B) Secondary structure − alpha helix. (C)
Secondary structure – beta‐pleated sheet. (D) Tertiary structure − barley alpha‐amylase. Secondary motifs highlighted: red arrows
pleated sheet and green cylinder helix. Source: Data for drawing D: Kadziola et al. (1994).
87
350 mg/L may promote the formation of higher alcohols or staling flavors
through Strecker degradation, discussed in Section 12.3.
Nucleic Acids: DNA and RNA

Deoxyribonucleic acid, called DNA, is easily the largest biological polymer,
often containing millions of monomers. DNA is the repository for genetic
information; it carries the code for all the polypeptides in the cell. Ribonucleic
acid or RNA is structurally similar to DNA. RNA molecules are not as large,
because they are copied from segments of DNA. A primary function of RNA
is to carry the genetic code from the original source DNA to the cellular
structures that will produce proteins from the code. Other RNAs can partici-
pate directly in the synthesis of polypeptides, act as enzymes, or control gene
regulation.
Both DNA and RNA have the same underlying structure; they are poly-
mers of nucleotides. A nucleotide is described as having three modules. At
the center is a modified version of ribose, a five‐carbon sugar. In the case of
DNA, the hydroxyl group on carbon 2 in the ribose module (symbolized 2′,
pronounced “two prime”) is missing from the nucleotide, hence “deoxy.”
Attached to the modified sugar is one of five flat cyclic groups containing
nitrogen, called nucleobases, or bases for short. A phosphate group is attached
to the sugar on the 5′ carbon. The generic structure of a nucleotide is shown
in Figure 3.18.
The five bases, shown in nucleotides in Figure 3.19, are adenine (A), gua-
nine (G), cytosine (C), thymine (T), and uracil (U). Adenine, guanine, and
cytosine are in both DNA and RNA. Thymine is in DNA only and uracil is in
RNA only, so each of the nucleic acids has four different bases. The nucleo-
tides form polymers by condensation of the ─OH groups on the ribose to
those on the phosphate, as shown in Figure 3.20. The ─OH on the ribose is
attached to the 3′ carbon; the phosphate group is attached to the 5′ carbon.
DNA is transcribed in the direction from 5′ to 3′. The polymer backbone con-
sists of alternating ribose and phosphate units. The nucleobases are bound to
the ribose units, but not to one another.
The nucleic acid bases serve as information carriers; their sequences in
DNA and RNA ultimately control the sequences of amino acids in poly-
peptides produced in cells. They also play a critical role in cell reproduction.
Figure 3.18 Nucleotide. X = OH: ribonucleotide. X = H: deoxyribonucleotide.

A G
T C
U
Figure 3.19 Nucleotides. (A) Deoxyadenosine phosphate, (G) deoxyguanosine
phosphate, (T) deoxythymidine phosphate, (C) deoxycytosine phosphate, and (U)
uridine phosphate.
Ribose phosphate backbone
3’ 5’
A G T
T C A
5’ 3’
Ribose phosphate backbone
Figure 3.20 DNA section showing three deoxynucleotides – T, C, and A – and their
complementary base pairs.
TABLE 3.4 Differences Between DNA and RNA

DNA RNA
Typically double stranded Typically single stranded
Contains deoxyribose sugar Contains ribose sugar
Bases are A, T, C, and G Bases are A, U, C, and G
Located in nucleus and Produced in nucleus; transported into
mitochondria cytoplasm
The genetic blueprint The transcribed message for protein synthesis
A molecule of DNA serves as the template for a new molecule of DNA.

Any time a cell divides, it must make an exact copy of its DNA. Central to
the functions of nucleotides is the phenomenon of base pairing. The nucle-
obases stick together in pairs: adenine with thymine or uracil and guanine
with cytosine. These pairs of nucleotides are called complementary pairs.
The pairing is governed by hydrogen bonding. The spacing of hydrogen
bonding donors and acceptors on the nucleobases makes the preferred
pair more stable than other possible pairs. The bases recognize one another,
as shown in Figure 3.20 in which the hydrogen bonding that defines the
base pairs is shown with blue dashed lines. Because of base pairing, DNA
forms double strands that are antiparallel; the 5′ to 3′ direction for one
strand is opposite that of the other strand. The strands twist to form a dou-
ble helix, with about 1 complete turn for every 10 base pairs. By contrast,
RNA is stiffer than DNA because of the extra ─OH group on each ribose
unit, so RNA does not form a double helix, though it can form base‐paired
secondary structures. The differences between DNA and RNA are sum-
marized in Table 3.4.
3.2 MEMBRANES
Every living cell is surrounded by one or more membranes. Membranes form

selective barriers through which only some molecules can pass. Anything that
enters or leaves a cell must pass through a membrane. In yeast and other
eukaryotes, DNA is also protected by a membrane that forms a structure
called the nucleus. Yeast cells have additional membrane‐bound structures
called organelles, which will be discussed in Section 3.4. A membrane not
only protects and defines the boundaries of a cell from its environment, but it
also permits interaction in a controlled way. Cells control what enters and
exits the cell, a process controlled by the properties and composition of the
membrane.
MEMBRANES 91
Lipid Bilayer
The basic structure of a membrane consists of two layers of phospholipid mol-
ecules, called a lipid bilayer, assembled as shown in Figure 3.21. The
phospholipid molecules, an example of which is shown in Figure 3.22, have a
hydrophilic head and two hydrophobic tails. The hydrophilic character is
provided by a phosphate ester with a negative charge and, in many cases, by a
tertiary amine with a positive charge. The tails are long‐chain fatty acids such
as oleic (18 : 1) and palmitic (16 : 0) acids. The phospholipids are organized
with the heads in the watery medium inside and outside of the cell or organelle,
and the tails make up the 7–10 nm thick interior of the membrane.
The fluidity, which is the ease of flow, of the membrane is influenced by the
presence of double bonds in the tails that introduce kinks and weaken the
interactions among adjacent tails and by the presence of sterols. Sterols
Figure 3.21 Membrane structure. Source: From Barth (2013). © 2013 Wiley. Used
with permission.
Tails
Head
Figure 3.22 Membrane phospholipid.

Figure 3.23 Ergosterol.
are flat, four‐ring, mostly hydrophobic molecules that congregate among the

phospholipid tails. The most important sterol in yeast membranes is ergos-
terol, shown in Figure 3.23. Oxygen is required during early fermentation to
promote phospholipid and sterol synthesis and integrity during cellular
division.
Membranes in cells have a variety of attached proteins. These serve several
functions including catalyzing reactions, transmission of material, transmis-
sion of information, and anchoring the cytoskeleton, a system of molecular
ropes that organizes the cell contents. Certain proteins may span the entire
phospholipid bilayer, forming channels through which specific molecules can
pass. In addition to proteins, the membrane contains chains of carbohydrates
or modified carbohydrates. Present on the outer surface of cells, these carbo-
hydrate groups are attached to proteins, forming glycoproteins.
Cell Wall
Plants, bacteria, and fungi have another structure called the cell wall that sur-
rounds each cell. The cell membrane is sometimes mistakenly called a cell
wall. In plants like barley and fungi like yeast, the cell wall is outside of the
cell membrane. Gram‐negative bacteria have two cell membranes, one of
which is inside the cell wall and the other is outside. The major function of the
cell wall is to provide strength and structure to the cell within. Yeast and bac-
terial cell walls help the cells resist deformation or bursting under osmotic
pressure. Cell walls of land plants also provide mechanical strength to allow
the plant to stand against gravity and wind.
The yeast cell wall contains an abundance of polysaccharides and carbohy-
drate‐modified proteins called mannoproteins. The polysaccharides typically
consist of mannose, chitin (KYE‐tin), which is like cellulose, but with some
─OH groups replaced with ─NH─(C═O)─CH3, beta(1→6)glucan, and
beta(1→3)glucan. In plants like barley, cell walls contain cellulose and hemi-
cellulose. Although cellulose is insoluble, hemicellulose is soluble and can be
a source of undesirable carbohydrates, as mentioned earlier in Section
“Carbohydrates.”
CELLULAR STRUCTURES 93
3.3 CELLULAR STRUCTURES
A cell is the basic biological and structural unit of life. First discovered in 1665
by Robert Hooke, the term was coined after he examined cork under a micro-
scope, as the shapes reminded him of the cells in a monastery.
There are two major types of organisms, prokaryotes and eukaryotes, that
are distinguished by their cells. Prokaryotic cells do not contain a membrane‐
bound nucleus, while eukaryotic cells do. Bacteria like Lactobacillus and
Pediococcus are prokaryotes; animals, plants, yeast, and human brewers are
eukaryotes. Another difference between prokaryotes and eukaryotes is the
organization of their DNA. Eukaryotes contain multiple linear strands of
DNA organized into chromosomes; prokaryotes contain one large, circular
piece of supercoiled DNA. Finally, eukaryotes contain membrane‐bound
organelles; prokaryotes do not. An organelle is a specialized membrane‐
enclosed structure within a cell. Each organelle performs a specific biological
function. The membrane around each organelle isolates or protects its func-
tions from other parts of the cell, serving to compartmentalize key enzymes
and signaling pathways. For example, the nucleus protects the DNA and
serves as the site for replication and transcription.
In addition to organelles, the cell is filled with liquid cytosol (also called
cytoplasm). Table 3.5 lists organelles found within eukaryotes like yeast.
A model yeast cell is depicted in Figure 3.24.
The nucleus is a round organelle about 1.5 μm in diameter in which the
genomic DNA is protected from the rest of the cell. The nucleus is separated
from the cytoplasm by its own phospholipid bilayer membrane called the
nuclear envelope. In this membrane are nuclear pore complexes, which are
proteins that form channels across the membrane for controlled exchange of
materials. From the DNA‐based genes, messenger RNA (mRNA) is produced
TABLE 3.5 Organelles in Eukaryotes

Organelle Function
Nucleus DNA storage and protection
Mitochondria Energy production (aerobic respiration)
Smooth endoplasmic Lipid production; detoxification
reticulum
Rough endoplasmic Protein production and processing
reticulum
Lysosome Protein breakdown and recycling; not found in yeast
Peroxisome Lipid breakdown; oxidative
Golgi apparatus Protein tagging and export
Vacuole Stores excess water and waste; serves a lysosome‐like
function in yeast
Smooth ER
Cell wall Peroxisome
Ribosome
Golgi
Mitochondrion
Bud scar
Rough ER
Vacuole Cell Nucleus

membrane
Figure 3.24 Structure of a yeast cell.
by transcription within the nucleus. mRNA is then transported across the

nuclear envelope and translated into protein in the cytoplasm. Within the
nucleus is the nucleolus. This dense region of DNA encodes and transcribes
the RNA that will become the ribosomes.
Ribosomes are not membrane‐bound organelles but rather complex parti-
cles consisting of ribosomal RNA (rRNA) and proteins. They bind mRNA
and are responsible for the process of translation, the formation of proteins.
The endoplasmic reticulum (ER) is a highly continuous and branched
network of tubules attached to the nuclear envelope. All transmembrane pro-
teins and proteins exported outside of the cell are processed within the ER.
Ribosomes loosely associated with the cytosolic side of the ER translate pro-
teins into the ER. From there, these proteins are folded and packaged into
small membrane‐bound vesicles that translocate to the Golgi apparatus.
The Golgi apparatus contains several stacks of membrane‐bound com-
partments. After receiving newly folded proteins from the ER, the Golgi
facilitates posttranslational modifications such as glycosylation, lipidation,
and phosphorylation. Vesicles containing improperly folded proteins will
return to the ER for further folding assistance. This is an important check-
point to ensure that misfolded proteins are not released.
The vacuole is a compartment in yeast in which proteins are recycled. In
this organelle, proteases break down proteins into amino acids that can be
reused by the cell. As the yeast cell ages, the vacuole increases in size. In a
healthy yeast cell with sufficient nutrients, the vacuole may take up 20–30%
of the cellular space, but in stressed or nutrient‐starved yeast, the vacuole can
grow to be 70% of the cellular volume.
The mitochondrion (pl. mitochondria) is known as the powerhouse of the
cell. This organelle is surrounded by an outer membrane and contains an
THE CENTRAL DOGMA 95
inner membrane that folds upon itself to increase surface area. This surface
area is important because the inner membrane is the location of aerobic res-
piration and the production of ATP. Mitochondria also contain DNA that
encodes proteins specifically for the mitochondria.
The peroxisome is a small organelle that breaks down lipids and facilitates
the reduction of reactive oxygen species, like hydrogen peroxide, that would
otherwise be harmful to the cell.
3.4 THE CENTRAL DOGMA
The central dogma of molecular biology describes the movement of genetic

information in biological systems and was first defined by Francis Crick in
1958. As an oversimplification, DNA makes RNA, and RNA makes protein.
A portion of a DNA molecule that contains the information for a single
protein is called a gene. Using these macromolecules, biological information
is passed from the code (DNA) through a messenger (mRNA) and into a
functional protein.
All living cells use three primary steps to execute this transfer of informa-
tion. DNA can make a copy of itself (DNA replication), genes can be written
into a messenger RNA called mRNA (transcription), and mRNA can be
interpreted into a protein (translation). As we will discuss below, this transfer
of information protects and preserves the DNA code in the nucleus. At each
stage of information transfer, there are several opportunities to change the
activity of genes and the amounts of proteins they produce. Understanding
these basic concepts of biology in yeast will help the brewer better under-
stand the importance of yeast health, as changes in yeast lead to changes in
beer. Though all mechanisms are generally shared between prokaryotes and
eukaryotes, here we primarily focus on eukaryotes to which yeast belong.
DNA Replication
DNA replication is the process by which a single DNA macromolecule is
identically copied into two. As a cell divides, it must replicate its DNA; thus
the major purpose of DNA replication is genetic inheritance. Because DNA
contains genes, accurate and highly precise copying of DNA is critical to the
persistence of new cells. DNA replication is semiconservative, which means
that replicated DNA contains one new strand and one strand that is
conserved from the original molecule. This occurs because both strands of
the original DNA double helix act as templates for the new strands.
Semiconservative replication is modeled in Figure 3.25. DNA replication
only occurs when a cell is actively dividing.
Figure 3.25 Semiconservative DNA replication. Green: original strand. Red: repli-
cated strand.
As DNA makes RNA, which makes protein, the specific sequence of

nucleotides in the DNA begets the final sequence of all proteins and thus is
critical to the function and identity of the organism. If the DNA sequence
changes, the protein sequence changes. Because the amino acid sequence is
essential for protein structure and function, changes to the DNA sequence
could negatively impact yeast performance. It is therefore essential that the
process be precise and perfect, introducing no base pair changes or mutations.
DNA replication is so precise that experimental methods in Saccharomyces
cerevisiae measured a genome‐wide single‐nucleotide mutation rate at 1.67 ±
0.04 × 10−10 per base per generation. The S. cerevisiae genome is 12.1 million
base pairs in length; thus for one yeast cell division, there is only about 1
chance in 500 of a mutation.
The reason for DNA replication precision is the molecular machinery of
the process. A helicase separates the double helix, while a topoisomerase
unwinds the double‐stranded template DNA to prevent supercoiling. Single‐
stranded binding proteins keep the individual strands separated. RNA pri-
mase is an enzyme that adds a short RNA primer that is complementary to
the DNA sequence. DNA polymerase III then binds to the double‐stranded
DNA–RNA section and initiates DNA replication by adding nucleotides to
the 3′ end of the polymerizing DNA strand. DNA and RNA are always syn-
thesized in the 5′ to 3′ direction. The nucleotide added to the new strand will
be complementary to the nucleotide of the old strand being copied. The
energy for this addition is generated by hydrolysis of triphosphate on the free
nucleotide being added. In linear DNA molecules, like the chromosomes in
yeast, the process ends when the DNA polymerase falls off the end of the
DNA molecule. DNA polymerase I then replaces the RNA primer with
DNA. DNA replication is modeled in Figure 3.26.
Direction of
replication
Single-stranded
binding protein 5’
RNA primer
Helicase
DNA polymerase III
Topoisomerase 5’
3’
Direction of
A C G T U replication
Figure 3.26 DNA replication.
Transcription
Transcription is the process through which a segment of DNA, called a gene,
is copied into mRNA. A gene is a specific sequence of DNA that is responsi-
ble for the amino acid sequence of a specific polypeptide. In yeast and other
eukaryotes, DNA is protected within the cell’s nucleus. The machinery
responsible for making protein is found in the cytoplasm, which is outside of
the nucleus. Transcription synthesizes mRNA that carries the code from the
nucleus to the cytoplasm.
Transcription is orchestrated by an enzyme called RNA polymerase. RNA
polymerase reads one strand of the DNA helix as a template to create a com-
plementary RNA strand. As with all nucleotides, polymerization occurs in the
5′ to 3′ direction. There are three major stages of transcription.
First, during initiation, RNA polymerase binds to a specific region of the
gene called the promoter. Binding separates the double‐stranded DNA helix,
making one strand accessible for transcription. Second, during elongation,
the RNA polymerase will scan the strand of DNA, making a complementary
copy of RNA. RNA uses the same bases as DNA except that uracil (U) is
used instead of thymine (T). Finally, during termination, a specific DNA
sequence causes the RNA polymerase to stop. This is often caused by the
formation of an RNA stem loop structure in which internal base pairing of
the RNA transcript halts the processing by the RNA polymerase. When the
RNA polymerase stops moving, it falls off the DNA template. This process is
modeled in Figure 3.27. mRNA is further distinguished by addition of a 7‐
methylguanosine cap on the 5′ end, called the 5′ cap, and a long p
olyadenylated
Promoter Direction of transcription Terminator
5’
3’
RNA polymerase
Gene
5’
3’
5’
mRNA
5’
3’
5’ cap
Poly A tail
Figure 3.27 Transcription.
3′ end, called the poly A tail. The DNA gene will act as a template for many
more mRNA copies, leading to an amplification of the signal, to be further
amplified during the next step, translation.
Translation
Translation interprets the mRNA sequence and turns it into a polypeptide
from within the cytoplasm. This information is encoded in codons, which are
sets of three consecutive nucleotides. The genetic code is made up of 64 dis-
tinct codons. Of these, 61 encode an amino acid, and three serve as stop sig-
nals, shown in red, that terminate translation. Only one codon, AUG (which
also encodes methionine), acts as the starting translation signal (shown in
green). The genetic code for mRNA is shown in Table 3.6.
Translation involves two main pieces of machinery, both of which contain
RNA. Transfer RNAs (tRNAs) interpret the mRNA codons into an amino
acid sequence. Within the tRNA is a complementary anticodon, which recog-
nizes the mRNA codon through complementary base pairing. Each specific
tRNA, defined by its anticodon, is attached to an amino acid, the identity of
which is specified in the genetic code. The removal of the amino acid from
the tRNA and the subsequent formation of the peptide bond on the
amino‐terminus of the growing polypeptide are catalyzed by the ribosome.
TABLE 3.6 The mRNA Genetic Code

Second letter
U C A G
UUU Phe UCU Ser UAU Tyr UGU Cys
UUC Phe UCC Ser UAC Tyr UGC Cys
U UUA Leu UCA Ser UAA Stop UGA Stop
UUG Leu UCG Ser UAG Stop UGG Trp
CUU Leu CCU Pro CAU His CGU Arg
CUC Leu CCC Pro CAC His CGC Arg
C
First letter
CUA Leu CCA Pro CAA Gln CGA Arg

CUG Leu CCG Pro CAG Gln CGG Arg
AUU Ile ACU Thr AAU Asn AGU Ser
AUC Ile ACC Thr AAC Asn AGC Ser
A AUA Ile ACA Thr AAA Lys AGA Arg
AUG Met ACG Thr AAG Lys AGG Arg
GUU Val GCU Ala GAU Asp GGU Gly
GUC Val GCC Ala GAC Asp GGC Gly
G GUA Val GCA Ala GAA Glu GGA Gly
GUG Val GCG Ala GAG Glu GGG Gly
The ribosome is a multi‐complexed entity that contains both rRNA and

protein. The ribosome contains a large subunit and a small subunit that
sandwiches the mRNA, forming the active site.
In the first stage of translation called initiation, ribosomes are loaded onto
mRNA on the 5′ end, moving in a 5′ to 3′ direction. The ribosome is activated
when the first start codon, AUG, is encountered. During the second stage of
translation, elongation, the ribosome continues in a 5′ to 3′ direction along
the mRNA, catalyzing the formation of the polypeptide. In the ribosome,
there are three active sites, called A (acceptor), P (peptidyl), and E (exit),
through which the polypeptide is formed. In the A site, the tRNAs cycle in
and out of position until the correct combination of anticodon and codon is
found. The ribosome catalyzes the formation of a peptide bond from the
amino acid bound to tRNA at the P site (at the near end of the peptide chain)
to the new amino acid in the A site, transferring the chain to the A site. The
tRNA in the P site becomes empty. Then the ribosome moves in the 3′ direc-
tion to bring the A site to a new codon, the P site to the growing chain, and
the E site to the empty tRNA, which loses affinity for the ribosome and exits.
In this manner, the ribosome will translate the mRNA into a full‐length poly-
peptide by moving 5′ to 3′ from the start codon to the first stop codon. The
first stop codon causes ribosome disassembly through recruitment of a termi-
nation factor. A model of translation is shown in Figure 3.28.
Codon
A U G G A
G U U C A G U G mRNA
C U U A A A A A
Met Gly Stop
Ile Arg Lys
Leu
New protein
chain
Ribosome tRNA with
large unit lysine
E P A
Anticodon
mRNA
CCG UCU UUU
AUGCUUAUUGGCAGAAAAUGA
Ribosome
small unit
Direction of translation
Figure 3.28 Translation.
So now that we have a full‐length polypeptide, are we finished? Sometimes.

During translation, as a polypeptide exits the ribosome, it can sometimes fold
on its own. But other polypeptides need folding assistance by way of chaper-
one proteins. A full‐length polypeptide rarely exists without tertiary struc-
ture; there is always some degree of protein folding; thus when a protein is
denatured, by boiling for example, it is nearly impossible for it to refold to its
original structure. Hot break results from the inability of proteins to refold.
Posttranslational modifications can further influence protein folding, sta-
bility, and functionality. These include attachment of small molecules through
condensation with phosphate (phosphorylation), with acetate (acetylation),
or with glucose or its polymers (glycosylation). Covalent disulfide bonds
may form between sulfur‐containing amino acids, stitching together distant
parts of the molecule. And finally, some proteins are expressed as precursors
called pro‐proteins, which are not active until parts are chopped out by pro-
teolysis (hydrolysis of proteins) at a specific amino acid sequence. A new
polypeptide also needs to find its proper location within or outside the cell.
Specific signal sequences on the N‐ or C‐terminus of a polypeptide may be
used to direct shuttling of the protein to intracellular locations or to extra-
cellular secretion.
Regulation of Gene Expression

The process of creating an mRNA copy of a gene and translating it into pro-
tein is called gene expression. Although all cells of the human body have the
same DNA, they become differentiated by the types and relative amounts of
Gene
accessibility
DNA
Transcription
control
RNA
Nucleus
Regulation of
Nuclear Envelope mRNA transport
Cytoplasm
Regulation of
mRNA stability
RNA
Protein Translation
control
Posttranslational
modification
Protease
Figure 3.29 Control of gene expression in eukaryotes.
proteins produced. For example, a muscle cell has different proteins than a
brain cell. These differences are the result of gene regulation. Yeast, being
single‐cell organisms, do not need to differentiate into tissues; they must
nonetheless regulate their gene expression to meet external and internal con-
ditions. For example, yeast cells that are actively dividing on the first day of
fermentation express a completely different set of genes than yeast after the
end of fermentation. On the first day of fermentation, a yeast cell needs to
express, or turn on, genes responsible for cellular division, but after fermenta-
tion is complete, the yeast cell must focus on survival by activating stress
response genes, promoting survival in an environment with insufficient nutri-
ents. If the yeast were unable to regulate or change gene expression, the cells
would continue to divide without sufficient nutrients, leading to cell death.
Plus, they would make bad beer! Every step of gene expression, from the
DNA sequence to the final protein, is fine‐tuned by mechanisms of gene reg-
ulation. A summary of different areas in which a gene can be regulated is
illustrated in Figure 3.29.
But how does a cell “know” which genes to activate and how to regulate
them? Molecular pathways in the cell convey information that influences
gene expression. Signaling from inside or outside of the cell can activate these
pathways. The inherited DNA of the yeast as well as existing proteins that
came from the mother cell will influence inside signaling. But a major part of
gene regulation is the ability of a cell to respond to signals from the environ-
ment outside of the cell. These signals may be hormones, proteins, nutrients,
1. Molecule binds
to receptor
Outside cell
Cytoplasm
7. mRNA 2. Signaling
translated cascade
3. Transcription
factor activated
Nucleus
4. Bound TF
activates gene
5. Gene transcribed
6. Nonactivated gene
not transcribed
Figure 3.30 Transcription factor signaling.
or other chemicals. Here a specific signal reacts with a protein on the cell
surface called a receptor, which activates a chemical cascade inside the cell
that reaches into the nucleus. The molecular signaling cascade activates tran-
scription factors that bind to specific regulatory DNA sequences before a
gene. Transcription factor binding recruits and activates the transcriptional
machinery, creating new mRNA and leading to new protein expression. This
process is generalized in Figure 3.30 and is the primary example of transcrip-
tional control of gene regulation.
While transcription factor signaling is a general concept shared by many
genes, the details of each signaling pathway vary for every gene and are still
active areas of study. This type of control illustrates how different genes can
be regulated at the transcriptional level. Genes may be either “turned on” or
“turned off” by environmental stimuli but can also be fine‐tuned as to how

much mRNA or protein is made. More mRNA often means more protein.
mRNAs are also regulated by stability. Some mRNA transcripts are very
stable, while others quickly degrade. Stable mRNAs can be translated repeat-
edly, producing more and more protein. One of the factors that affects mRNA
stability is the presence of small regulatory RNAs (sRNAs). These noncoding
RNAs are genetically encoded in DNA but do not produce a functional
protein. Instead, they act through complementary binding to an mRNA,
leading to its degradation. MicroRNAs (miRNA) were among the first

sRNAs to be discovered. These short transcripts form a hairpin loop through
complementary base pairs within the molecule. The loop structure is recog-
nized by enzymes that then create a small single‐stranded miRNA of about
22 base pairs. The miRNA binds to target mRNAs through complementary
base pairing. Perfect matches are quickly degraded. Thus miRNAs provide a
means to regulate gene expression through the targeted degradation of
specific mRNAs.
And finally, gene expression is regulated at the translational and protein
levels. Generally, there are support proteins that bind to specific mRNAs that
can either promote or inhibit translation. These proteins typically affect ribo-
some loading onto the mRNA and subsequent translation initiation. Once
translated, proteins will be quickly degraded by the proteasome if they are
unfolded or tagged with a posttranslational modification called ubiquitin.
Other posttranslational modifications include proteolysis, phosphorylation,
acetylation, and glycosylation.
1. What are the four classes of biological macromolecules? For each,

describe the nomenclature, structure, and function of the most common
monomers and polymers.
2. For each of the macromolecules, describe its role or influence on the
brewing process, and give specific examples of each.
3. There are two types of starch in barley malt. Give their names, and explain
how they differ in structure, relative abundance, and contribution to beer
production.
4. Maltose is fermentable. Lactose is unfermentable. What is the molecular
difference between these two disaccharides?
5. Which common barley carbohydrate is most undesirable during the brew-
ing process due to its effect on wort viscosity? How does its structure lead
to this behavior?
6. Describe the structure and function of the plasma membrane. What

biochemical properties of lipids enable the formation and function of
cellular membranes?
7. What is the flavor of the staling molecule trans‐2‐nonenol? How can it
be avoided in beer?
8. For each of the following amino acids, describe their biochemical
properties (i.e. polar, nonpolar, acidic, basic, etc.). With which type of
intermolecular force are they likely to influence protein folding?
a. Glycine
b. Alanine
c. Glutamic acid
d. Serine
e. Cysteine
9. What is the relative composition of hot break material after the boil?
Why does it form?
10. What is the purpose of the following organelles in yeast?
a. Nucleus
b. Mitochondrion
c. Lysosome
d. Golgi body
11. What are the differences between DNA and RNA?
12. Describe the central dogma using essential terminology for each step.
13. Considering the various methods for regulation of gene expression in a
cell, describe some differences in the central dogma which could vary by
yeast strain and influence fermentation performance or flavor.
BIBLIOGRAPHY
Barth R. The Chemistry of Beer: The Science in the Suds. 2013. Wiley. ISBN
978‐1‐118‐67497‐0. p. 117.
Feldman H (editor). 2012. Yeast: Molecular and Cell Biology, 2nd ed. Wiley‐Blackwell.
ISBN 978‐3‐527‐33252‐6.
BIBLIOGRAPHY 105
Kadziola A, Abe J, Svensson B, Haser R. 1994. Crystal and molecular structure of bar-
ley alpha‐amylase. J. Mol. Biol. 239(1): 104–121.
Kuhbeck F, Back W, Krottenthaler M. 2006. Influence of lauter turbidity on wort com-
position, fermentation performance and beer quality – a review. J. Inst. Brew.
112(3):215–221.
Zhu YO, Siegal ML, Hall DW, Petrov DA. 2014. Precise estimates of mutation rate and
spectrum in yeast. Proc. Natl. Acad. Sci. U. S. A. 111(22):E2310–E2318.
Chapter 4
RAW MATERIALS
There are just four essential ingredients in beer: water, malt, hops, and yeast.
Yeast is an ingredient, but not really a raw material because most of it is
grown in the brewery. We discuss its biology and processing in Chapters 3
and 9. Sources of starch or sugar other than malt are adjuncts. Other items
used for brewing such as enzymes, filtration media, and finings (clarifying
agents) are processing aids. We discuss adjuncts and processing aids in subse-
quent chapters.
Quality beer cannot be made without quality ingredients. It is essential to
understand the impact that each of the four major ingredients has on the
finished product. Raw materials should be regularly inspected for quality.
Brewers should take every opportunity to evaluate their raw materials. They
should chew on malt, smell hops, taste water, and visually inspect yeast. The
impact of quality and more detailed methods of assessment for each of
the raw materials are discussed in this chapter.

107
108 RAW MATERIALS
4.1 WATER
Water is the matrix of all life as well as the major component of beer. Water
and ethanol are the only two beer components that exceed 1%. In contrast to
wine, the water in beer is an ingredient; it is added during brewing. This makes
it convenient to ship the dry ingredients to a brewery near the consumers and
use locally available water. Wine, on the other hand, is prepared near the
source of grapes, and the finished product must be shipped at great expense
to the point of use.
Water Chemistry
Water is unique in many ways. It is the only common substance that can exist
as a solid, liquid, or gas at ordinary temperatures. It is one of the few substances
that expands on freezing; as a solid, it floats. Water requires an unusually high
energy input to increase its temperature (specific heat capacity = 4.18 J K−1 g−1),
melt it (heat of fusion = 334 J/g), and boil it (heat of vaporization = 2230 J/g).
These properties and its low price make water an ideal material for heat
transfer.
Hydrophilic/Hydrophobic The water molecule in the liquid and gas phases

is bent with an H─O─H bond angle of 105°; water in ice has a nearly ideal
tetrahedral angle of 109.5°. This bond angle gives water molecules an oxygen
end and a hydrogen end, as shown in Figure 4.1. Because oxygen is much
more electronegative than hydrogen, the shared electrons are attracted to the
oxygen end, making water a polar molecule. Water molecules can form
hydrogen bonds with one another and with other molecules, especially those
with ─OH or ─NH bonds. The dipole–dipole and hydrogen bonding
interactions between water molecules hold them together strongly in the
liquid phase. To allow a foreign molecule to take a position among the water
molecules, these forces must be overcome, so the water molecules can be
pulled away from one another to make room. If the foreign molecule can
form strong dipole–dipole or hydrogen bonding interaction with water, the
water–water forces are replaced with water–foreign molecule forces, keeping
the energy in balance. Substances whose molecules form strong intermolecular
H H
+
Figure 4.1 Water.

WATER 109
interactions with water are said to be hydrophilic. Substances that do not

form strong intermolecular forces with water are squeezed out of the water
matrix, allowing the water molecules to interact with one another. Such
substances are hydrophobic. Sometimes parts of a molecule are hydrophilic
and other parts are hydrophobic. In water, molecules tend to take positions
that put the hydrophilic parts in contact with the water and the hydrophobic
parts in contact with one another. This effect is responsible for the organization
of membranes around cells, the details of protein folding, and the stabilization
of foam on beer.
Acids, Bases, and pH Acid–base chemistry plays a dominant role in

processes in water solutions, like beer brewing. An acid–base reaction involves
the transfer of a hydrogen ion, H+. The significance of the hydrogen ion is that
a hydrogen atom consists only of one proton and one electron. When the
hydrogen atom loses the electron, only the proton remains. So an acid–base
reaction involves the transfer of a fundamental subatomic particle, the proton.
An acid provides a proton (H+); a base accepts a proton. A complete acid–
base reaction needs both an acid and a base.
The reaction of a generalized acid, HA, with water is
HA H 2O A H 3O
H3O+, the hydronium ion, is the signature of an acid in water. If this reac-
tion goes to near completion, so that no HA remains, the acid is considered a
strong acid. If the reaction only goes part way, the acid is a weak acid.
The reaction of a generalized base with water is
B H 2O HB OH
OH−, the hydroxide ion, is the signature of a base in water. There is a simi-
lar distinction between strong and weak bases. In both cases, the charges are
relative. The acid starts out neutral or charged, but after it loses a proton, its
charge decreases by one. The charge on the base increases by one when it
accepts the proton. In the acid reaction, the proton is accepted by water;
water acts as a base. In the base reaction, water provides the proton; water
acts as an acid. Water can behave either as an acid or as a base. One water
molecule can even accept a proton from another water molecule:
H 2 O H 2 O  H 3O OH
The double arrow shows that the reaction goes only part way to prod-
ucts. This reaction proceeds to a tiny but important extent, giving H3O+
and OH− concentrations of 1.0 × 10−7 mol/L at room temperature in pure water.
110 RAW MATERIALS
Le Châtelier’s principle tells us that increasing the concentration of H3O+ will

cause a shift to reactants, so the concentration of OH− decreases. Similarly, a
high concentration of OH− will be accompanied by a low concentration of
H3O+. Le Châtelier’s principle also applies to the acid and base equations
above. For the equation HA + H2O → H3O+ + A−, increasing H3O+ causes the
reaction to shift toward reactants, lowering the concentration of A− and rais-
ing that of HA.
An important practical consequence of Le Châtelier’s principle is illus-
trated in Figure 4.2. In Figure 4.2A the concentration of H3O+ is high. The
acidic groups retain their protons, and the basic groups accept protons. In
Figure 4.3B the concentration of H3O+ is low; acidic groups lose protons and
basic groups are unchanged. The result is that under acid conditions (high
H3O+), the molecule becomes more positive and less negative. The charging is
reversed in base (low H3O+) conditions. If the molecules in this example were
enzymes needed to convert starch to sugar, the correct balance between acid-
ity and basicity would have a big effect on enzyme activity.
pH is a measure of acidity in solution. If the concentration (technically an
effective concentration called the activity) of H3O+ is 10–4 mol/L, the pH is 4.
If the concentration is 10–9 mol/L, the pH is 9. A neutral solution at 25 °C has
a pH of 7. Acidic solutions have a low pH; basic solutions have a high pH. To
extend the calculation to numbers that are not whole number powers of 10,
we define pH by an equation:
pH log H 3O

The square brackets denote the concentration of the item. The pH concept
was put forward in 1909 by Søren Sørensen of the Carlsberg laboratory.
The modern pH meter was invented by Arnold Beckman in 1934. Unlike
earlier scientific instruments that occupied an entire lab bench or more,
Beckman’s meter was self‐contained, portable, and fit into a small wooden box.
It used an electronic amplifier to capture the weak signal from the pH probe
AH
AH
BH +
BH + (A)
–
A
A–
B
B
(B)
Figure 4.2 Acidity effect. (A) High H3O+ and (B) low H3O+.
WATER 111
and displayed the result on a meter. Today’s pH meters use the same type of
sensor, but some of them are small and rugged enough to fit into one’s pocket.
The lowest water pH possible, but not actually attainable, is −1.7. This
would require every water molecule to bind a hydrogen ion. The highest pH
possible, also not attainable, is 15.7. This would require every water molecule
to donate a hydrogen ion. Most pH meters measure in the range of pH 1–14,
the typical pH range encountered in brewing applications.
ACID–BASE EQUILIBRIUM
The reaction 2H2O ⇆ H3O+ + OH− is governed by the equilibrium

expression
H 3O OH Kw
At 25 °C Kw is the equilibrium constant for water ionization, 1.0 × 10−14.

This means that if the concentration of hydronium ion is high, the con-
centration of hydroxide ion must be low. In a neutral water solution, the
concentrations are equal and, at 25 °C, are 1.0 × 10−7 mol/L. Using some
properties of logarithms and coining the expression p(anything) = −log
(anything), we can write the above equation as
pH pOH pK w
At 25 °C, pKw = 14 so pH + pOH = 14. The concentrations of hydro-

nium ion and hydroxide ion are not independent. If we know one, we
know the other.
The acid reaction is
HA H 2 O A H 3O
We can write the equilibrium expression
H 3O A
Ka
HA
keeping in mind that the solvent, H2O, does not enter the equilibrium
expression. Ka is the acid dissociation equilibrium constant. We can solve
this equation for [H3O+] and perform some logarithmic algebra to get
A
pH pKa log
HA
(continued)
112 RAW MATERIALS
This equation, called the Henderson–Hasselbalch equation, tells us

that the pH depends only on the ratio of the acid and anion concentra-
tions. If these are much larger than the concentrations of hydronium
and hydroxide ion, we can use the initial concentrations without having
to correct for conversion of acid to base or base to acid. When the A−
and HA concentrations are equal, the argument of the log (the number
we take the log of) is 1. The log of one is zero, so pH = pKa.
Example: pKa for lactic acid, often used to give beer a tart taste, is 3.86.
If the concentration of lactic acid is 0.05 mol/L and that of lactate ion is
0.25 mol/L, calculate the pH of the solution.
Answer:
0.25
pH 3.86 log 4.56.
0.05
Example: A sample of beer has pH = 4.2. The lactate ion concentration

is 0.003 mol/L. Calculate the concentration of lactic acid (LA).
Answer:
0.003 0.003
4.2 3.86 log 4.2 3.86 log 0.34
LA LA
0.003
100.34 2.19; LA 0.0014 mol/L
LA
Ions in Water Many ionic compounds are soluble in water, at least to some
extent. Although the separation of ions of opposite charge to disperse them
in solution requires a large input of energy, much of this energy can be
recovered because of ion–dipole interactions with water, as shown in a
simplified way in Figure 4.3. Stabilization of ions or molecules by water is
called hydration.
Water used for brewing contains dissolved ions constituting tens to hun-
dreds of milligrams per liter (ppm). Some of these ions affect beer flavor
depending on style, and some create off‐flavors or processing issues. Some
ions are required to keep yeast healthy. Common ions in water, their effects
on beer, and recommended concentrations are listed in Table 4.1.
Alkalinity Alkalinity is the measure of the amount of basic substances

dissolved in water. It is a different concept from pH. Water containing
0.001 mol/L hydroxide ion has a pH of 11. Water containing the same molar
WATER 113
–
+
–
+
+
–
– + – + –
+ –
+
+ – + –
+
+
–
–
–
–
–
+
+
+
– +
+
+
–
Figure 4.3 Hydration of ions.
concentration of sodium bicarbonate has a pH of 8.7. Both have the same

alkalinity. The alkalinity is defined by the amount of hydronium ion needed
to neutralize the base. In both examples it would take 1 mmol (0.001 mol)
of hydronium ion to neutralize 1 L of water. We will discuss alkalinity
measurement and units of alkalinity in the next section.
The acceptable range of pH for mashing is 5.2–5.6. Malt provides acids, par-
ticularly in the form of phosphate esters, that neutralize some of the water
alkalinity, lowering the pH to a range that provides good activity of the mashing
enzymes. If the alkalinity is too high, there may not be enough acid in the malt
to neutralize it, and mashing effectiveness will suffer as the pH will be higher
than 5.6. Darker malt is more acidic than pale malt, so localities with alkaline
water often favor darker styles of beer. There are several ways to lower alkalin-
ity, some of which are discussed in Section “Water Quality and Processing.”
Hardness Hardness in water refers to the concentration of metal ions

whose charge is +2 or higher, typically calcium and magnesium. Hardness has
both desirable and undesirable effects on beer brewing. Hardness causes a
modest decrease in the mash pH by reacting with phosphate‐containing
compounds from the malt according to the simplified reaction 3Ca2+ +
2H2PO4− + 4H2O→ Ca3(PO4)2 + 4H3O+. The situation is not so simple;
phosphate in malt exists mostly in bound forms, and there are several calcium
phosphate and calcium hydroxyphosphate compounds that can form. The net
result is that the acidifying effect of hardness is much less than would be
predicted by the simplified equation.
Calcium ions help the mashing enzymes avoid denaturation. Hardness can
also remove undesirable oxalate ions (C2O42−), which are derived from grain
hulls. When subjected to boiling, oxalate ions can form difficult‐to‐remove
deposits called beer stone in the kettle or chiller. Oxalate ions in finished beer
promote excessive foaming, called gushing. The calcium ion and to some
extent the magnesium ion remove the oxalate by forming insoluble solids,
like CaC2O4, that harmlessly precipitate with the grain during mashing.
Calcium ions are also important to enhance flocculation of yeast during fer
mentation, making it easier to clarify the beer. It is recommended that the
concentration of calcium ion in the mash be no less than 50 ppm.
114 RAW MATERIALS
TABLE 4.1 Common Ions Important for Beer Production

Ion Formula Brewing Range Effects and Issues
Bicarbonate HCO3− 0–50 ppm for pale beers Alkalinity. Raises pH
50–100 ppm for amber
or malt‐forward beers
150–250 ppm for dark
or roasted beers
Calcium Ca2+ 50–100 ppm Provides hardness. Lowers pH.
Precipitates oxalate. Forms
deposits in pipes and vessels.
Cofactor of many enzymes and
is essential for yeast health and
flocculation
Chloride Cl− 0–250 ppm Sweetness. Fullness. Balances
sulfate. Corrosive to stainless steel
Iron(II) Fe2+ <0.2 ppm Metallic. Astringent. Inhibits
conversion of starch. Increases
color of wort. Increases staling.
Forms deposits
Hydronium H3O+ Lowers pH. Enhances bitterness.
Suppresses bacteria.
Magnesium Mg2+ 10–30 ppm Contributes to hardness. Lowers
pH. Excessive amounts (>50 ppm)
create a sour bitterness. Very
excessive amounts (>100 ppm)
acts as a laxative
Nitrate NO3− <10 ppm Above 10 ppm suggests
contamination by agricultural
runoff. At high concentrations
can be converted to potentially
harmful nitrite
Sodium Na+ 0–150 ppm At 70–150 ppm will round out
flavor and provide sweetness.
Salty flavor will develop >200 ppm
Sulfate SO42− 50–150 ppm Enhances bitterness, making the
150–350 ppm to sensation more dry and crisp.
accentuate bitterness At levels >400 ppm can act as a
laxative
On the negative side, hardness ions can form insoluble deposits in brewing
equipment, called pipe scale, especially where water is heated. The layer of
deposit narrows the effective diameter of pipes, making flow more difficult. It
interferes with heat transfer by forming an insulating layer. Hardness ions can
WATER 115
also interfere with the action of detergents, leading to ineffective cleaning or

the need for increased use of chemicals, higher temperatures, and longer
treatment times. Hardness is highly undesirable in steam boiler feed water
because of the formation of deposits. Boiler water is often treated to remove
or sequester (bind in a soluble form) hardness ions.
Water Quality and Processing At a minimum, water for brewing must

meet the standards for drinkable water. This is mostly an issue for breweries
that do not use municipal water supplies. Water from any source usually
requires some level of processing at the brewery. Disinfectants like chlorine
and chloramine must be removed. It may be necessary to remove iron and
manganese. Excessive hardness or alkalinity may require treatment. Water
for mashing and sparging ends up in the beer, so flavor issues are at the
forefront. Water used for cleaning should either be free of interfering ions,
like calcium and iron, or should be treated with substances that bind these
ions and render them harmless to the cleaning process. Water for boilers
needs to be treated to minimize corrosion and the deposit of pipe scale in the
boiler. The most demanding specifications are on water that that is used to
dilute high‐gravity beer before packaging. Dilution water must have the same
mineral and carbon dioxide content as the beer, and it must be free of
dissolved oxygen.
Water coming into a brewery is filtered, that is, it is passed through a
medium with holes measuring in the micrometer or tenths of micrometer
range. Filtration removes suspended solids, like debris from the plumbing and
bits of sand or soil. Filtration protects subsequent purification processes and
brewery mechanisms from damage. Disposable cartridges, often of polymer
yarn wound around a core, are suitable for small breweries. Larger operations
benefit from filters with renewable media. These often use beds of sand or
other inert granular material. The filter is cleaned by flowing water through it
in the reverse direction and discarding the wash water.
After filtration to remove suspended solids, all breweries should use acti
vated carbon to remove chlorine, chloramine, odors, and colors from the
water. Activated carbon is made by partial combustion of a carbon source,
like coal, peat, fruit pits, and the like. The resulting char is treated (“acti-
vated”) at high temperature, usually with steam, to remove some of the
carbon and leave a system of pores with a very high surface area for binding
impurities. Activated carbon is effective for removing neutral molecules like
chlorine and chloramine, which are often added to municipal water systems
to suppress harmful microbes. Very small amounts of chlorine in brewing
water will produce undesirable chlorophenols in beer. Chlorophenols have a
medicinal, hospital, plastic, or band‐aid off‐flavor. Chlorine is easy to smell
and is easily volatized. It can be removed by boiling your water or simply
letting it sit out overnight. Because chlorine escapes from water so easily,
many water treatment plants have switched to chloramines. Chloramine is
116 RAW MATERIALS
more difficult to detect by the senses and is not as volatile. The most effective
way to quickly remove chloramine (and chlorine) is with an activated carbon
filter. Activated carbon can also remove nonionic off‐flavor compounds and
colored substances. It does not remove ionic impurities, including heavy metal
ions and those that cause hardness, alkalinity, and salinity.
Chlorine may also be removed by ultraviolet (UV) light, often installed
in‐line, upstream of an activated carbon filter. UV light breaks down the
chlorine or chloramine molecules into chloride, ammonia, and water, with the
added benefits of killing 99.99% of bacteria and viruses. Chlorine and chlora-
mine can also be broken down with sodium metabisulfite (Na2S2O5) or
potassium metabisulfite (K2S2O5), sold as Campden tablets. Potassium

metabisulfite may also be used for sanitization of fruit and as an antioxidant.
Metabisulfite releases sulfite ion (SO32−), which causes an allergic reaction in
some people.
In the past, if hardness and alkalinity were a concern, they were reduced by
boiling the water. The chemical reaction is Ca2+ + 2HCO3− → CaCO3(s) +
CO2(g) + H2O. The solid calcium carbonate settles out or is filtered out.
Hardness that can be removed by boiling is called temporary hardness. The
boiling method is seldom used today in commercial breweries because it
requires heating, cooling, and sedimentation or filtration, which are expen-
sive in energy and equipment.
Lime softening is another old process that may still be in use at some
locations. Calcium hydroxide (slaked lime) is added to the water, converting
soluble calcium bicarbonate to insoluble calcium carbonate: Ca(HCO3)2 +
Ca(OH)2 → 2CaCO3(s) +2H2O. The resulting water is treated with carbon
dioxide to lower the pH. The process has declined in popularity because it
needs a large reactor for sedimentation of the calcium carbonate. Advances
in separation technology may make lime softening more attractive.
Ion exchange can be used to alter the ionic composition of water. The
exchanger contains one or more types of resins (plastics) with functional
groups that bind positive or negative ions. In a water softener, hardness is
removed by a cation (positive ion) exchanger, which binds hardness ions like
magnesium ion and calcium ion and releases an equivalent (by electrical
charge) amount of sodium ion. Negative ions are removed by an anion (nega-
tive ion) exchanger and replaced with chloride ion. This process is often used
for removal of bicarbonate ion, called dealkalization. The cation and anion
exchange materials may be combined in the same vessel. These units are
regenerated by treatment with a concentrated solution of sodium chloride,
which drives off the captured ions and replaces them with sodium and
chloride ions. In another variation, called demineralization, the positive ions
are replaced with hydrogen ion and the negative ions with hydroxide ion (see
Figure 4.4). The hydrogen and hydroxide ions combine to give water, so
complete deionization is possible. In this case, the cation exchanger and the
WATER 117
HA HA –
AH A
Ca2+
AH A–
HA
HA
(A) (B)
Figure 4.4 (A) Cation exchange resin. (B) Resin exchanged with calcium ion.
anion exchanger must be in separate vessels. The cation exchanger is regener-

ated with a strong acid like hydrochloric acid, and the anion exchanger is
regenerated with sodium hydroxide (caustic soda).
Reverse osmosis can, in theory, remove virtually any impurity in water, gen-
erating reverse osmosis water or RO water. It involves driving the water through a
membrane with pores on the order of the effective size of a water molecule. In
practice, it is usually necessary to pretreat the water to avoid damaging the
membrane. Pressure is applied to the impure side to drive the water to the
pure side, leaving the impurities behind. Without pressure, water would p refer
to move toward the impure side. The amount of pressure needed to overcome
this force is called the osmotic pressure. The osmotic pressure increases with
increasing concentration of substances that do not pass through the mem-
brane. The flow rate through the membrane depends on the pressure in excess
of the osmotic pressure and the area of the membrane. As water is driven
through the membrane, the concentration of impurities on the inlet side
increases, so the osmotic pressure increases. To maintain a steady state, up to
20% of the inlet water with concentrated impurities is discarded. Practical
membranes are usually made in the form of long, thin tubes to provide ade-
quate mechanical strength and area. Applied pressure is generally in the range
of 7–15 bar (100–220 psi). It is possible to run a reverse osmosis system using
only the pressure of the municipal water system. These systems discard
85–95% of the feed water and are not regarded as suitable for brewery use.
Related purification methods include nanofiltration, ultrafiltration, and micro-
filtration, in order of increasing pore size. There are no sharp boundaries
between these methods. Microfiltration is used to remove bacteria from beer.
Membranes for nanofiltration have pores small enough to block hardness and
alkalinity ions, but not as small as those of osmotic membranes.
Iron and manganese ions are problem pollutants in brewing water because
they form deposits in pipes and equipment, they give rise to off‐flavors, and
they promote staling reactions in packaged beer. Both elements exist in water
as +2 ions. The hydroxide of the +3 ion of iron, Fe(OH)3, is very insoluble;
water provides the hydroxide ion. Manganese +4 ions form insoluble MnO2.
The strategies for removal of iron and manganese ions involve oxidizing the
118 RAW MATERIALS
more soluble +2 ion to the less soluble ion. Oxidation is accomplished by

reaction with a substance that grabs electrons. Some substances often used
for this purpose are air, chlorine, sodium hypochlorite (bleach), and potas-
sium permanganate (KMnO4), often used in conjunction with MnO2 coated
on a mineral (“green sand”) or artificial support. The last option has the
advantage that the coated support serves as a catalyst for the oxidation and
as a filter for the solid product.
Water Profiles and Adjustment for Brewing

Describing Hardness and Alkalinity Systems describing hardness and
alkalinity are very different from those describing other potential solutes.
One reason for this is that hardness and alkalinity are effects that can be
caused by several ions. The contribution to hardness or alkalinity goes by the
number of ions, not by their mass; 24.305 g of magnesium ion (1 mol) makes
the same contribution to hardness as 40.078 g of calcium ion (1 mol). Many
sources are lax about specifying exactly what units they are using. For
individual ions, substances, and combinations like total dissolved solids
(TDS), the usual measurement is milligrams per liter (mg/L), also called
parts per million (ppm). Some water treatment companies use grains per
gallon (gr/gal or gpg) = 17.12 mg/L. Table 4.2 provides conversions among
units used to express hardness and alkalinity. To convert the unit at the top
to that on the left, multiply by the entry in that column and row. For example,
to convert 12 German degrees (dGH) to ppm as CaCO3, 12 dGH × 17.848 =
214 ppm as CaCO3.
Water Reports Annually updated municipal water reports should be

available from water suppliers. Unfortunately for brewers, municipal water
reports tend to focus more on safety and quality regulations as required by
the government, often lacking beer‐centric metrics. For some regions, multiple
TABLE 4.2 Hardness and Alkalinity Conversions

mEq/L ppm dfH dGH °Clark gr/gal Name
mEq/L 1 0.01998 0.1998 0.3567 0.2848 0.3421 Milliequiv per L
ppm 50.043 1 10 17.848 14.254 17.118 ppm as CaCO3
dF 5.0043 0.1 1 1.7848 1.4254 1.7118 French degrees
dGH 2.8039 0.05603 0.5603 1 0.7986 0.9591 German degrees
°Clark 3.5109 0.07016 0.7016 1.252 1 1.2010 Clark degrees
gr/gal 2.9234 0.05842 0.5842 1.0426 0.8327 1 Grains per US gal
WATER 119
water sources are blended in response to demand and availability, resulting in

a frequently changing water profile. For these reasons, municipal water
reports are a useful approximation but cannot always be depended upon to
establish the character of brewing water. There are commercial laboratories
who will provide detailed water analysis for a fee. Some laboratories specialize
in brewing water chemistry. Do‐it‐yourself water analysis kits are also
available but typically only have sensitivities in the 10–50 ppm range
depending on the test. More quantitative tests are described in Section
“Analytical and Quality Control Procedures for Water.”
A water report for brewing should measure the concentration of the
following ions:
• Total hardness (unnecessary if calcium and magnesium are provided)

• Calcium
• Magnesium
• Alkalinity (unnecessary if bicarbonate is provided)
• Sulfate
• Chloride
• Sodium
• Nitrate
Advanced water chemistry, and truly mastering the impact of water on

your beer, involves understanding the ionic content of the water. For most
beer styles, brewing water should have moderate hardness and low to moder-
ate alkalinity. As we will discuss below, these two water qualities greatly
influence mash pH, arguably the most important impact of brewing water.
Table 4.3 provides a range of hardness values in water.
Influence of Water Profile on Beer The grain bill of a mash and the
underlying water chemistry play a major role in establishing an acceptable
mashing pH of 5.2–5.6. For example, when 100% pilsner malt is mashed with
distilled water, the pH is typically 5.7–5.8. The natural acidity of roasted
specialty malts can greatly affect the pH. Using a dark crystal or roasted malt
TABLE 4.3 General Hardness Values in Water

Concentration as CaCO3 Indication
<60 ppm Soft water
60–120 ppm Moderately hard water
120–180 ppm Hard water
>180 ppm Very hard water
120 RAW MATERIALS
at 20% of the grist can lower the pH by as much as 0.5. In distilled water,
100% chocolate malt can yield a pH as low as 4.3. The starting pH of water is
not very important. If the pH needs to be adjusted, steps should be made to
adjust the mash pH rather than the water pH.
The synergy of malt, water ionic content, and pH is best illustrated in areas
of the world famous for their particular beer style. The town of Pilsen (Plzeň)
in the Czech Republic is the birthplace of the pilsner style of beer. Pilsner is
a very pale, clear lager with a light, clean, noble hop flavor. The water in
Pilsen is very low in bicarbonates, very soft, and free of most minerals.
Historically, because the brewers in Pilsen used only pale malts, they needed
an acid rest to reach an appropriate mash pH. The acid rest is a several‐hour‐
long step that permits the malt enzyme phytase to release phosphoric acid,
thus lowering the pH.
In contrast to pilsners from Pilsen is stout from Dublin, Ireland. The water
of Dublin is high in bicarbonate (HCO3−), but without enough calcium to bal-
ance it. This yields hard, alkaline water that overcomes malt acidity. With this
water profile, a 100% base malt mash may produce a mash pH higher than
5.8, which can extract harsh phenolic and tannin compounds from the grain
husks. The water profile of Ireland is well suited to stout ales, because the
roasted black malts add acidity to the mash, enabling an appropriate mash
pH of 5.2–5.6. A comparison of the water profiles of Pilsen and Dublin is
shown in Table 4.4.
In summary, light lagers cannot be made with the extremely hard water of
Dublin, and dark beers cannot be made with the very soft waters of Pilsen. In
brewing beers to style, a brewer might find it appealing to try to match the
geographic water profile of an area known for that style. Unfortunately, this
is a bit like shooting a target in the dark, as the exact conditions of the brew
are usually unknown. It may be hard to exactly mimic the same grain bill in
that brew, but more importantly, brewers, especially in areas with very hard or
alkaline water, may modify the water profile.
Adjustment of Brewing Water The addition of food‐grade compounds,

referred to as “brewer’s salts” in the industry, allow a specific water profile to
be attained. A specific profile may be needed to hit a target mash pH or
accentuate particular beer flavors such as bitterness, maltiness, sweetness,
or saltiness. A summary of ionic contributions to beer flavor is provided in
TABLE 4.4 Comparison of Historical Water Profiles of Pilsen and Dublin (in

mg/L)
Ca+ Mg2+ HCO32− Cl− Na+ SO42−
Pilsen 10 3 3 4.3 4 —
Dublin 119 4 319 19 12 53
WATER 121
Table 4.1. A summary of brewer’s salts used for water adjustment is provided

in Table 4.5. Note that these adjustments specifically refer to increasing ionic
content. Decreasing ionic content was covered in the previous section.
In addition to the effects of sulfate on bitterness or bicarbonate on
perceived maltiness, the brewer should pay attention to the sulfate‐to‐chloride
ratio. The combination of high chloride and high sulfate can generate a harsh
bitterness, and so one should be kept lower relative to the other, preferably
the chloride. Recommended sulfate‐to‐chloride ratios are 4 : 1 for a hoppier
beer and 0.5 : 1 for a fuller, maltier balance.
When adding brewer’s salts to water, remember that one salt addition
provides two ions, one cation and one anion. This will be an important consid-
eration when calculating the impact of each addition on the overall water
profile. As we will see below, two ions are not present in the salt in equal
masses. This means that the ionic contribution of each ion in water is different
and must be considered. Certain salts have water molecules in their formulas.
These salts are referred to as hydrated salts. For example, calcium sulfate
TABLE 4.5 Common Brewer’s Salts Used for Water Adjustment

Common
Scientific Name Name Notes Composition
Calcium carbonate Chalk Raises pH. Very limited 40.04% Ca2+
(CaCO3) solubility in water; should be 59.96% CO32−
added directly to mash. Used
for dark beers
Calcium sulfate Gypsum Lowers pH. Accentuates 23.28% Ca2+
(CaSO4∙2H2O) crispness and bitterness for 55.79% SO42−
hop‐forward beers
Calcium chloride — Lowers pH. Increases calcium 27.26% Ca2+
(CaCl2∙2H2O) as needed for soft water 48.23% Cl−
Magnesium sulfate Epsom salt Minimal effect on pH. 9.86% Mg2+
(MgSO4∙7H2O) Accentuates crispness and 38.97% SO42−
bitterness for hop‐forward
beers
Sodium bicarbonate Baking soda Raises pH through increased 27.37% Na+
(NaHCO3) alkalinity. Good addition for 72.63% HCO3−
dark beers
Sodium chloride Table salt No effect on pH. Promotes 39.34% Na+
(NaCl) saltiness 60.66% Cl−
Magnesium chloride — Minimal effect on pH. Used 11.96% Mg2+
(MgCl2∙6H2O) to increase magnesium in 34.88% Cl−
deficient profiles without
affecting sulfates
122 RAW MATERIALS
is commonly sold as gypsum, which is a dihydrated form, CaSO4·2H2O.

Magnesium sulfate is commonly sold as Epsom salt, which has seven water
molecules, MgSO4·7H2O. A salt with no water molecules is called an anhy-
drous form. Some salts, especially the chlorides, have several hydrates, each
with a different composition.
Proper safety precautions should always be taken when adding salt
additions to hot liquor tanks or the mash. Appropriate gloves and eye protec-
tion to protect against chemicals and splashes are required. Extreme caution
is warranted for calcium chloride additions because heat is released that will
cause spattering unless the salt is added slowly to plenty of water. Salt should
always be added to water, not water to salt.
Calculating Salt Additions to Reach a Target Water Profile The impact

of salt additions on water chemistry is relatively easy to calculate. We will
illustrate this process through an example. You work for a brewery in
Philadelphia with the following water profile as identified by the Philadelphia
Water Department:
Philadelphia, PA – Queen Lane Reservoir

Ca+2 Mg2+ Na+ Cl– SO42– Alkalinity pH
43 13 35 92 50 65 (HCO3–) 7.1
Ionic content in ppm
You are interested in making an IPA with a very bright, firm bitterness
like that of the famous ales made in England at Burton‐on‐Trent. To
approach the astringent bitterness of this region, you would like to do a
single chemical addition in 100 L of water to increase your sulfates to about
300 ppm. This process, informally called “Burtonizing,” requires the
addition of gypsum. Gypsum is calcium sulfate dihydrate (CaSO4∙2H2O).
There are three steps to water addition calculations. (1) Determine the
mass percentages of the salt. (2) Determine the mass of salt needed to
reach the given level. (3) Determine the impact of the balancing ion on the
final water profile.
Step 1: We first calculate the mass percentages of the elements in
gypsum. The molar mass of each element is listed on the periodic table of
the elements (Figure 2.3). Referring to the periodic table, we know the
following:
Ca 40.1 g/mol; S 32.1 g/mol; O 16.0 g/mol; H 1.0 g/mol.
Given the formula for gypsum (CaSO4∙2H2O), we now determine the total
molar mass and the molar mass of sulfate.
WATER 123
Item MM (g/mol) Mass (g/mol) Mass Fraction

Ca 1 40.1 40.1 40.1/172.2 = 0.233
SO4 1 32.1 + 4 × 16.0 96.1 96.1/172.2 = 0.558
H2O 2 2 × 1.0 + 16.0 36.0 36.0/172.2 = 0.209
CaSO4∙2H2O 172.2
The mass fraction is easier to use than the mass percent in mass calcula-
tions. Mass fraction = mass percent/100. The mass percent of the ions in
various brewer’s salts is given in Table 4.5.
Step 2: We now need to calculate the amount (in grams) of gypsum required
to raise the sulfate level to 300 ppm in 100 L of water. Starting with a water
profile that already contains 50 ppm of sulfate, we need to increase the
amount by 250 ppm in 100 L of water. Remember that ppm = mg/L. First,
determine the mass of sulfate required to reach 250 ppm in 100 L. Then
convert mg to g:
1g
250 mg / L 100 L 25 g
1000 mg
We need to calculate the mass of gypsum that provides 25.0 g of sulfate:
Mass sulfate
mass fraction 0.558
Mass gypsum
mass sulfate 25.0 g

Mass gypsum 44.8 g
mass fraction 0.558
Step 3: We now need to account for the increase in calcium upon

a ddition of 44.8 g of gypsum in 100 L of water. What is the final amount
of calcium (in ppm) in the 100 L? From step 1, we know the mass fraction
of calcium in gypsum is 0.233. To determine the amount of calcium
added (in g),
25.0 g × 0.233 = 5.8 g.
To convert this to ppm (mg/L), we convert the mass to mg and divide by
the liters:
5.8 g 1000 mg /g
58 mg /L 58 ppm
100 L
According to the water report, we started with 43 ppm calcium. The gyp-
sum provided another 58 ppm for a total calcium concentration of 101 ppm.
124 RAW MATERIALS
Additional salt additions can be calculated in the same manner. Brewers

who do this type of calculation often prepare spreadsheets with the relevant
data inserted.
Analytical and Quality Control Procedures for Water

Hardness The standard method for measuring hardness is titration with
ethylenediaminetetraacetate (EDTA), which binds strongly to hardness ions.
The method, in brief, is that a measured volume of water is treated with an
ammonia buffer to give a pH of 10. A small amount of an indicator dye,
typically Eriochrome Black T®, is added. The indicator gives a red color when
hardness is present. A solution of disodium EDTA of known concentration is
added in a controlled way, a procedure called titration, so that the amount
added at any point can be determined. When the hardness ions have all
reacted with the EDTA, the dye turns from red to blue. Addition is stopped
and the moles of EDTA are equated to the moles of hardness ions. Fast but
approximate measurement can be done with test strips impregnated with
proprietary mixtures including EDTA and indicator dyes that give a color
change used to estimate the hardness.
Alkalinity The standard method for alkalinity involves titration with a

solution of sulfuric acid while simultaneously measuring the pH. Briefly, a
measured volume of water is titrated with a sulfuric acid solution of known
concentration. The volume of acid and the pH are monitored. When the pH
reaches 4.5 (other values are sometimes used), the volume of acid is recorded.
Each mole of sulfuric acid can neutralize two equivalents of alkalinity. The
milliequivalents of alkalinity are equal to twice the number of moles of
sulfuric acid needed to lower the pH to 4.5. Hydrochloric acid can also be
used for the titration; one mole of hydrochloric acid corresponds to one
equivalent of alkalinity.
Total Dissolved Solids The defining laboratory method for total dissolved
solids (TDS) analysis is to filter the water, evaporate a weighed sample, heat
it to 180 °C, then cool, and weigh the residue. Dissolved ions also give rise to
electrical conductivity, which is measured by a TDS meter. There are several
issues that limit the reliability of TDS meters. Only dissolved ionic compounds
conduct. A contaminating molecule like sugar would not register on the
meter at all. Volatile ionic substances conduct but are not dissolved solids.
A small amount of hydrochloric acid, which is not a dissolved solid, gives a
large signal on a TDS meter. Each type of ion makes a different contribution
to the conductivity. A 10 ppm solution of potassium sulfate gives a different
conductivity reading from a 10 ppm solution of sodium chloride. Because of
these issues, the TDS meter gives reliable results only for solutions whose
MALT 125
compositions are closely related to the calibrating solutions. TDS meters are
useful for tasks like determining changes in brewing water, indicating
potential problems with equipment or supply.
Taste/Smell/Color Water quality can fail. Perhaps a gasket deteriorated

into it; or there was an error in the use of treatment or regeneration chemicals;
or there was bacterial contamination in the pipes. Water for brewing should
be inspected every brew day. Put water from your treatment system into a
clean, clear glass container – the same one every time. Visually inspect the
quality against an evenly lit white surface for cloudiness and any discernable
color. Taste and smell the water and have others who have good flavor
judgment do the same. If there are any problems, spend the day working on
your water treatment system instead of brewing. If you solve the problem, it
will be a very profitable day.
4.2 MALT
Barley (Hordeum vulgare) malt is barley seed that has been steeped, germi
nated, and dried in a process called malting. The process of malting enables
the creation of a very specific set of tools that the brewer will be able to use
in the brewery. Malt provides such essential components as:
• Starch (complex carbohydrates).

• Enzymes to generate simple carbohydrates from starch during the
mash.
• Proteins – foam and haze.
• Proteases to generate free amino nitrogen (FAN), promoting extract.
• Lipids.
• Polyphenols/tannins.
• Vitamins.
• Filter material for the lauter.
• Color and flavor.
Grain Biology
Barley is a cereal grain that is classified as winter or spring and as two‐row or
six‐row varieties. Winter barley is planted in the late fall and harvested in the
spring or early summer. It sprouts in the fall but does not flower until it is
exposed to winter temperatures. Spring barely is planted in the early spring
and is harvested near the end of the summer. Flowers of barley plants are
carried in groups of three spikelets at nodes (joints) on a stem, one group per
126 RAW MATERIALS
node. The groups alternate from one side of the stem to the other. In six‐row
barley, each flower yields a seed, so there are three rows of seeds on one side
of the stem and three on the other. In two‐row barley, only the middle spike-
let of the group of three yields a seed; the other two are sterile. This gives one
row of seeds on each side of the stem. Surprisingly, this distinction is controlled
by only two genes. Both two‐row and six‐row varieties are used in brewing.
Two‐row barley is usually preferred for craft and all‐malt brewing. Six‐row
varieties find use in beers made with starchy, nonenzymatic adjuncts because
the higher protein content of six‐row leads to higher levels of starch hydro
lysis enzymes in the malt. Table 4.6 provides a general overview of the
differences between two‐row and six‐row barley. This table is a generaliza-
tion; the development of new varieties has enabled selection of favorable
traits for the brewing industry in both barley varieties.
A barley seed is illustrated in Figure 4.5. The seed or kernel has three main
parts: the germ or embryo, the endosperm, and the seed coat, which includes
the hulls. The germ region, containing the embryo, will develop into the barley
plant. During the malting process it produces an acrospire that grows up the
dorsal side toward the tip and rootlets that emerge from the base. The dorsal
and ventral sides of a barley seed are distinguished by the ventral furrow, a
large groove that runs the length of the ventral side.
The endosperm consists of dead cells filled with starch granules, each
surrounded by a protein‐rich matrix. The granules are semicrystalline (partly
TABLE 4.6 Differences Between Two‐Row and Six‐Row Barley

Two‐Row Six‐Row
Mostly used for malting Mostly used for animal feed
Uniform size Variable sizes
Thinner hull Thicker hull
Less polyphenol More polyphenol
Less total protein More total protein
Higher extract potential Lower extract potential
Less beta‐glucan More beta‐glucan
Seed Coat Scutellum

Aleurone layer
Awn Micropyle
Embryo
Starchy endosperm
Hull
Figure 4.5 Barley corn. Source: From Barth (2013) © 2013 Wiley. Used with permission.
MALT 127
crystal, partly glassy). They serve as an energy stock for the embryo, provid-
ing a source of sugar until the seedling can grow leaves and begin photosyn-
thesis. But during the malting process, care is taken to limit consumption of
the starch by the embryo.
Each endosperm cell is surrounded by a cell wall made mostly from
complex carbohydrates and protein. The outer layer is mostly hemicellulose.
The middle lamella is a mostly proteinaceous layer between the cells.
Figure 4.6 compares cell walls from the shoot (acrospire) with those from the
endosperm. The endosperm walls have no detectable pectin (a polymer of
mostly galacturonic acid) or xyloglucan (polymer of glucose with xylose side
chains). Endosperm walls have seven times as much beta‐glucan and
somewhat less, though still significant arabinoxylan, a polymer of xylose with
arabinose side chains. Some of the OH groups on the xylose and arabinose
rings form esters with ferulic acid and acetic acid. Ferulic acid is potentially
important because it can be released by hydrolysis and subsequently decar-
boxylated to highly flavor‐active 4‐vinylguaiacol. Endosperm cell walls are
easier to hydrolyze during malting than walls of other cells. One of the key
objectives in the malting process is to break these cell walls down to gain
access to the starch. Timing is everything. There must be enough modification
to break down the cell walls but not so much as to consume starch. Surrounding
the endosperm is a triple layer of cells derived from the embryo called the
aleurone. The aleurone will be important for producing starch‐degrading
enzymes during the malting process.
THE FERULIC ACID REST
In the endosperm cell wall, ferulic acid forms ester bonds with pen-
tosans. During mashing, a ferulic acid rest at 45 °C (113 °F) for
15–20 minutes has been shown to liberate ferulic acid through the activ-
ity of beta‐glucanase, which degrades both beta‐glucan and pentosans.
Free ferulic acid is important in wheat beers because it is decarboxy-
lated into 4‐vinylguaiacol during fermentation (by POF+ yeast), which
contributes to the characteristic phenolic flavor of the style. Furthermore,
4‐vinylguaiacol is converted by certain Brettanomyces yeast species to
4‐ethylguaiacol, described as having a clove or smoky flavor.
The seed coat of a barley seed consists of three layers. Moving from inner
to outer, the testa is flush against the aleurone layer and is permeable only to
water. The next layer is the pericarp. The outermost layer consists of cellu-
lose‐rich hulls, the palea (front hull) and the lemma (back hull). The awn, also
called the beard, is at the tip of the lemma; it is removed before malting during
128 RAW MATERIALS
70
Shoot
Mass percent
Endosperm
32
25
20
10 12 10
3
0 0
Arabino- β-Glucan Cellulose Pectin Xylo-
xylan glucan
Figure 4.6 Endosperm cell wall carbohydrates.
cleaning. The awn protects barley crops from herbivores like deer. The ven-
tral side of a barley seed has a groove called the ventral furrow (Figure 4.7).
Malting Malt is grain that has been soaked in water, allowed to sprout, and
is then dried. Each of these steps has a key role in the malting process. An
overview of the malting process is shown in Figure 4.8. Grain is harvested and
dried on the farm to 12% moisture. The barley is cleaned in a series of sieves
to remove stones, dust, and undersized seeds. The malting process begins with
steeping during which the seed is hydrated and the embryo is activated. Then
the hydrated seeds are transferred to a germination chamber. During
germination the embryo begins to grow, releasing hormones that stimulate
the aleurone layer and scutellum to produce important enzymes that enable
modification. Finally, modification activity is stopped in the drying or kilning
process, which produces key flavor and color compounds.
2 mm
Palea
Ventral
furrow
Lemma
Dorsal Ventral
Figure 4.7 External view of a barley kernel.

MALT 129
Grain sorting
Scalping,
large screenings
Farming/harvesting
Clean grain
Sifting,
fine screening
Grain
Germinating Steeping storage
Water
Malt
Storage
Kilning
Packaging
Malt
Hot air
Figure 4.8 Overview of the malting process.
Steeping Raw barley seed is dried to about 12% moisture before storage.
The grain, having been cleaned and freed of debris, like broken kernels,
stones, weed seeds, and bits of wire, is added to a tank of water. The grain is
soaked for several hours, an operation called steeping. Then the water is
drained, and the barley is allowed to rest in air (often in flowing air).
The purpose of steeping is to activate enzymes and begin germination.
The embryo is activated at a moisture content of around 30–35%. This
step triggers aerobic respiration indicated by the following equation:
sugar + O2 → CO2 + H2O + energy (ATP). As a result, there must be a
source of oxygen and a method to dissipate carbon dioxide and heat. This is
130 RAW MATERIALS
Chit
Figure 4.9 Barley chit. Photograph: Naomi Hampson.
accomplished through the air rests. Otherwise, the barley seeds would drown.
Steeping also helps to wash bacteria and dust from the raw grain.
During steeping, the moisture content of the grain increases to 44–48%.
Details like the temperature and duration of each steep and air rest are adjusted
to match the requirements of the characteristics of the grain and the type of
malt being produced. Usually there are a total of two or three steeps over a
period of two days, typically at 13–18 °C (55–64 °F). Each steep is approximately
4 hours, and each air rest is approximately 20 hours, with variations as needed.
By the end of steeping, most of the seeds will show a white spot at the base,
called a chit, where the root sheath breaks through the hull, shown in Figure 4.9.
Germination After steeping, the malt is allowed to sprout, a process called

germination. To grow a new plant, the embryo needs energy provided by
respiration. Before it grows large enough to make sugar through photosynthesis,
it must rely on its own starch reserves in the endosperm. A critical process
during this step is the generation of enzymes called amylases that will convert
the starch into simple sugars. Another major process goal is the breakdown of
the endosperm cell walls to gain access to the starch. Collectively, this process
is called modification. The germination step must be fine‐tuned to maximize
enzyme production and cell wall modification but minimize carbohydrate
consumption. The more sugar used for growth, the less remains for beer!
The traditional method of germination is to spread the steeped grain in a
layer on a floor and to turn the grain with rakes and shovels. Modern methods
transfer the steeped grain into a separate container, such as a Saladin box,
which provides automated mechanical turning enabling the grain to be piled
deeper. During germination, the grain breathes oxygen, releases carbon diox-
ide, consumes starch reserves, releases heat, and grows rootlets, called culms
(Figure 4.10). In all germination systems, the malt must be turned regularly
MALT 131
to allow oxygen to reach the seeds and to allow carbon dioxide and heat to
escape. Regular turning is also needed to prevent the rootlets from becoming
entangled, which would make the malt difficult to handle. High air flows pro-
vide oxygen and facilitate removal of heat and carbon dioxide. Germination
is typically conducted at 18–22 °C (64–72 °F) for a period of four days.
Hydration as low as 30% will foster germination. Typically 40% moisture
is targeted. The hydrated embryo produces hormones that migrate to the
aleurone layer to regulate enzyme synthesis. During modification, key
enzymes are produced such as beta- and alpha‐amylase (collectively referred
to as diastase), limit dextrinase, proteases, glucanases, lipases, lipoxygenases,
and phosphatases. The glucanases break down the outer lamella, proteases
hydrolyze the middle lamella, and the endosperm becomes more porous,
going from steely to mealy. The amylases will now have access to the starch.
Because of the location of the embryo at the base of the seed, modification
proceeds from the base to the tip. After modification, the kernels become
more friable, that is, easy to crush. Culms emerge, as shown in Figure 4.10.
During germination, the shoot of the plant, called the acrospire, travels up
the dorsal side of the seed. It may puncture the testa but should not be allowed
to puncture the hull. The acrospire can be observed as a swelling under the
hull on the dorsal side and is often used as a rudimentary measure of germi-
nation progress. For most pilsner and pale malts, the acrospire is permitted to
grow no more than two‐thirds to three‐quarters of the seed length. For darker
malts, the acrospire’s length may be ¾ to full length. The process of growing
the acrospires and rootlets requires the breakdown of starch and consump-
tion of sugar for energy; thus over‐modification leads to loss in extract or
fermentable sugar in finished malt.
Figure 4.10 Culms.

132 RAW MATERIALS
The main plant hormones released by the embryo belong to a family called
gibberellins. It is possible to supplement the natural gibberellin with artifi-
cially produced gibberellic acid (GA), usually sprayed on during germination,
if used. Modification time is expedited by using GA for “two‐way” modifica-
tion, whereby the tips of the seed are gently sheered, promoting natural
modification from the embryo at the base and from the added GA at the tip.
Most maltsters do not use GA. Furthermore, the use of GA would be a
violation of the Reinheitsgebot.
Kilning When modification is adequate for the type of malt being made,
the germination process is stopped by drying the malt, also called kilning. The
details of the drying process are the most important factor affecting the flavor
of the malt. Malt before drying is called green malt. Drying is accomplished
by blowing hot air through a bed of malt in a device called a kiln. The details
of the drying process vary depending on the type of malt desired. The drying
process to make base malt follows three stages. In the free‐drying stage, easily
accessible water from the surface of the grains is dried in a fast stream of air
whose inlet (“air‐on”) temperature is around 50 °C. The air gives up energy to
evaporate the water, cooling down and getting more humid as it passes
through the bed of grain. The air emerging from the kiln is saturated with
water. Respiration continues until the inside temperature of the grains
exceeds 50 °C. At the end of free drying, the air temperature rises, because all
the easily evaporated water has been removed. This happens first near the air
inlet and progresses through the bed. When all, or nearly all, of the grain has
lost its unbound water, the moisture content falls to about 10–15%. This stage
is diffusion drying; the rate of drying depends on how quickly the water vapor
can diffuse from inside to the surface of the grain kernels. Air flow is decreased,
and the inlet air temperature is increased to 65–75 °C. The exit air is relatively
dry and can be used to dry another batch of malt. The malt enzymes are
particularly vulnerable to degradation during this stage because of the
presence of moisture and potentially high temperature. At the end of diffusion
drying, the moisture content reaches about 5%. The final stage, called curing,
raises the temperature to around 80–110 °C, depending on the how pale or
dark the malt is intended to be. The final moisture content is close to 4%. The
drying process is regulated to maintain the activity of the amylase enzymes,
which will be used by the brewer in the mashing process. The entire kilning
step takes about two days.
After drying, the culms, rendered brittle by the heat, are mechanically
removed. The malt is cooled, cleaned by sieving, and stored for three weeks
or more before it is used for brewing. The storage period improves the perfor-
mance of the malt in milling and wort separation. It is believed that storage
evens out the distribution of moisture in the batch and promotes flavor
stabilization.
MALT 133
Types of Malt
There are three broad classes of malt. Base malt retains enough amylolytic
(starch‐hydrolyzing) enzyme activity to allow it to convert starch to sugar
during mashing. The ability of malt enzymes to convert starch is called the
diastatic power (DP), measured in the United States and the United Kingdom
in degrees Lintner (°L). The minimum diastatic power that a malt requires to
convert its own starch to sugar is about 40 °L. Variations of base malt are
produced by changing the degree of modification and the temperature and
duration of curing. Because base malt retains amylolytic activity, it is typically
used at 70–100% of the grain bill. Crystal malt, also called caramel malt, has
been processed to convert most of its starch into sugar in the kiln. Depending
on processing conditions, some of the sugar is allowed to react with amino
acids to give unfermentable but flavorful compounds. Crystal malts are often
used at 2–10% of the total grain bill. Roasted malt is subjected to an addi-
tional heating step in a specialized roaster to give dark colors and intense
flavors. Crystal and roasted malt have little, if any, diastatic power, because
their amylolytic enzymes have been inactivated during manufacture. Roasted
malts are used at 1–8% of the grain bill. A fourth category of malt that we will
call special processed malt has characteristics that derive from sources exter-
nal to the grain.
There are many gradations and variations for malt. A type of malt from
one company may be significantly different from one with the same name
from another. Let the brewer beware. Many malt names are trademarks, so
virtually identical malts may have a different designation. Table 4.7 gives
color according to the Lovibond scale or the more or less equivalent American
TABLE 4.7 Typical Malt Data

Malt Type Color (SRM or Lovibond) Diastatic Power (°L)
Distiller’s malt 2.4 240
Pilsner/lager 1.2–2.5 140
Pale ale 3.5 85
Vienna 3.5 80
Munich 10 40
Dark Munich 20 20
Wheat 2.2–4 170
Crystal/caramel 5–120 0
Dextrin 1.5 0
Brumalt/melanoidin 25 0
Biscuit/amber 20–36 0
Chocolate 200–500 0
Black 400–600 0
Roasted barley 300–500 0
134 RAW MATERIALS
Society of Brewing Chemists (ASBC) SRM scale and diastatic power in

degrees Lintner for a variety of malt types.
Base Malts Distiller’s malt has the highest diastatic power of any standard
malt. As the name implies, it is used to make whisky with a high content of
non‐malt starch ingredients, like maize (corn). Barley for distiller’s malt is
high in protein to allow for more enzyme production. The barley is allowed to
germinate longer than brewer’s malt, resulting in an elevated level of
amylolytic enzymes. Curing is done very gently to preserve the enzymes. The
high level of protein could cause haze and gushing problems in beer.
Distillation leaves the protein behind, so these malts are appropriate for
whisky.
More common to beer production are pilsner, lager, pale, two‐row, and
six‐row malt (the latter distinction relates to the barley itself). Low tempera-
ture curing at 54–70 °C (129–158 °F) leaves pilsner malt with high diastatic
power that allows its enzymes to saccharify (make into sugar) its own starch
plus as much as 35% non‐diastatic starchy materials like maize and rice. This
enables the brewer to produce a product with a very light, crisp flavor and a
pale color. Beers of this style are the most popular worldwide.
Pale ale malt is cured at a slightly higher temperature than pilsner malt,
60–80 °C (140–176 °F). The higher temperature curing drives off dimethyl
sulfide (DMS), so it is less susceptible to vegetable off‐flavors. Pale ale malt
has a subtle malty and biscuit profile especially suitable to British ales and
their stylistic offspring.
Vienna malt is similar to pale ale malt in color and diastatic power. The
curing process is short but at high temperature around 100–110 °C (212–
230 °F). The flavor it gives to beer has been described as toasty and nutty.
Vienna is a major ingredient in the Vienna, Marzen, and Oktoberfest (VMO)
beer style.
Munich malt has a unique drying schedule. The green malt is warmed
under humid recirculating air to 38 °C (100 °F) prior to drying. Curing is at
105–120 °C (221–248 °F), depending on the desired color. Munich is the most
highly cured base malt. It retains just enough diastatic power to saccharify its
own starch. The key contribution of Munich is a malty flavor. It is the base
malt for Bock, Dunkel, and Oktoberfest styles, and it is sometimes used to
boost the maltiness in others, including pale ale. Many maltsters offer two
types of Munich, regular and dark.
Crystal Malt Several varieties of malt are subjected to “stewing” in which

the green malt is given a high humidity heat treatment before drying. This
heat treatment causes the amylase enzymes to convert the starch to sugar
within the endosperm. The kilning process then “crystalizes” the sugar.
Crystal malts have no diastatic power.
MALT 135
Standard crystal malt, also known as caramel malt, is briefly dried to

remove surface water. The kiln is then sealed and warmed up to 60–72 °C
(140–162 °F) for saccharification of the starch. The malt is then cured in dry
air in the range of 120 to nearly 180 °C (248–356 °F), depending on the color
desired. During curing, the sugars mostly combine to give unfermentable
dextrins, which add body to the beer. Crystal malt provides a variety of fla-
vors such as malty, caramel, and toast.
Dextrin malt is a variety of crystal malt in which the stewing and curing are
carried out at lower than the usual temperatures to give a product with little
color or flavor, but which enhances mouth feel and foam.
Brumalt (Brühmalz), also called melanoidin malt, is subjected to high tem-
perature of 50 °C (122 °F) at the end of germination. The green malt is stewed
at 60 °C (140 °F), dried, and then cured for a long time at a low temperature
in the range of 80–90 °C (176–194 °F). It imparts honey‐like flavors. Brumalt
is used as a substitute for prolonged boiling in the preparation of Bock and
related styles of beer.
Roasted Malt Malt and even unmalted grain can be subjected to heat
treatment of varying intensity and duration to give a variety of products.
Usually roasting is accomplished in rotating drums.
Biscuit malt, amber malt, and brown malt provide nutlike, bread, and toffee
aromas. They are typically used in British‐style ales. Today’s brown malt is a
completely different product from the historical version formerly used as a
base malt for porter ale.
Chocolate malt is roasted to a very dark brown color at 150–200 °C (302–
392 °F). It gives color and chocolate and coffee notes to dark beers. Black
malt, also called black patent malt, is roasted nearly to the point of ignition
(315 °C, 599 °F) and then cooled with a spray of water. It contributes acrid
flavors and an astringent mouth feel to styles like stout ale. Prior to roasting,
roasted barley is not malted, but it is steeped before intense roasting at 250 °C
(482 °F). It is a defining addition to stouts as compared with porters.
Special Processed Malt Special processed malts are subjected to

processing or treatment that adds flavors or characteristics that are not
inherent to the malt itself.
Acidulated malt [Sauermalz] is handled in a way that encourages growth of
lactic acid bacteria either during germination or after drying. The resulting prod-
uct is used in small quantities to lower mash pH and to provide a tart taste to the
beer. Acidulated malt, unlike lactic acid itself, is permitted by the Reinheitsgebot.
Various flavors of smoked malt can be made by exposing the malt to the
smoke of different types of wood. Peated malt is dried in a peat fire under
conditions that expose the malt to the smoke. It is usually used for Scotch
whisky, especially that made on the island of Islay.
136 RAW MATERIALS
Other Grains Barley is the most common grain used for malt, but it is
possible to malt other grains as well. After barley, the most commonly malted
grains are wheat, oats, and rye. None of these are as easy to malt as barley, but
they are used to make malts for certain styles of beer. Wheat loses its hull on
threshing (separating the seed from the plant), which affects malting and
mashing. Wheat kernels are larger than those of barely. The protein content is
higher. Wheat malt is used in various styles like weissbier, weizen, and wit.
Small amounts of wheat malt can be used to enhance foam in barley beer.
Rye also loses its hull on threshing. Rye malt is used to give a spicy flavor to
the beer. Oat malt is used in some styles, like oatmeal stout. Gums and fats in
the oats impart a unique silky mouth feel. They also require adjustments to
the brewing procedures. Several grains are attracting interest for potential
use in gluten‐free beer. These include sorghum, millet, and even quinoa,
which is not a cereal grain at all.
Malt Flavor and Brewing Issues Malt flavor is created during the kilning
step. Sugars and amino acids, in the presence of heat, yield a Schiff base. The
reaction is shown in Figure 4.11. The Schiff base is unstable; it undergoes a
variety of reactions, collectivity known as Maillard reactions. One pathway
gives rise to melanoidins, which are complex polymers with intense brown
colors. The other pathway gives rise to small molecules, some of which are
highly flavored. Just as toast develops more color and flavor with more
intense heat treatment, so too does malt color and flavor develop with
increasing temperatures and heating times. Two examples of the hundreds of
flavored molecules known to form in malt are shown in Figure 4.12. Because
O
H O
H O H N C
C H
C C OH
H + N H C
C OH H
H C OH R + H2O
C OH
H C
OH R H C
R OH
R
Figure 4.11 Schiff base.
(A) (B)
Figure 4.12 Flavor molecules. (A) Maltol and (B) 2,5‐dimethylpyrazine.
MALT 137
the colored melanoidins and the flavored compounds originate from the
same Schiff base reaction, high color and high flavor often go together. The
inclusion of such flavorful malts has a decisive effect on the color of the beer
and on some aspects of the flavor.
There is another outcome of the Schiff base reaction. Figure 4.11 shows
that the amino (─NH2) group on the amino acid is destroyed by the reaction.
Because the amino group is basic, the reaction makes the malt more acidic.
The use of highly kilned (usually dark) malt lowers mash pH. In the past,
brewers whose water was alkaline, like London, got better results with more
highly kilned malt. Those who had less alkaline water, like Pilsen in Bohemia,
could get better results with paler malt. This is one of many factors, such as
taxes, regulations, availability of supplies, transportation issues, and others,
that gave rise to traditional regional or local beer styles.
Grain Quality for Malting

Grain, both before and after malting, must be of very high quality. A major
part of quality maintenance is careful handling and storage. Issues of fungus,
animal pests, skinned and broken kernels, and the like can interfere with
malting and brewing processes.
Grain for malting must meet certain standards regarding the grain variety,
level of protein, and quality of the seeds. Malting grain requires more effort
and expense to grow and entails more risk to the farmer, so it commands a
significant premium in price over grain of standard quality. Proper handling
of grain begins before it is harvested. Malting barley must be grown with a
minimum of fertilizer to keep protein levels low. The use of herbicides (“des-
iccants”) to dry the plants prior to harvest is not permitted. Fungicides may
be applied to prevent fusarium head blight and other fungus diseases that can
make the grain unsuitable. Of all diseases that may affect barley, fusarium
head blight, also called head scab, is one of the most detrimental. One species
of Fusarium, F. graminearum, produces a mycotoxin called deoxynivalenol
(DON), also called “vomitoxin” because of its effect on animal digestive
systems. US regulations require DON to be less than 1 ppm in food for animal
or human consumption. Severe fusarium infections can lead to DON levels
exceeding 20 ppm. All barley malt should be tested for DON and reported by
the maltster. Although not all Fusarium species produce DON, most produce
polypeptides called hydrophobins. Hydrophobins can coat many materials
and form high‐potency bubble nucleation sites, leading to gushing.
The grain should be harvested as soon as possible at maturity, because rain
on mature grain heads leads to early sprouting and other problems. The com-
bine harvester should be set to minimize damage to the kernels. Broken and
skinned seeds do not malt properly. The grain must be dried at low tempera-
ture to maintain the viability of the seeds. Excessive moisture can lead to
mold growth. A moisture content of 12% is considered ideal for barley
138 RAW MATERIALS
s torage. It is important to remember that the seeds are alive; they consume
oxygen and they release carbon dioxide and heat. Cool storage, adequate air
flow, control of humidity, and freedom from insects and rodents are needed to
maintain grain quality.
Raw grain should demonstrate good kernel shape and consistency. Smaller
kernels absorb water faster, so variability in size leads to heterogeneity in
modification across the batch. Raw barley seed should demonstrate a fresh,
straw‐like smell without any notes of mold or earth. Raw barley should be
light yellow or straw color. A dull gray color can indicate rain damage.
A green color indicates early premature harvest. Brown tips indicate water
sensitivity, which is the inability of viable seeds to germinate in excess water.
Red endosperms are caused by infection from Fusarium. Raw barley should
also be subject to a float test. An excessive number of floating kernels indi-
cate pest infection.
Analytical and Quality Control Procedures for Malt

There are 15 official Methods of Analysis of the ASBC dealing with malt, plus
an additional 12 for raw barley. Similar methods are available from the
European Brewing Convention (EBC). As most brewers work with finished
malt, we focus here on the most important methods to understand malt qual-
ity, discussing how each impacts the brewing process.
Malt specifications are reported on a Certificate of Analysis (COA). COAs
should be obtained and analyzed for every lot of malt received in the brew-
ery. Deviations in malt specification can lead to deviations in beer quality.
Table 4.8 shows a representative COA. Table 4.9 summarizes the acceptable
ranges for each quality trait. Note that these ranges represent superior quality.
Beer can be made from malt with qualities that fall outside of this range, but
this might impact process or flavor standards.
Most malt COA measurements are conducted on wort produced by the
Congress mashing procedure. Congress mashing consists of a series of
temperature increases and steps, usually with a Congress mashing machine
that has capacity for many samples to be mashed at the same time. The ASBC
version of the method starts with 50 g of fine‐ground malt and 200 mL of dis-
tilled water. The malt is mixed with the water, and the mixture is stirred at
45 °C (113 °F) for 30 minutes and heated at 1 °C (1.8 °F)/min to 70 °C (158 °F);
then 100 mL of 70 °C water is added. Stirring is maintained at 70 °C for 60 min-
utes. Additional cold distilled water is added gradually to cool the sample for
filtration at room temperature. Enough water is added to bring the total mass
to 450 g (net: 50 g malt and 400 g water). Filtration is conducted with a fluted
filter paper, including a vorlauf step but excluding a sparge step. This method
does not mimic a brewer’s mash, but rather is used to standardize analysis of
malt samples.
MALT 139
With any malt analysis, the brewer is concerned with five major traits:
1. Physical quality
2. Protein modification
3. Carbohydrate modification
4. Enzyme potential
5. Color and flavor
TABLE 4.8 Certificate of Analysis

from a Fictitious Company
FarBar Maltings
“We wrote the book”
Certificate of Analysis: FarBar Pale Malt.
Lot number 19383. Analysis Date: 8/27/2018
Assortment
On 7/64″ screen 64.4%
On 6/64″ screen 28.2%
On 5/64′ screen 5.6%
Thru 5/64″ screen 1.8%
Moisture 4.4%
Mealy/glassy
Mealy 98.4%
Half‐glassy 1.6%
Glassy 0%
Friability 79.2%
Extract
Fine grind db 80.2%
Coarse grind db 79.3%
F–C difference 0.9%
Protein
Total protein 10.42%
Soluble protein 5.19%
S/T 49.8%
Diastasis
Diastatic power 116 °ASBC
Alpha‐amylase 84.1 DU
Conversion time <5 minute
Wort
Color 3.5 °SRM
Viscosity 1.2 cP
Beta‐glucan 188 ppm
FAN 262 ppm
140 RAW MATERIALS
TABLE 4.9 Typical Ranges for Base Malt

of Superior Brewing Quality
Moisture 3.5–4.5%
Extract DBFC 80–82%
Extract DBCG 78–80.5%
Alpha‐amylase 44–48 DU
Dextrinizing potential 70–100 °Lintner
Conversion 10–15 minute
Protein 9–11%
Mealy 90–97%
Glassy 0–1%
Friability 80–85%
On 7/64 75–85
On 6/64 10–20
On 5/64 0–3
Thru 0–2
Source: Noonan (1996).
Figure 4.13 Grain trier.
The first task in any malt analysis is to get a representative sample.

A shovelful from the top or the first bucket of malt from the silo hopper is not
likely to be representative of the rest of the malt. Several samples should be
collected from several different locations in the truck, bin, silo, or sack. Samples
are taken with a grain trier, also called a grain thief, shown in Figure 4.13. The
trier is stuck into the container, and, once it is in position, its doors are opened,
allowing samples to be collected in compartments at different heights in the
bed of grain. The doors are closed, and the samples are retained for analysis.
The trier should be used at several locations within the malt shipment.
Physical Quality Rapid physical tests are easily conducted by the brewer
to check the quality of the incoming malt shipment. These include examination
MALT 141
of foreign material, test weight per bushel, 1000 kernel weight (KW), and the
float test. Such tests are not typically reported on malt COAs.
To test for foreign material, weigh out 50 g of sample. Spread out sample
on a flat surface and pick out all particles, husks, and contaminants. Classify
materials removed, weigh on an analytical scale (±0.01 g), and report percentage
by weight.
To test weight per bushel, weigh out 110 g representative sample of malt to
the nearest 0.1 g and pour evenly into a funnel placed in a 250 mL graduated
cylinder. Pour evenly and do not tap or jar the cylinder. Report the volume to
the nearest 2 mL. Calculate the bushel weight: bushel weight (in lb/bu) = 8545.4/
volume. Weight per bushel is a crude estimate of the plumpness of the malt.
The use of assortment screens as described below is a better method.
To test the 1000 kernel weight, obtain a representative sample of malt and
count out 500 kernels, excluding debris. Weigh to the nearest 0.1 g. Multiply
the weight by 2 and report at the 1000‐kernel weight (KW), as‐is basis.
To test for floaters, place an exact number (100–200) of malt kernels in water.
Count the number floating and express as a percentage. Malt should sink. Floating
malt may be compromised by infestation by insects which bore holes into the kernel.
Assortment refers to the size distribution of the grain or malt kernels, as
measured by standard screens (Figure 4.14). The screens are plates with 0.75 in.
(19 mm) slots whose width defines the seed size. For barley, the fraction (by
weight) that is retained by a 6/64 in. (2.38 mm) screen is designated plump. The
fraction that passes through the 6/64 in. screen but is retained by a 5/64 in.
(1.98 mm) screen is thin. The fraction that passes through the 5/64 in. screen is
thru. Sometimes retention on a 7/64 in. (2.78 mm) screen is also included to give
a more complete indication of the size range. High fractions of thin and thru
malt are undesirable. Properly sizing malt is critical to ensure that the mill gap
settings are appropriate for crushing. This is particularly important for two‐
roller mills, as variability in malt size results in inadequate crushes (Table 4.10).
20 mm
Figure 4.14 Grain screen.

142 RAW MATERIALS
TABLE 4.10 Screen Sizes

ASCB EBC
7/64 in. 2.8 mm 2.8 mm
6/64 2.4 2.5
5/64 2.0 2.2
Moisture is reported as a percentage of weight. It is measured by weighing

a given mass of malt before and after drying in an oven. If moisture is too low
(<3%), the malt is brittle and prone to breakage during milling, leading to
poor lauter performance. If the moisture is too high (>6%), the malt is slack.
Slack malt is susceptible to spoilage during storage and is difficult to mill,
leading to poor extract yield in the mash. Moisture analysis is used in the
calculation of dry basis analytical results.
Protein Modification In measurement of protein modification, we are

looking for adequate digestion of the lamella by proteases in the endosperm
cell wall. As barley is modified during germination, enzymes hydrolyze some
of the protein, cutting the large molecules into smaller, more soluble
molecules. Proteolysis of the lamella helps glucanases to break down beta‐
glucan. Because digestion of the lamella is required to gain access to starch,
protein modification is also tied to the maximum extract potential of the
malt. Lower protein modification leads to less fermentable carbohydrates.
Protein modification also provides FAN, foam‐positive proteins, malt flavor,
and color (melanoidins). Malt COA specifications involving protein
modification include total protein, soluble protein, the S/T ratio, and FAN.
Protein measured in malt is called total protein. Protein measured in wort
prepared in a laboratory mash is called soluble protein. The ratio of soluble
to total protein is called the S/T ratio, or the Kolbach index. Because protein
is the principal source of nitrogen, protein is often estimated from the nitro-
gen content: % protein = % nitrogen × 6.25.
Free amino nitrogen (FAN) is the measurement of substances containing
the amino group, ─NH2. The method involves a reagent called ninhydrin,
which interacts with terminal amino groups to give a characteristic purple
color which is measured with a spectrophotometer. The absorbance is com-
pared with that from a standard sample of glycine, one of the common amino
acids. The results are reported in milligrams per liter (ppm). Adequate FAN
is needed for good yeast health. Excessive FAN may result in the formation
of higher alcohols (fusel alcohols) or Strecker aldehydes, which may impart
off‐flavors to the beer. Most adjuncts have little or no FAN, so higher levels
of FAN from the malt are needed for adjunct brewing.
In general, brewers prefer malt that is low in total protein, yet is well modified
(reasonable FAN and S/T). Malt with low protein modification may lead to:
MALT 143
• Poor yeast health and erratic fermentation performance.

• Reduced extract yields.
• Slower runoffs and more turbid wort.
• Increased lauter cuts and more tannin extraction.
• Beer filterability and physical stability problems.
• Bland and drying wort flavor.
Malt with high protein modification may lead to:
• The formation of fusel alcohols.

• Promotion of staling flavors from Strecker degradation products.
• Thinner beer body.
• Poor foam retention.
Carbohydrate Modification For carbohydrate modification, we are looking

for adequate digestion of the barley lamella and endosperm structure. Such
modification is required for quality milling operations, high extract potential,
and easy lautering. Malt COA specifications involving carbohydrate modification
include extract, fine/coarse extract difference, viscosity, beta‐glucan, and friability.
Extract is the amount of soluble material released by the malt in a labora-
tory test mash. Malt extract values are used along with brewhouse efficiency
to estimate the original gravity of wort mashed from a specified grain bill.
Extract may be expressed as percent extract fine‐ground dry basis (fgdb) or
as percent extract coarse‐ground dry basis (cgdb). To measure percent extract
fgdb, a defined amount of malt is milled in a laboratory mill at 0.2 mm to pro-
duce a fine flour. It is then mashed under strict Congress mash parameters,
and the solids content is determined from the wort specific gravity. To meas-
ure percent extract cgdb, a defined amount of malt is milled in a laboratory
mill at 0.7 mm to produce a more brewery‐relevant crush. It is then mashed
under strict Congress mash parameters and extract is determined via density.
For extract reported as “dry basis,” the mass of the malt is reduced by the
moisture content, as water weight provides no extract potential. If moisture is
not taken into account, percent extract is reported “as‐is” (fgai and cgai).
Unlike fgdb, which uses malt ground to flour, the cgdb method is meant to
better model brewing conditions. Because the crush is coarser, the extract
may be lower. If the malt is well modified, the two measurements should be
close. A comparison of these two measurements is reported as the fine grind–
coarse grind (FG–CG) extract difference.
To measure extract, the specific gravity of the wort from the Congress
mash is measured, and the percent solid is read from a table or calculated
from an equation. The equation given in ASBC Method Wort‐3 is

Plato 135.997 SG 3 630.272 SG 2 1111.14 SG 616.868
144 RAW MATERIALS
where SG is the specific gravity measured at 20 °C and °Plato is the mass per-
cent solids. The total mass of extracted solid divided by the weight of the grain
is the fractional extract, which is usually reported as a percentage. Abbreviated
versions of the Congress mash have been proposed. British maltsters some-
times report hot water extract (HWE) in deg⋅L/kg as defined by the equation
1000 SG 1 Vol
HWE
mass malt
where SG is the specific gravity of a wort prepared under Institute of Brewing
and Distilling (IOB) test conditions, Vol is the volume of wort in liters, and
mass malt is in kilograms. The factor 1000(SG − 1) is the number of points,
also called degrees Oechsle (°Oe). One brewer’s point corresponds to
approximately 0.25 °P. There is no direct conversion between malt extract
percent derived from a Congress mash and HWE derived from an IOB mash.
MALT EXTRACT EXAMPLE
A batch of pale ale malt is found to have a moisture content of 4.0% by

ASBC Malt‐3. A 50.0 g sample of the malt is mashed according to ASBC
Malt‐4. The specific gravity of the resulting wort is measured to be
1.0352 at 20 °C. Calculate the malt extract, dry basis.
Solution
For convenience, we will do the calculation based on a double recipe of
100.00 g of malt and 800.0 g of water. The dry weight of the malt is 96.0 g.
The total water is the 800.0 g used to mash, plus the 4.0 g of water from
within the malt, for a total of 804.0 g.
Application of the equation above gives the solids content of the wort
as 8.830 °P = 8.830%. The mass of solids divided by the mass of wort
(water plus solids) is the mass fraction solids = 0.08830. In equation form,
mass solids
mfs
mass solids mass water
where mfs is the mass fraction of solids. The algebraic solution for the
mass of solids is
mfs mass water
Mass solids
1 mfs
Application of this equation with mfs = 0.08830 and mass water =
804.0 g gives mass solids = 77.87 g. The mass percent extract in the 96.0 g
of dry malt is 77.87 g/96.0 g × 100% = 81.1%.
MALT 145
Beta‐glucans are gums that increase the viscosity of beer wort. During
modification, they should be sufficiently degraded by glucanases. High beta‐
glucans are indicative of poor modification. They are analyzed by introduc-
ing a stain called Calcofluor, which binds the beta‐glucan to form a
fluorescent adduct. Ultraviolet light at 365 nm excites the adduct molecules,
which radiate blue light at 420 nm. This test has been subject to scrutiny
because it has moderate precision at best, and it is complicated and expen-
sive to run.
Viscosity of wort, by contrast, is quite easy to measure. Viscosity is resist-
ance to flow. The wort sample can be made to flow through a narrow tube or
orifice. The time for a certain volume to flow a specified distance is a measure
of the viscosity. Another method is to roll a small ball through a tube filled
with the wort sample. The time for the ball to roll a certain distance is a
measure of the viscosity. Excessive viscosity gives severe flow problems with
processes that involve the fluid passing through a porous medium, like filtra-
tion or wort separation. The base unit for viscosity is the pascal‐second (Pa∙s).
The centipoise (cP), which is 0.001 Pa∙s, is more commonly used. The viscosity
of water at 20 °C is 1.002 cP.
Friability is the ease of crumbling a sample. The friability of malt
increases with modification. Malt friability can be measured with an
instrument called a friabilimeter (Figure 4.15). The instrument has a per-
forated drum that acts as a sieve. A rubber roller presses against the
inside of the drum under spring tension. A 50.0 g sample of malt is loaded
into the drum, which rotates for a period of exactly eight minutes. The
friable parts of the malt kernels will break under the pressure of the
roller and be driven through the drum. The portion retained in the drum
is weighed and accounted as non‐friable. It has been argued that if a
brewer invests in equipment to check malt quality, the friabilimeter is a
great place to start.
FRIABILITY EXAMPLE
A 50 g sample of malt is loaded into the drum of a friabilimeter. After

8.0 minutes, 6.24 g of malt is recovered from the drum. Calculate the
percent friability.
Solution
Of 50 g of malt, 6.24 g is non‐friable, so 43.76 g is friable. The percent
friable is 43.76/50 × 100% = 87.5%.
146 RAW MATERIALS
Rotating drum
Roller
Friable malt
Non-friable
Figure 4.15 Friabilimeter.
Malt must exhibit high carbohydrate modification for optimal brewhouse

performance. Malt with low carbohydrate modification may lead to:
• Milling problems.
• Poor extract yields.
• Elevated final gravity; reduced attenuation due to excessive starch or
dextrins.
• Deeper lauter cuts and more tannin extraction.
• Slower runoff and more turbid wort.
• Beer filterability and haze problems.
Enzyme Potential For enzyme potential, we are looking for adequate

production of diastase (alpha‐ and beta‐amylase), which is required in the
mash to convert starch into fermentable sugars. It is important to confirm
that the activity of alpha‐ and beta‐amylase has been preserved past the
kilning process. Malt COA specifications involving enzyme potential include
diastatic power and alpha‐amylase.
Diastatic power derives from the combined action of the two major starch‐
converting enzymes, alpha‐ and beta‐amylase. It is measured by the amount
of starch hydrolyzed at 20 °C in 30.0 minutes by the enzyme extracted from a
sample of the malt. Diastatic power is measured either in degrees Lintner
(°L), degrees ASBC (roughly equal to °L), or Windisch–Kolbach units (°WK).
An approximate conversion is °WK = 3.5 × °L – 16. Diastatic power is a meas-
ure of how effective the malt is at converting starch to sugar. The minimum
diastatic power for malt to convert its own starch is about 40 °L. When base
malts and other starch sources are used, brewers generally look for an aver-
age diastatic power of at least 50 °L.
MALT 147
Alpha‐amylase activity can be measured independently of beta‐amylase

by using starch that has been pretreated with beta‐amylase. As the alpha‐
amylase hydrolyzes the starch chains, they lose their ability to make a color in
iodine. The unit of measure is the dextrinizing unit (DU), which is the amount
of alpha‐amylase that will hydrolyze starch at a rate of 1 g/h.
Today’s barley malt contains ample enzymatic potential. Poor diastatic
power is not usually a problem for most brewers. Only those brewers using
large amounts of adjuncts need to be concerned. Typical enzymatic potential
in barley malt can tolerate 30–40% adjunct additions to the mash with no
issue. The major impact of enzyme potential for a brewer is consistency.
Brewers should be able to repeat the same degree of attenuation for each
brew given the same mashing protocol. Maintaining consistency in enzyme
potential from lot to lot is important.
Color and Flavor Color and flavor are indicators of kiln performance.
Were the conditions of the kiln such that desirable color and flavor were
achieved? Malt color is controlled during the kilning process by the severity
of thermal treatment. As the temperature and treatment time increase, so
does the concentration of Maillard products. Because malt is the main source
of beer color, malt is graded for color.
Conventionally, measurement of malt color is based on the amount of blue
light (wavelength of 430 nm) that a sample of wort produced from the malt
will transmit (allow to pass through). The approximation is that beer is essen-
tially beer‐colored; all that matters is how light or dark it is. But this model is
not accurate for all beer or wort. Some beer is more yellow and some more
red, a topic discussed further in Chapter 13.
A sample of malt is milled and mashed following a standard procedure in
which 50 g of malt is mashed to a final dilution of 450 g (malt plus water). This
comes to 1.04 lb of malt per US gallon of water. The wort is filtered, and the
color measured in the same way as for beer (see Chapter 13). The color of the
test wort, ASBC or EBC, is reported as the malt color. An older system of
color, called the Lovibond scale, gives similar numbers to the ASBC scale.
Malt flavor is a critical kilning outcome, but its inclusion in malt COAs is
not standard. Part of the challenge in describing malt flavor has been on the
development of a relevant method to describe malt‐specific flavors. The
ASBC Methods of Analysis has been recently updated to include Sensory
Analysis 14: Hot Steep Malt Sensory Evaluation Method. This method can be
easily adopted by any brewery. In brief, 50 g of coarse‐ground malt is added to
400 mL of 65 °C (149 °F) distilled water in a thermos®. It is capped, shaken for
20 seconds, and steeped for 15 minutes. The “mash” is then filtered through
fluted filter paper into a collection container with a vorlauf step for the first
100 mL of filtrate. Wort sensory analysis is to be conducted within four
hours of filtration. This method is convenient and designed to limit starch
148 RAW MATERIALS
modification, and thus sweetness, which can obscure subtle malt flavors. Malt
flavor wheels using this method have been developed to further refine
descriptive analysis of malt flavor.
4.3 HOPS
Hops (Figure 4.16) serve several functions in beer. One family of components

provides a bitter taste to balance the sweetness of malt, and another provides
aromas to give each style of beer its character. Hops have antibacterial activ-
ity that can retard beer spoilage, they help stabilize beer foam, and they can
prevent excessive foaming during boiling.
The first historical mention of the use of hops in beer dates to 822 CE in
monastery rules written by Adalard of Corbie (761–826), a cousin of
Charlemagne, whereby a portion of the hops given to the abbey in tithes
would be set aside for beer. The first cultivation of hops was recorded in
Bavaria around 859 CE. In Europe over a period of hundreds of years, hops
supplanted gruit, a mixture of herbs based on bog myrtle (Myrica gale), also
called sweet gale. Today, hops are regarded as an essential feature of beer. In
the United States, “malt beverages” are defined by law to be prepared with
hops.
The Biology of Hops

The scientific name for hops, Humulus lupulus, was first described by Carl
von Linné, founder of modern taxonomy. “Humulus” is derived from the
Figure 4.16 Hops.

HOPS 149
Slavic name for hops, and “lupulus” from the Latin word meaning “little
wolf.” This description may be attributed to Roman scientist Plinius (Pliny)
the Elder who, in his landmark Naturalis historia, described a plant called
“lupus salicarius” or wolf of the willows. Perhaps this early nomenclature can
be attributed to physical attributes of the wild hop plants from which hops
were collected.
Hops are a flowering, climbing bine of the Cannabaceae family. Unlike
vines, which spread via tendrils, bines climb by wrapping in a clockwise man-
ner around a surface. In addition to hops (Humulus), there are two other
genera in this family: the hackberry tree (Celtis) and hemp (Cannabis). Hops
are further divided into five subspecies (H. lupulus spp. lupulus, H. lupulus
spp. americanus, H. lupulus spp. neomexicanus, H. lupulus spp. lupuloides, and
H. lupulus spp. japonicus).
Hops are dioecious, meaning there are separate male and female plants.
Flowers of the male plants produce pollen that is wind‐dispersed to fertilize
the female flowers. A female flower, also called a burr, is depicted in
Figure 4.17. Plants in a commercial hop field are 100% female. By excluding
males, the hop farmer ensures no mating takes place, thus maintaining the
exact same cultivar in the entire field. Also, fertilized strobiles contain seeds
that are rich in lipids, that could negatively affect foam stability.
The hop cone, which is the fruit of the plant, is the part used for brewing.
Cones develop from the female flowers. Technically described as a strobile
(Figure 4.18), the hop cone has a central strig that contains four bracteoles
(inner leaves) and a pair of bracts (outer leaves) at each node, arranged in a
structure that resembles a green pinecone (Figure 4.19). Lupulin glands
emerge from the base of each bracteole and produce yellow lupulin oil.
Lupulin glands contain hard and soft resins. The soft resins contain the alpha
and beta acids that provide the bitterness for which hops are prized. There are
4 mm
Figure 4.17 Female hop flowers (burrs).

150 RAW MATERIALS
Figure 4.18 Humulus lupulus: hop plant (female) with strobiles.
Strig
Lupulin
Bracteole
Bract
Figure 4.19 Hop strobile section.
over 300 compounds in the lupulin glands that are thought to contribute to
hop flavor and aroma.
Hops are perennial plants that grow from rootstocks (rhizomes) each year.
This allows female plants to be propagated by clipping and replanting the
rhizomes from the rootstock. Hop shoots emerge in spring and are harvested
in late summer or early fall. In commercial operations, hops grow on trellises
up to 50 cm per week, reaching a height of 6 m (20 ft). Hops grow best in
temperate climates with mild winters and require a long day (15 hours of sun-
light) for optimal hop cone production. These growing conditions typically
fall within the 35° and 55° latitude in the Northern and Southern Hemispheres.
HOPS 151
The Pacific northwestern region of the United States and regions in Belgium,
Germany, and the Czech Republic are prominent hop‐producing regions.
Southern Africa, Southern Australia, and New Zealand are also areas with
emerging hop crops. Although the northeast region of the United States has
an ideal temperate area for hop production, its humidity and rainfall promote
disease and pest pressure. Powdery mildew and aphid infestations are more
abundant in this area.
During harvest, small operations may require that hops be picked by hand,
as was historically done. The bines bear prickly hairs, so pickers should wear
gloves. Larger operations cut bines from the top, which then fall into trucks.
Picking machines then separate the hops from stems, leaves, and other for-
eign material. The hops are dried in hop kilns at about 65 °C (150 °F) for
8–10 hours. They are then cooled and pressed into bales of about 90 kg
(200 lb). Bales should always be stored cold to prevent oxidation and loss of
quality.
Hops in storage are susceptible to spontaneous combustion. The risk is
greatest when large quantities of hops are stacked up, when the hops are high
in alpha acids, and when some of the hops are damp. A 2006 fire in Yakima,
Washington, destroyed 4% of US hop production. Fortunately, there were no
human casualties.
Hop Flavor Chemistry

There are hundreds of flavor components in hops; we will only cover the most
prevalent compounds. Hops yield two broad classes of flavor compounds, bit-
ter compounds and aroma compounds. These compounds are mainly found in
lupulin.
Bitter Compounds There are two families of hop acids, one of which is the
alpha acids, sometimes called humulones. Figure 4.20 shows the three main
alpha acids – humulone, cohumulone, and adhumulone – as well as a generic
alpha acid in which the variable part of the molecule is represented by R.
Bitterness is a taste; only dissolved materials can be tasted. In their original
forms, compounds in hops are neither soluble nor bitter. To get bitterness,
(A) (B) (C) (D)

Figure 4.20 Alpha acids. (A) Humulone, (B) cohumulone, (C) adhumulone, and (D)
generic alpha acid.
152 RAW MATERIALS
hop alpha acids found in the resin must undergo a reaction called isomerization
to give iso‐alpha acids. Hops typically range from 3.5 to 20% alpha acids by
dry weight, depending on the variety, and about half that much beta acids.
The other family of hop acids is the beta acids, sometimes called lupulones.
The beta acids include lupulone (shown in Figure 4.21), colupulone, and adlu-
pulone, with the analogous differences in the side chain as the alpha acids.
Unlike the alpha acids, the beta acids do not undergo isomerization. In their
original form, they are largely flavor inactive, but they can produce bitter
oxidation products, such as hulupone, shown in Figure 4.22. Hulupone has the
same family of analogues as the alpha and beta acids, including cohulupone
and adhulupone. The additional bittering partially compensates for loss of
alpha acids during hop storage. Beta acids can be converted to bitter hop
products by chemical processes, but not during brewing.
Compounds from hops are not bitter until they undergo a chemical change
during boiling called isomerization. The isomerization products, called iso‐
alpha acids, also called isohumulones (shown in Figure 4.23), are bitter and
moderately soluble. The flavor threshold, which is the minimum amount that
can be tasted, for isohumulone is about 4 mg/L. Like the alpha and beta acids,
the iso‐alpha acids have corresponding analogues isocohumulone and isoad-
humulone. Some brewers believe that isocohumulone provides undesirable
harsh bitterness, but not everyone accepts this. Hop isomerization is covered
in more detail in Chapter 8.
Humulinones (Figure 4.24) are another important class of hop bitter
compounds. Structurally they are similar to iso‐alpha acids, but they have an
extra ─OH group on the ring. Humulinones arise from oxidation of alpha
Figure 4.21 Lupulone, a beta acid.
Figure 4.22 Hulupone, enol form.

HOPS 153
Figure 4.23 Generic iso‐alpha acid.
Figure 4.24 Humulinone.
acids; they do not require boiling to become bitter. They are about two‐thirds
as bitter as iso‐alpha acids. They can compensate, to some extent, for the loss
of alpha acids with storage, and they can be a significant source of bitterness
in dry‐hopped beers.
Aroma Compounds Aroma compounds, which are heat sensitive and

volatile, are in a fraction called hop oil. There may be over 400 compounds in
hop oil, most of which have unknown molecular structures and make unknown
contributions to beer flavor. Many of these compounds are present at barely
detectable concentrations, but their flavor contributions could nonetheless be
substantial. The standard dogma for aroma compounds seems to be that
compounds that are abundant in “noble hops” (Hallertauer, Tettnang, Saaz,
and Spalt) are pleasant and desirable and all others are harsh and objectionable.
Experience suggests that the complex aroma profiles of the different hop
strains defy simplified analysis in terms of good and evil compounds. The three
154 RAW MATERIALS
main classes of aroma compounds are hydrocarbons, which contain only

carbon and hydrogen; oxygen‐containing compounds; and sulfur‐containing
compounds. Most plant‐derived hydrocarbons are terpenes, compounds
assembled from five‐carbon units. Terpenes with 5 carbon atoms are called
hemiterpenes, those with 10 are called monoterpenes, and those with 15 are
called sesquiterpenes. Some hydrocarbons that are significant in most hop
strains include the monoterpene beta‐myrcene and the sesquiterpenes alpha‐
humulene and beta‐caryophyllene, all shown in Figure 4.25.
Oxygen‐containing aroma compounds include alcohols (have OH), car-
bonyl compounds (have C═O), and many others. Some of these have low
volatility, and it is likely that some of them could make an aroma contribution
even after boiling. Figure 4.26A shows the alcohol linalool, which contributes
a floral aroma. A comparison with myrcene (Figure 4.25A) shows that linal-
ool can be prepared by adding water (H─OH) across a double bond in
myrcene. Of the carbonyl compounds, esters can be important sources of fruit
and flower aromas. Figure 4.26B shows isobutyl isobutyrate, which has a
pleasant fruit aroma.
Sulfur‐containing compounds are usually bad‐smelling. The example in
Figure 4.27, S‐methyl thiohexanoate, is an exception. It carries a pineapple
aroma. It should be no surprise that compounds that smell bad on their own
can, at low concentrations, make a positive contribution to beer flavor.
Hop flavor and aroma is further complicated by a process called biotrans
formation. Biotransformation is a general term for the conversion of one
(A) (B) (C)

Figure 4.25 Hop terpenes. (A) Myrcene, (B) humulene, and (C) caryophyllene.
(A) (B)
Figure 4.26 Oxygenates. (A) Linalool and (B) isobutyl isobutyrate.
HOPS 155
Figure 4.27 S‐methyl thiohexanoate.
HO
OH
Geraniol Linalool
Figure 4.28 Biotransformation of geraniol to linalool by yeast.
compound into another through biological enzymes. In the case of beer, the
action of yeast can affect the final hop aroma. As an example of biotransfor-
mation, geraniol (rose‐like) from hops has been shown to be transformed into
linalool (citrus‐like) by brewer’s yeast (Figure 4.28). Brewer’s yeast can also
affect flavor through modification of glycosides. Hops contain glycosides,
which consist of a sugar, like glucose, covalently attached by a glycosidic link
to another compound, called (if it is not a sugar) the aglycone. In hops, many
aroma‐active compounds can serve as aglycones. Glycosides of linalool,
geraniol, nerol, vanillin, benzaldehyde, and phenylacetate as well as other
ketones, aldehydes, and alcohols have been discovered. Certain yeast strains
express beta‐glucosidases, enzymes capable of hydrolyzing the glycoside,
which releases the aglycone. Glycosides are typically flavor neutral, but the
aglycone released by hydrolysis may be flavor active.
Hops Processing and Products

One of the key issues in hopping beer is the efficiency of extraction of flavor
compounds into the wort or beer. The low pH of beer makes extraction dif-
ficult. The percentage of the amount of a flavor compound extracted to the
total amount in the hops is called the hop utilization. The term is mostly used
for the extraction of hop bitter compounds. The type of hop product and
details of the brewing process affect hop utilization.
Hop aging begins at harvest. As soon as the hop plant is removed from the
ground, oxidation ensues. Hops do not improve with age; they are best used
156 RAW MATERIALS
fresh. Oxidation drives the loss of alpha acids and the formation of humulinone
and hulupone, which are less bitter but more soluble. Once baled, hops should
be immediately placed in cold storage, which also mitigates fire risk. Advanced
hop products, like extracts, are very shelf stable.
Fresh Hops Unprocessed hop cones, variously called fresh hops, green
hops, and wet hops, are about 80% water. They are picked fresh and should be
used within 24–48 hours to avoid oxidation. The flavors imparted by fresh
hops are described as fresh or grassy. Because fresh hops must be used quickly,
analytical methods and data are often lacking, making consistency difficult.
Excess moisture further complicates the use of fresh hops. Since fresh hops
are 80% water, brewers must use six to eight times the amount of fresh hops
as dry hops. The hops soak up beer, which can lead to a significant loss in beer
volume. Because fresh hops are so perishable, use is restricted to a few batches
at harvest time.
Leaf Hops Dried hop cones, often compressed to save space, are called leaf,
flower, or whole cone hops. After harvest, the hop cones are cleaned, layered
on perforated shelves in a kiln, also called an oast, and dried in a stream of air
in the temperature range of 50–65 °C until the water content reaches the
desired level, typically about 10%. The details of the depth of layering, the air
flow rate, and the heating and cooling program are critical to the character of
the hops, especially to the aroma. Different strains of hops may undergo
different drying regimes. After cooling, the cones are pressed into bales of as
much as 100 kg. Fifty kilograms of hops is sometimes called a zentner (abbrev
Znt). The leaf hops may be used directly for brewing, but most of the hops
undergo additional treatment.
Leaf hops present technical issues in beer processing. They are the least
stable processed form of hops in storage. Leaf hops are irregularly shaped;
they cannot be depended upon to feed smoothly from hoppers. They must be
added manually or blown about with air or carbon dioxide. Their low appar-
ent bulk density (~0.15 kg/L) adds to the cost of transport and storage. The
void space within the cones absorbs an objectionable volume of beer or wort
during beer production. Because of their large particle size, the efficiency of
extraction of desired compounds (utilization) is low. Leaf hops are not com-
patible with the whirlpool and must be removed by other apparatus. Only a
few brewers use leaf hops.
Pellet Hops Some of the technical issues that plague leaf hops are solved
by pellet hops. Pellets originate as leaf hops that are broken up to a powder at
low temperature, usually in a hammer mill. The milling produces a powder
that can pass through a 140 mesh sieve (105 μm). Milling ruptures the lupulin
glands. The powder may be blended with other varieties of hops, and it may
HOPS 157
be separated by a program of freezing and sieving to give a lupulin‐rich

fraction. Pellets prepared without separation are conventionally known as
type 90 pellets, because the yield of pellets is about 90% of the leaf hops.
Concentration of the lupulin yields type 45 pellets. The separation is not
perfect, so type 45 pellets generally contain less than twice as much lupulin as
type 90 pellets. Immediately after preparation, the powder is driven with
rollers through holes, typically 6 mm diameter, to give cylindrical pellets.
Figure 4.29 shows 5 mm diameter pellets. The pelleting operation generates
heat, so cooling is sometimes applied to avoid damage to the flavor
components of the hops. The pellets are packed in air‐resistant bags, purged
with carbon dioxide or nitrogen, and sealed either with the inert gas or under
vacuum.
The apparent bulk density of pellets is three to four times that of leaf hops.
When added to wort or beer, the pellets quickly return to the powder from
which they were pressed. The rupture of lupulin glands and the small particle
size enhances utilization from about 20% in leaf hops to 35% in pellets, an
increase of 75%. Pellet hops take less space, absorb less beer, and weigh less
than leaf hops, because they are more dense, and are better utilized, so less is
needed. If the hops contain traces of contaminants, like pesticides, less hops
means less contamination of the beer. The pellets usually roll smoothly and
are easy to dispense mechanically. Because of the compression, pellet hops
are less subject to degradation than leaf hops, so it is easier to maintain their
freshness. Pellet hops should be stored at −20 °C (–4 °F) to prevent oxidation.
Pellet hops stored at 0–4 °C are best used within one year. Storage at −20 °C
will maintain freshness for up to three years. Hop pellets usually contain 80%
or more insoluble material that must be removed from the wort after boiling,
usually in a whirlpool.
Hop Extract Flavor compounds can be extracted into solvents and

concentrated for use in brewing. The solvents in general use are liquid or
supercritical carbon dioxide and ethanol. Supercritical carbon dioxide is CO2
Figure 4.29 Hop pellets, 5 mm diameter.

158 RAW MATERIALS
whose temperature is higher than 31.1 °C and whose pressure is higher than
73 bar, the critical point. In practice, pressures are in the range of 150−300 bar
(2175−4350 psia). Formerly hexane (C6H14) and other organic compounds
were also used as solvents, but they have fallen into disuse. Today, most hop
extract is made with supercritical carbon dioxide. The product is called CO2
extract or pure resin extract (PRE). Hop extract is about a factor of four
more concentrated than the original hops. It contains none of the insoluble
plant matter of the leaf hops or pellets, so removal of spent hops in unnecessary.
Hop extract can be used as a substitute for leaf or pellet hops, although some
adjustment in processing may be needed because the relative amounts of
bitter and aroma components may have changed. Hop extract is a thick syrup.
It often comes in containers with a fixed amount of alpha acid. As with leaf
hops and hop pellets, hop extract must be boiled to isomerize the alpha acids
into soluble bitter compounds. Utilization of alpha acids is about the same as
that from pellets, about 35%. Hop extract, stored cool in a sealed container,
retains its potency for years, especially for bittering.
Stabilized and Isomerized Hop Pellets Stabilized hop pellets are prepared

by the mixing in of about 2% food‐grade magnesium oxide to the hop powder
before pelletization. The heat generated by pelletization converts most of the
alpha acids to their magnesium salts. This improves storage stability and
moderately improves alpha acid conversion during the boil.
Isomerized pellets have the alpha acids converted to the soluble, bitter
iso‐alpha acids during processing. Conversion is highly efficient (>96%), in
contrast to isomerization during the boil. Iso‐pellet utilization is 45–55%. For
the same level of bittering, a smaller amount of isomerized pellets is needed
compared with standard pellet hops. Pre‐isomerization does nothing to
increase the yield of aroma compounds, so less hops will yield less aroma.
Isomerized pellets are prepared by adding about 1% food‐grade magnesium
oxide (a base) and then pressing them into pellets. The pellets are packaged
under vacuum or inert gas and are then held for several days at 50 °C to com-
plete the isomerization. The processing procedures for isomerized hop pellets
are about the same as those for type 90 pellets, but isomerized pellets do not
require refrigerated storage if aroma is not an issue.
Isomerized Kettle Extract (IKE and PIKE) Hop extract can be pre‐
isomerized by treatment with magnesium oxide and heating to 100 °C. The
products are magnesium salts of the iso‐alpha acids, which are solid. The
mixture is treated with an acid to convert the salts into liquid iso‐alpha acids.
The resulting mixture, called isomerized kettle extract (IKE) is similar to
kettle extract, but the alpha acid utilization is 50–60%. IKE contains fractions
that need to be removed by boiling, so it cannot be added later in the brewing
process. If the IKE is neutralized with potassium hydroxide, the iso‐alpha
HOPS 159
acids are converted to potassium salts, which are more water soluble than the
free acids. The resulting product is called PIKE.
Isomerized Hop Extract Isomerized kettle extract can be refined by

manipulating the pH and temperature in several steps to put the iso‐alpha
acids in a different phase from other components. The refinement can be
carried out before or after isomerization. The refined product is called
isomerized hop extract. Because the sources of off‐flavors and other
processing issues have been removed, isomerized hop extract can be added to
the fermenter or even during conditioning to adjust bitterness.
Hydrogenated Hop Products Iso‐alpha acids are subject to degradation

by light. The degradation products can undergo a series of reactions, discussed
in Chapter 12, leading to the formation of 3‐methylbut‐2‐ene‐1‐thiol known
as MBT. This compound creates a skunky off‐flavor, called lightstruck, even
at a concentration in the range of a few nanograms per liter (ppt). This is
especially an issue if the beer is packaged in colorless or green bottles, as
more light is transmitted through the glass as compared with brown bottles. If
hydrogen is added across some of the double bonds in the iso‐alpha acids,
susceptibility to this defect is virtually eliminated. Iso‐alpha acid molecules
have six double bonds. Three of these, a C═O bond and two C═C bonds, form
a conjugated system of alternating double and single bonds. Conjugation
gives the bonds extra stability, making them harder to hydrogenate. The
remaining double bonds, two C═C bonds and one C═O bond, shown in red in
Figure 4.30, can be hydrogenated to yield the corresponding single bonds. The
C═O bond can be hydrogenated chemically by the action of sodium
Figure 4.30 Iso‐alpha acid bonds that can be hydrogenated.

160 RAW MATERIALS
borohydride (NaBH4), yielding a product called rho isohumulone (“rho”),

shown in Figure 4.31A. The two C═C bonds can be hydrogenated by direct
metal‐catalyzed addition of hydrogen, giving tetrahydroisohumulone
(“tetra”), shown in Figure 4.31B. If both processes are carried out, the product
is hexahydroisohumulone, shown in Figure 4.31C.
The hydrogenated products differ from untreated iso‐alpha acids in more
than their light stability. They contribute different levels of bitterness, and
some of them enhance foam stability. Hexahydroisohumulone is sometimes
used for foam stability even when light stability is not an issue. Table 4.11
compares the three hydrogenated iso‐alpha acids with untreated alpha acid.
Analytical and Quality Control Procedures for Hops

Hops are dried and packaged at harvest time and may need to last for an
entire year before use. The hops should be packaged in an inert atmosphere
and kept sealed until used. They should be kept in a refrigerator or freezer.
Any unused portion should be repackaged tightly and immediately returned
to the cold storage. Opened hops should be used within a few weeks.
Physical Inspection Hops, although only a small component of beer, make

a large contribution to its flavor. Many brewers go to the growing regions at
(A) (B) (C)

Figure 4.31 Hop products. (A) Rho isohumulone, (B) tetrahydroisohumulone, and
(C) hexahydroisohumulone.
TABLE 4.11 Hydrogenated Versus Standard Iso‐alpha

Acid Performance
Hop Product Bitterness Foam Stability
Rho Less Same
Tetra Much more More
Hexa Same Much more
HOPS 161
harvest time and inspect samples of the hops. They look at the hops, cut them
open and look inside, crush them and smell them, make tea from them, etc.
This is called physical inspection. A good lot of hops should have relatively
low amounts of debris such as leaves, twigs, and seeds. The inspector should
note the vibrancy of the color. Pellets should be crushable with finger pressure.
Glossy‐hard surfaces that resist crushing suggest excessive heating during
pelletization. Further, hard pellets will not dissociate as easily when added to
beer, potentially creating utilization problems.
In the hands of an experienced inspector, organoleptic evaluation can be
very informative regarding the aroma quality. To evaluate dried hop cones, a
handful of hops are rubbed vigorously between the palms to break the lupu-
lin glands and warm the sample. During this process the feel of the hops can
be noted, but most importantly, the aroma should be evaluated, noting any
smell of oxidation. The shortcoming of this technique is that it tells nothing
about bitterness, a key flavor attribute, because bitterness is not present in the
raw hops, but it is developed by boiling.
Measurement of Alpha and Beta Acids Hop suppliers invariably provide

alpha and beta acid content. They can be measured several ways. One method
for measurement of alpha and beta acids in hops is based on ultraviolet
spectroscopy. A sample of hops is extracted and diluted. The absorbance of
the solution is measured at wavelengths of 355, 325, and 275 nm. The results
can be used to calculate the amounts of alpha and beta acids in the hop
sample. Another method is conductometric titration with lead acetate. These
methods are given in detail in ASBC Method Hops 6. Hop alpha and
beta acids are more accurately measured using high performance liquid
chromatography (HPLC) according to ASBC Method Hops 14. HPLC
calibration standards prepared by the International Hop Standards
Committee can be purchased from the ASBC.
Hop Storage Index The absorbance values collected for measurement of

alpha and beta acids can also be used to determine the hop storage index
(HSI) according to ASBC Method Hops 12. The HSI provides a general
overview on the “freshness” of the hops. The hop storage index is defined by
HSI = A275/A325. An HSI of 0.2–0.25 indicates very fresh hops, 0.25–0.3
indicates fresh hops, 0.3–0.4 indicates slightly oxidized hops, and anything
greater than 0.4 indicates high oxidation. While oxidation may negatively
impact alpha acid utilization, slight oxidation may be considered beneficial
for the creation of citrus and floral flavors. HSI and oxidative effects are
affected by hop variety.
Total Essential Oils The total oil fraction from hops is considered an
important measure for hop quality and consistency from lot to lot. Suppliers
162 RAW MATERIALS
usually provide the concentrations of total essential oil and of their

constituents including myrcene (Figure 4.25A), humulene (Figure 4.25B),
caryophyllene (Figure 4.25C), and farnesene, which is usually very low. Total
essential oils in hops and hop pellets are determined by steam distillation
(ASBC Hops 13) or by gas chromatography (ASBC Hops 17).
Water
1. For the reaction HCO3− + HPO42− → H2CO3 + H2PO4−, which is the acid
and which is the base?
2. What is the concentration range in ppm for calcium ions in “moderately
hard” water?
3. Express the hardness and alkalinity of Pilsen and Dublin water, as given
in Table 4.4 above, in units of ppm as CaCO3.
4. Go online and obtain your municipal water report. Comment on the
quality of this water for beer production based on the sodium, hardness,
and alkalinity.
5. Given the water profile below (in ppm), comment on each ion’s contribu-
tion to beer production or flavor based on recommended concentrations.
For which style of beer would this water be well suited?
Ca2+ Mg2+ Na+ Cl− SO42− HCO3−

187 20 113 85 247 20
6. What are the differences among municipal, DI, and RO water?

7. How should all breweries treat municipal water for effective beer
production?
8. You are interested in making an IPA with a very bright, firm bitterness as
made famous by beer made in England at Burton‐on‐Trent. To approach
the astringent bitterness of this region, you would like to do a single
chemical addition to increase your sulfates to about 300 ppm. This pro-
cess, informally called “Burtonizing water,” simply requires the addition
of gypsum. Gypsum is calcium sulfate dihydrate (CaSO4 · 2H2O). You
work for a brewery with the water profile given in problem 5.
Part I: Calculate the mass percent of sulfate in gypsum.
Part II: Calculate the amount (in grams) of gypsum required to raise the
sulfate level to 300 ppm in 100 L of municipal water.
Part III: After addition of your gypsum in Part II, calculate the final
Ca2+ concentration (in ppm) in this same 100 L batch of Burtonized
water.
Malt
9. The drawings below represent end‐on views of heads of barley. Choose
the barley whose malt would be most suitable for a high‐adjunct interna-
tional lager. Explain your choice.
10. During the malting process, what is meant by the term modification? It
could be argued that it is better to brew with an over‐modified malt than
an under‐modified malt. Support this statement with an explanation of
the science of malting and the implications of modification on the brew-
ing process.
11. Organize the following malt types in order of decreasing diastatic power:
chocolate, crystal, distiller’s, Munich, pale ale, Pilsner, and Vienna. How
does this compare to color?
12. Explain how to inspect new malt delivered to the brewery. What physical
qualities can you immediately evaluate?
13. On a piece of paper, write three squares with the three steps of the malt-
ing process in order. Above each square, describe the process inputs (i.e.
time, temperature, process conditions, etc.). Below each square, write the
process outputs or checkpoints (i.e. final % moisture, CO2, acrospires
length, etc.)
14. Which carbohydrate in barley malt causes an undesirable increase in
wort viscosity?
15. In your most recent shipment of pale 2‐row malt, the COA (below)
showed some significant differences from previous shipments. A. Explain
how these differences would affect your brew if nothing on the process
end was changed. Explain how you might adjust for these differences in
the brewhouse given the new shipment.
164 RAW MATERIALS
Typical New Shipment

Specification Measurement Measurement
Malt moisture 4.0 4.0
Extract (FG db) 80 70
Color (ASBC) 2.0 2.0
Total protein (T,%) 11.0 11.0
S/T ratio (%) 42 25
FAN 200 150
Beta‐glucan (ppm) 100 150
Hops
16. Many sources incorrectly state that female hop flowers are used to fla-
vor beer. Correct this statement.
17. What are some reasons for using hydrogenated hop extract?
18. What is the effect of boiling on the flavors provided by hops?
19. Your Director of Operations found an opened but resealed bag of hops
in the cooler. It is at least three years old, but the Director would like you
to use it in an upcoming collaboration beer. Describe why that is not a
good idea. What scientific data could you present to support your
argument?
20. What are humulinone and hulupone? How do they affect the brewing
process?
BIBLIOGRAPHY
Almaguer C, Schönberger C, Gastl M, Arendt EK, Becker T. 2014. Humulus lupu-

lus – a story that begs to be told. J. Inst. Brew. 120(4):289–314. doi: 10.1002/jib.160.
A detailed review article about hop biology, chemistry, and use in brewing.
American Society of Brewing Chemists. 2017. Hot steep malt sensory evaluation
method. Methods of Analysis. Sensory‐14.
Bamforth CW. 2002. Standards of Brewing. Brewers Publications. ISBN 978‐0‐937381‐3.
Barth R. 2013. The Chemistry of Beer: The Science in the Suds. Wiley.
Cheetham NWH. 2011. Introducing Biological Energetics. Oxford University Press.
ISBN 978‐0‐19‐957593‐0.
Combes RP. 1998. Hop products. Brewer. 84:29–35. Overview of the preparation and
uses of hop products.
Eumann M, Schildbach S. 2012. Water sources and treatment in brewing. J. Inst. Brew.
118:12–21.
BIBLIOGRAPHY 165
Hieronymus S. 2012. For the Love of Hops. Brewers Publications. ISBN

978‐1‐938469‐01‐5. Covers hop biology, processing, and use in brewing.
King A, Dickenson RJ. 2000. Biotransformation of monoterpene alcohols by
Saccharomyces cerevisiae, Torulaspora delbrueckii, and Kluyveromyces lactis. Yeast
16(10):499–506.
Kunze W. 1999. Technology of Brewing and Malting, International ed. VLB. ISBN
3‐921690‐39‐0. Chap. 2.
Lewis ML, Young TW. 2001. Brewing, 2nd ed. Springer. ISBN 0‐8342‐1851‐8. Chap 18.
Fermentation biochemistry.
Mallett J. 2014. Malt. Brewers Publications. ISBN 978‐1‐938469‐12‐1.
Noonan GJ. 1996. New Brewing Lager Beer. Brewers Publications. ISBN
978‐0‐937381‐82‐3. p. 10.
Palmer J. 2017. How to Brew, 4th ed. Brewers Publications. ISBN 978‐1‐938469‐35‐0.
Palmer J, Kaminski C. 2013. Water. Brewers Publications. ISBN 978‐0‐937381‐99‐1.
Comprehensive resource on water for brewing.
Sidor L, Peacock V. 2006. Hops and hop products. In Ockert K (editor). Raw Materials
and Brewhouse Operations. Master Brewers Association of the Americas. ISBN
0‐9770519‐1‐9. Chap. 4. p. 73–109.
Thomas D. 2014. The Craft Maltsters’ Handbook. White Mule. ISBN 978‐0‐9910436‐2‐0.
Wahl R, Henius M. 1902. American Handy Book of the Brewing, Malting, and Auxiliary
Trades. Wahl and Henius. Vol. 2. p. 790.
Woodske D. 2012. Hop Variety Handbook. CreateSpace Independent Publishing
Platform. ISBN 978‐1475265057.
Chapter 5
GRAIN HANDLING AND MILLING
Malt is the second ingredient in beer, after water. Unlike water, malt is easily
damaged during transfer and storage. Malt is susceptible to spoilage from
microbes, mold, insects, and rodents. Malt can also be a source of dust that can
be an inhalation hazard, a fire hazard, and a source of contamination to the
brewing process. Malt may change hands several times on its way to the brew-
ery. Once at the brewery it will be conveyed from the carrier’s truck to storage
to equipment to weigh out the grain bill to the mill and finally to the mash
conversion vessel. The brewer must organize each step in the malt’s journey
to maintain malt quality and to minimize its hazards.
5.1 MALT STORAGE AND TRANSFER
Malt Receiving
Malt should always be inspected upon delivery before acceptance by the
brewer. It is highly recommended that a contact person at the brewery be
assigned the responsibility to develop and execute standard operating proce-
dures regarding malt receiving.

167
168 GRAIN HANDLING AND MILLING
Malt inspection starts with the delivery truck. If receiving pallets or bags of
malt, ask the truck driver if any other products were loaded in the same deliv-
ery. Bags are not impervious to gas and may admit unwanted odors. As each
pallet is unloaded, check each for integrity; look for physical damage, stain-
ing, moisture, or foreign objects. Pay particular attention to infestation by
insects, a topic covered in more detail in Section “Malt Infestations.” The
shipper (you) usually has the right to refuse acceptance while the carrier
(the truck) is still there. Any malt that seems infested should go right back on
the truck. If something looks damaged, stop immediately and note the prob-
lem on the bill of lading. Then follow up with the vendor’s customer service
representative. If receiving bulk malt from a truck or a train, samples from
several locations in the shipment should be taken with a grain trier, as
explained in Chapter 4. Each sample should be checked for quality and integ-
rity. If it is not practical for the samples to be inspected before the delivery is
unloaded, it is possible to keep the grain in a holding bin until it is accepted
or rejected. In this case, there will need to be a clear, binding agreement on
return of rejected grain for refund or credit, who pays for return shipment,
and related issues.
Malt Storage
There are several ways to store malt; the appropriate method depends on the
scale of the brewery. For a small craft brewery, malt storage and transfer may
be all manual, with grain sacks and buckets transferred by hand or by fork lift.
With larger‐scale and more frequent brewing, malt may be stored in super
sacks or a silo for bulk malt storage. This practice offers significant cost sav-
ings as malt suppliers often provide discounts for bulk shipments and may
even offer financing options to support silo procurement.
Malt bags are delivered in 50 lb (22 kg) or 25 kg (55 lb) quantities on pallets
that may contain up to 40 bags per pallet. Bag material may be double‐walled
paper or a more durable (and sometimes recyclable or reusable) woven poly-
propylene. Neither material is impervious to moisture or odor, so care must
be taken to avoid each. Bags should be stored on pallets or industrial strength
racks to keep the bags off the ground. Avoid high traffic areas as a snagged
bag could lead to a malty mess. Ensure prolonged malt quality by storing your
malt in cool, dry locations.
Large breweries may invest in silos and have the malt delivered “in bulk,”
that is, without packaging. The biggest consideration for purchasing a silo is the
rate of malt usage. It is recommended that malt be stored in a silo for no more
than six to eight weeks. Minimum recommended storage volumes are 22 000 kg
(48 000 lb), which is also a manageable amount of malt for delivery via truck.
MALT STORAGE AND TRANSFER 169
HOW TO OPEN A SEWN MALT BAG
Malt sacks are often sewn shut. It is better to remove the stitching than
just to cut a hole in the bag or rip into the stitching, which can compro-
mise the integrity of the bag and lead to polypropylene debris falling
into the malt. Here is a reliable method to remove the stitching quickly
and cleanly while opening a bag (Figure 5.1).
Step 1: Find the single loop stitching on one side of the bag. On the
other side of the bag is double loop stitching.
Step 2: Face the side with the single stitch and grab the overhanging
thread on the right side.
Step 3: Cut the double string closest to the bag.
Step 4: When you pull the single stitch string, the entire string will come
off in one piece.
Figure 5.1 Opening a bag of grain.

You may wish to consider a silo if your consumption of a particular type of malt
exceeds 2700 kg (6000 lb) a week.
Although silos are water tight, they are often single‐walled vessels that
are subject to environmental temperature fluctuations. During large warm
and cool swings, the grain near the wall may release moisture, especially if
any of the seeds can sprout. This moisture can lead to mold growth. Another
area of concern for silos is the significant amount of dust. Dust represents
an explosion hazard, so silos should be equipped with an air vent that
feeds into a dust‐collecting filter sock that is easy to replace from the
ground level.
Malt silos may be filled pneumatically or mechanically and are often filled
from the top. To ensure complete emptying, a bottom hopper angle (meas-
ured from one side of the hopper to the other) of 40–45° is recommended.
However, even with such a hopper, uneven flow patterns called channeling
can cause some malt to remain in the silo even after a new batch of malt has
been loaded (Figure 5.2). For this reason, malt silos should be completely
emptied once or twice a year to avoid accumulating stale malt. If more than
one silo holds the same type of malt, one silo should be completely emptied
before grain is drawn from another.
Intermediately sized malt deliveries come in super sacks, also called flex-
ible intermediate bulk containers (FIBCs). Super sacks of malt typically
range from 450 to 1000 kg (1000–2200 lb). They are reusable containers
typically made of woven material with straps on each corner for transport
by a fork lift. Malt super sacks usually have a 30–35 cm (12–14 in.) spout on
the bottom for rapid emptying into a hopper. Racks designed for super
sacks may have a large receiving shelf upon which the sack can sit. The
opening then feeds into a hopper with an iris valve to control the flow of
malt (Figure 5.3).
Figure 5.2 Channeling of malt in a silo during storage and emptying.

Figure 5.3 Super sack on dispensing rack at Yards Brewing Company. Pipes to the
left and below are parts of an aeromechanical conveyor.
Malt Transfer
Malt Measurement The amount of each type of malt and other dry
ingredients is a critical element of a beer style. The malt must be weighed
carefully, especially the types that contribute intense or unusual colors or
flavors. Small amounts of malt can be weighed out on conventional scales,
but when hundreds or thousands of kilograms are used, the container from
which or to which it is transferred is weighed before and after the transfer.
The device that does the actual weighing is a load cell. A load cell is a piece
of material or a hydraulic device that deforms slightly under the weight
applied to it. The amount of deformation is measured with a strain gauge,
typically a material whose resistance changes with extension, compression,
or bending. Compression load cells can be installed under the feet of vessels
that stand on the floor, or tension cells can be attached to the supports of
those that hang from above. The load cells must be mounted so that the force
passes through the cell in the proper direction. The load cells must be
properly calibrated. If they are overloaded, they will give an erroneous
reading, and they may not recover their accuracy if their elastic limits are
exceeded. Abruptly dropping a large amount of material into a vessel
equipped with load cells may permanently damage them. A load cell is
usually accurate to some fraction of its full range, so a load cell designed for
several tonnes may not give a precise reading for a few kilograms.
Malt Control The speed of malt delivery by gravity feed from hoppers, silos,
or super sacks is usually controlled by valves that can change the effective
opening through which the malt flows. Usually the valves have gates or plates
that enter the flow path at a right angle to the direction of flow. Valves that
move parallel to the flow direction, like butterfly valves, experience wear
from fighting the momentum of the grain, and their sealing surfaces are
subject to damage from particles that are trapped when they close. Gate
valves have a plate, sometimes described as a knife, that can be pushed into
or pulled out of the opening to control grain flow (Figure 5.4). An iris valve is
a variation on the gate valve in which several plates enter the flow path
maintaining a roughly circular opening. A type of iris valve with fabric
“plates” can be used to constrict the flow in a flexible tube like the spout of a
super sack.
Conveying Systems When only using 25 kg bags, malt transfer can be
manual, but with larger volumes of malt comes the need for more efficient
malt transport. The most cost‐effective methods for transport are those with
the shortest paths. Malt transportation from silo to mill to mash tun should be
as short as possible while maintaining operator safety and grain integrity.
Designing the brewery to have short paths can yield significant savings in the
initial cost of conveying systems and in their operating costs.
Figure 5.4 Gate valve.

Five types of conveyor systems are regularly used for moving malt and
grain. Belt conveyors have a flexible belt that carries the material. Each end
of the belt goes around a pulley; one pulley is connected to a motor that pro-
vides power, and the other pulley provides tension. The top of the belt is
supported by a platform or by idler rollers that support the belt against the
weight of the grain as shown in Figure 5.5. The idler rollers can be configured
to form the belt into a trough, keeping the kernels from dropping off the edge
of the belt. Belt conveyors can be up to 200 m long. They can be loaded or
unloaded at any point. Enclosing them to control dust and contamination can
be cumbersome and expensive. They do not easily accommodate turns, and
they can raise or lower grain only through a small angle; otherwise the grain
rolls down. Belt conveyors have many nip points that can injure workers if
not properly covered with guards.
Screw conveyors, also called augers or worms, have a spiral band
enclosed in a tube or trough, as shown in Figure 5.6. A motor turns the
band, driving the grain along the tube toward the discharge point. Screw
conveyors are generally limited to 20 m (65 ft). They can bend to a limited
extent. The enclosure helps to control dust and contamination. They are
most effective at horizontal transfer but can be used to lift grain at an
angle of up to 30°. Capacity and energy efficiency fall off with lift angle.
belt
tension
pully idler
drive
bucket pully
conveyor
belt conveyor
Figure 5.5 Belt and bucket conveyors.
Figure 5.6 Screw conveyor.

The enclosed tube guards the major nip points during normal operation,
but this may promote pinch points that cause malt breakage.
Bucket conveyors, also called elevators or grain legs, lift grain vertically in
buckets attached to chains or a belt. The chains or belt goes around pulleys at
the top and bottom with the drive shaft at the top. Bucket conveyors save
space, because they are not limited to shallow lifting angles. They are gener-
ally loaded at the bottom as the bucket scoops malt out of a trough or gutter,
and they are unloaded at the top. Large grain storage facilities, also called
grain elevators, use bucket conveyors to raise the grain to the top of a tower
from which it is distributed by gravity. The conveyor system is generally
enclosed, providing protection against dust and contamination. It exerts little
physical force on the malt that could cause breakage. It can be difficult to
completely empty the bottom trough. A lower‐level belt conveyor entering at
one angle feeding a bucket conveyor that, in turn, feeds another belt con-
veyor exiting at a higher level in a different direction can be used to carry
grain around a bend of any angle as shown in Figure 5.5.
Drag conveyors, also called cable or chain conveyors, consist of a tube
with paddles, also called flights, moving the length of the tube. The paddles
are moved by chains or cables. Drag conveyors can operate at any angle
from horizontal to vertical. They can, with special mechanical gear, follow a
curved path and go around (rounded) corners of large enough radius to
guide the cable or chain. In the standard drag conveyor, the spaces between
the paddles are filled with grain, and the motion of the cable or chain drags
the paddles and the grain with them. The aeromechanical conveyor, also
called a cable and disk conveyor, shown in Figure 5.7, is more common for
grain handling. The paddles are quickly pulled by a cable. The grain is moved
largely by the air moved by the paddles. The space between the paddles is
about 20% grain by volume, and the rest is air. To load the conveyor, the
grain is metered in to avoid overloading. The major advantage of the aero-
mechanical conveyor over the standard drag conveyor is that it causes less
grain abrasion. Drag conveyors are enclosed, which cuts down dust and
contamination.
Screw conveyors, bucket elevators, and tubular drag systems cannot be
completely emptied. Therefore, it is essential to add specialty malt between
Figure 5.7 Aeromechanical conveyor.

additions of the main malt, so that any malt held up in the conveyor will not
contribute unexpected flavors or colors to the next batch.
Pneumatic conveyors use air or a vacuum to move the grain through a
pipe. The air is moved by a blower and it drives the grain with it. Pneumatic
conveyors can operate at any angle and can negotiate narrower curves
than drag conveyors. Pneumatic conveyors require equipment to sepa-
rate the air from the grain at the delivery point. They use a good deal
more energy than other conveying systems. A potential disadvantage of
pneumatic c onveyors is that the physical forces they exert on the malt may
lead to breakage.
Malt Infestations
Pests, including insects and rodents, can cause expensive damage to stored
malt. Inspections of malting facilities in Europe have found over 80 species of
insects and mites. Those that represent the most risk are the grain weevil
(Calandra granaria), the confused flour beetle (Tribolium confusum), the red
flour beetle (Tribolium castaneum), and the saw‐toothed grain beetle
(Oryzaephilus surinamensis).
The grain weevil (3–4 mm) multiplies rapidly, laying some 100 eggs during
a lifespan of seven to eight months. Adults lay eggs in a small hole they make
on the surface of the seed. They seal the eggs in the hole with a gelatinous
material that they secrete. When the larvae hatch, they burrow into the
endosperm and finally emerge from the hole as adults. Such holes in malt are
characteristic of grain weevil infestation, and once they are apparent, the malt
has already been infested by at least one generation. As a result, damage can
quickly escalate. A simple float test can help identify grain weevil‐infested
malt; grains that float on water are probably infested. The optimum tempera-
ture for grain weevil reproduction is 16–20 °C (61–68 °F). Lower temperatures
do not kill the grain weevil, which accounts for its hardiness in surviving
through the winter. It cannot multiply in malt with a moisture content lower
than 10%.
The confused flour beetle (T. confusum) is more common in the northern
United States, and the red flour beetle (T. castaneum) in the south. Both are
around 4 mm long and commonly infest malt and flour. Unlike the grain wee-
vil, they cannot survive the winter in unheated silos, and they do not burrow
into the grain, so the larvae and adults can only feed on damaged grain or
flour. The most common infestations are in bags or bins in the brewery where
conditions favor breeding. With a lifespan of eight to nine months, an adult
can lay up to 300 eggs. The life cycle from egg to adult takes about 90 days at
22 °C (71 °F) and 22 days at 30 °C (90 °F). They are resistant to high tempera-
tures and can survive in malt with moisture of 5–7%, making them the most
common insect infestation in brewer’s malt.
Figure 5.8 Saw‐toothed grain beetle infestation of malt flour.
The saw‐toothed grain beetle (Figure 5.8) has a lifespan of 6–10 months.

Like the flour beetle, it cannot burrow into grain and must feed on damaged
malt or flour. It is extremely temperature tolerant, capable of surviving
through the winter and withstanding temperatures of 40 °C (104 °F). Its life
cycle takes about 72 days at 21 °C (70 °F) and 24 days at 27 °C (81 °F). It is less
tolerant to low humidity and has not been found in malt below 9%
moisture.
Because of the nature of farms, malthouses, and bulk transport and stor-
age, bugs are unavoidable in malt. Prevention is better than treatment; thus
brewers should inspect every shipment of malt and reject any infested
malt. Malt stored within an acceptable moisture range (4–5%) will be
resistant to infestation, and cool storage will prevent rapid insect breed-
ing. Emptying malt storage silos several times a year helps to prevent
infestations.
What if malt does become infested by insects? Title 21, Part 110.110 of the
Code of Federal Regulations by the US Food and Drug Administration estab-
lishes maximum levels of natural or unavoidable contaminants of food that
do not pose a health risk. Malt is not explicitly described. However, the
“action level” for wheat is 32 or more insect‐damaged kernels per 100 g. For
wheat flour, the action level is 75 or more insect fragments per 50 g. This does
not mean that the brewer should try to stay just under this level, but rather
these are the limits for which the FDA considers the food unadulterated.
Quality programs should be in place to ensure that insect damage in malt is
kept to a minimum.
MILLING 177
5.2 MILLING
Before the starch in grain can be converted to sugar, the grain must be
crushed to expose the starch and release the enzymes. Milling breaches the
waterproof seed coat and breaks the starch into small pieces, expanding the
area of starch–water contact. Finer grinding provides more surface area of
contact between the water and the starch, leading to more complete reaction
of the starch. In most breweries, the bed of milled grain serves as a filtration
medium during wort separation by the lauter process. If the particles are too
small, the spaces between them will be narrow, and filtration will be unac-
ceptably slow. Starch particles soften during mashing and are likely to form
an impermeable paste. The hulls of the seeds help maintain permeability;
damage to the hulls during milling should be avoided. Therefore, milling must
be a balance between accessibility to the endosperm while leaving the hull
intact. Some breweries separate wort by mash filtration. In this case the par-
ticle size can be very small. The hulls are not needed for filtration, but if they
are pulverized, mashing conditions will need to be adjusted to avoid extrac-
tion of off‐flavors.
Grain for brewing is prepared by either roller mills or hammer mills. The
type of mill that is most suitable depends on other details of the brewing pro-
cess, especially the method of wort separation. Most common to small brew-
eries, roller mills crush the grain between two or more cylindrical rollers that
pull the seeds through a narrow gap between them. In mills with multiple
rollers, screens separate the finely milled material; the coarse grits are milled
between another pair of rollers. The width of the gap is adjusted to give the
desired particle size distribution to the milled grain. In a hammer mill, the
grain is struck by rotating bars until the particles are small enough to escape
through a screen. The resulting particles resemble flour. Mills used in the lab-
oratory for testing are quite different from those used in production.
Roller Mill
The objective of roller milling is to break and expose the starchy endosperm
of the seeds without excessive damage to the seed hull. Very fine grinding
is undesirable because small particles provide more resistance to flow than
larger particles. If wort separation is to be carried out by the lauter pro-
cess, the wort will need to flow through a bed of grist. If the grist is too fine,
flow will be impeded, causing processing problems. Excessive damage to
the seed hulls should be avoided for two reasons. The hulls act as a pro-
cessing aid during wort separation, helping to maintain grain bed porosity
during lautering. Second, hulls contain phenolic compounds called tannins
that, if extracted into the wort, give undesired astringency to the beer.
Small hull fragments have more surface exposed, so they are more susceptible
to the extraction of phenolic compounds than larger pieces.
Dry Mill The starchy endosperm of grain is generally thick and brittle.
When it passes through the mill, it shatters into small pieces. The hull is thin
and somewhat flexible, so most hulls will emerge relatively intact. In some
milling systems, the grain is “conditioned,” by slight dampening with
mist or steam to make the hull more flexible and less susceptible to
damage. Dampening can provide higher extract yield and can make the
lauter process faster.
The simplest type of roller mill has two rollers that roll toward one another.
Each roller has grooves that help grip the malt. Damaging the grooves should
be avoided as repairs or replacements are quite expensive. The gap between
the rollers is the critical process variable. The gap is set to yield a compromise
between high mashing efficiency provided by small particles and fast wort
separation provided by large particles and undamaged hulls. A two‐roller mill
provides only one setting.
More control is possible with a four‐ or six‐roller mill, as shown in
Figure 5.9. The multiple‐roller mill has two or three pairs of rollers. The gap is
smaller between each succeeding pair. The output of the rollers goes through
or across sieves, usually in pairs, driven either by vibration or by rotary beat-
ers. Sieves separate the grist into fractions: flour, grits, and hulls. The multiple‐
roller mill provides more control over the particle size distribution of the
grist, less damage to the hull, more efficient extraction in mashing, and the
opportunity to separate the hulls from the starchy portion of the grist. Some
brewers mash only the fine grists and then add the hulls to the lauter tun to
improve flow. This reduces the risk of extracting astringent polyphenols from
the hulls during the mash.
Dry milling is relatively simple and reliable. Maintenance issues with the
mill are minor, and elaborate cleaning and sanitation are not needed. The
grist can be stored in a grist case as needed before mashing, lending flexibility
to the operation. The speed of the mill needs to be only enough to crush the
grain in the time from one mash to the next. Storage of grist for more than
24 hours is not advised, because it promotes lipoxygenase activity in malt.
Lipoxygenases are enzymes that cause oxygen to react with fats, giving rise to
faster staling of beer. The disadvantage of dry milling is that it produces dust
that can degrade the air quality of the brewery and can introduce microbial
contamination. The dust is also a potential explosion hazard should any spark
be generated.
Wet Mill Another type of roller mill is the wet mill. There are two major
variations of wet milling. In steep conditioning, the grain is steeped in warm
water in a vessel above the rollers, sometimes more than once. The steep
MILLING 179
feed roller
break rollers
hull rollers
grits rollers
flour fine grits flour hulls
Figure 5.9 Six‐roller mill.
water is usually discarded. After milling, water is run through the steep tank
and mill and into the mash tun. This method is seldom used today because of
several issues. Some extract is lost with the steep water. Also, discarded steep
water adds to the waste stream.
In spray‐steep conditioning, the grain in the hopper is dry. The dry grain
is metered into a conditioning compartment where it is sprayed with hot
water. Excess water is removed and recirculated. The wet grain is metered
onto the rollers and crushed. The water spray is adjusted to bring the mois-
ture content of the hull to about 20–30%; the endosperm stays dry enough
to fracture under pressure. The endosperm slides out of the relatively
undamaged hull. Mashing actually starts at the mill, so the temperature of
the steep water is set to give the correct mash‐in temperature. Wet mills
usually have two rollers. They do not use sieves, because it is not practical to
sieve wet grist. For all wet mills, the grist must be mashed immediately after
milling to avoid the growth of microbes. The mill must produce the required
amount of grist quickly, because milling slowly, and accumulating wet grist,
encourages the growth of microbes. Wet milling can give good hull integrity
and high mashing and lautering efficiency. Milling dust is eliminated.
Because the grist is wet, a high level of sanitation is needed. Wet mills
generally require more maintenance than dry mills.
Hammer Mill
A hammer mill reduces grain to a very fine grist by subjecting it to repeated
blows by metal bars called hammers. The grinding chamber is a cylinder.
A shaft rotates in the center carrying the hammers. The hammers swing freely
on hinge pins. Grist that is sufficiently reduced escapes through a screen.
Figure 5.10 shows the operation of a hammer mill.
The use of a hammer mill in brewing is associated with a specific form of
wort separation, mash filtration. The mash filter drives wort through a filter
cloth under pressure, which overcomes the flow resistance of the fine grist.
Nonetheless, if a high percentage of the grist is fine flour, the filter can become
blocked. Some advantages of the hammer mill/mash filter combination are
that the finer grist gives rise to as much as 8.5% higher extraction efficiency,
30% lower wort separation time, lower water consumption, and less water
left in the draff (spent grain). The disadvantages are higher equipment costs
and the presence of finely divided hulls during mashing. Special sparging pro-
cedures are used to minimize pickup of off‐flavors from polyphenols leached
feed hopper
hammer
screen
flour
Figure 5.10 Hammer mill.

MILLING 181
from the hulls. To lower the solubility of the polyphenols, the sparge water
may be acidified, less sparge water may be used, and the sparge water
temperature may be kept low.
MILLING SAFETY
A mill is a powerful, destructive mechanism. Every mill should be

installed with an effective lockout device backed up by a lockout pro-
gram that all workers understand and follow. The lockout device is an
arrangement that allows a worker performing maintenance or repair on
the mill to prevent anyone from mistakenly operating the mill before
the worker is out of the potentially dangerous area. At a minimum, the
lockout device should physically prevent the application of power with
a locking device to which the worker has the key. Most lockout systems
provide for multiple locks so that the device is secured until the last
worker unlocks it. The lockout program is a system of procedures and
worker training to make the lockout devices effective. The absence of a
lockout program, or of an improperly trained worker bypassing it, can
cause gruesome accidents.
A mill should contain a powerful magnet to pick up any bits of iron
or steel in the grain before they can reach the rollers. Stray metal may
damage the mill itself and, worse, can cause a spark. Malt dust is
highly combustible; sparks must be suppressed by electrical ground-
ing. The bearings of rotating parts, including the rollers and the
sieve shakers, should be regularly maintained and monitored for
overheating.
Mills should be located in a room separate from the brewhouse. This
permits effective cleanup of dust after milling and prevents exposure of
the brewhouse to airborne bacteria, as malt carries a variety of poten-
tial beer‐spoiling bacteria. Ventilation of the mill should include a pro-
vision for trapping dust and preventing it from mixing with the air in the
brewery. Grain dust is a serious inhalation hazard. A program of worker
protection including engineering controls (like air filtration) as well as
personal protective equipment (PPE) and worker training must be in
place. Proper PPE includes respiratory masks that prevent dust inhala-
tion. The recommended limit (National Institute of Occupational Safety
and Health [NIOSH] and American Conference of Government
Industrial Hygienists [ACGIH]) for grain dust is 4 mg/m3. Grain dust is
associated with lung problems like asthma and chronic bronchitis and
lesser issues like eye and sinus irritation.
Laboratory Mills Unmalted barley is milled in the laboratory with a knife

mill. The American Society of Brewing Chemists (ASBC) recommends a
Wiley intermediate model mill. A set of movable knives passes between
stationary knives, chopping the sample to pass through an 18 mesh screen
(1 mm opening).
Mills for malt analysis must produce a highly controllable and reproduci-
ble particle size distribution. The mill recommended by the ASBC and its
European and British counterparts is the Buhler DLFU disk mill. This type
of mill grinds the malt between a pair of abrasive disks. The particle size dis-
tribution is controlled by the spacing of the disks. When the mill is adjusted
for a fine grind, 9–11% by mass is retained on a 30 mesh (0.6 mm) sieve. For a
course grind, 74–76% is retained on a 30 mesh sieve. Analytical laboratory
mills cost well over US$10 000. They are not part of the standard outfit of the
average brewery laboratory.
Analytical and Quality Control Procedures for the Grist

Most production roller mill gaps are adjustable between 0 and 2.5 mm.
Reasons for adjusting the roller gap are variability in malt size, differences in
malt moisture, and the use of small grain adjuncts like rye. The mill gaps may
also widen over time as vibrations and routine use cause slippage of the drive
shaft. For this reason, the space between the roller mill gap is a critical process
variable and should be checked as a critical control point. For six‐roller mills,
the break mill gap is typically 1.3–1.5 mm, the hull mill gap is 0.7–0.9 mm, and
the grits mill gap is 0.30–0.35 mm. With a two‐roller mill, a gap of 1.0–1.1 mm
is recommended. Mill gap spacing can be checked with feeler gauges.
Alternatively, a soft piece of metal, like solder, can be rolled through the gap,
and its resulting thickness measured with a caliper.
Mill gap spacing is a critical control point because slippage can cause inef-
ficiencies in the grist production. Too wide of a setting and uncrushed malt
will pass into the mash, reducing the extract yield. Too narrow of a setting will
provide too much flour and too little husk material, which may create lauter-
ing problems. Decisions to change the spacing will also depend on the condi-
tion of the malt (Table 5.1).
TABLE 5.1 Reasons to Tighten or Loosen the Malt Mill

Causes for Tightening Causes for Loosening
Small or variable malt size Uniform, plump malt
The use of small grain adjuncts The use of plump grain adjuncts
Poorly modified malt Well‐modified, friable malt
High malt moisture Low malt moisture
Uncrushed malt in grist Too fine grist with little husk
Poor brewhouse yield Long lauter times
MILLING 183
Because of the implications of the grist in lauter performance and extract

efficiency, the grist should be regularly monitored as a critical control point.
Large six‐roller mills may have sampling ports at various points in the grist
pathway. These can be sliding drawers or half‐cylinders that catch a sample of
grist as it falls through the mill. The drawer can be slid out and its sample col-
lected for analysis. Two‐roller mills are not often equipped for sampling.
A collection tool may be used to catch the grist as it drops into the mash. One
of the disadvantages of wet milling is that evaluation of the particle size dis-
tribution by conventional means is not practical.
A preliminary evaluation of the grist should always be done by eye,
specifically looking for:
• No intact malt kernels.

• The presence of fine grits with a low amount of flour.
• Split hulls with little to no adherent grits.
A more accurate method of measuring the grist is by particle size distri-

bution. Particle size is measured with a series of sieves. Each sieve has a
cylindrical frame with a standardized wire mesh soldered across the bot-
tom. The frames come in different sizes. The ASBC methods call for 8 in.
(203 mm) diameter sieves. A series of sieves with known openings in
descending size is stacked with the largest openings on top. Usually a pan
goes on the bottom, and a lid goes on top. A set of four sieves and a pan is
shown in Figure 5.11. A weighed sample is introduced to the top sieve.
Sometimes small rubber balls, typically 16 mm (5/8 in.), are added to the
smaller sieves to help drive particles through. The stack of sieves is shaken
for a set time in a standardized way, often with a mechanized shaker,
although satisfactory results can be obtained by hand agitation. When the
Figure 5.11 Sieves from above and stacked.

shaking routine is finished, each sieve is weighed. Any material that is

retained on a sieve is deemed to have a larger particle size than the sieve
opening. The mass fraction or mass percent retained by each sieve repre-
sents the particle size distribution.
As shown in Table 5.2, there are at least three systems of sieves used in
brewing. American brewers usually use the ASTM International system
(formerly called the American Society for Testing and Materials).
European brewers usually follow European Brewing Convention (EBC)
procedures, which use the Pfungstadt series of sieves. Some laboratories
use the Mitteleuropäische Brautechnische Analysenkommission
(MEBAK) system (Central European commission for brewing analysis).
The sieves relevant for brewing grist and the names of the fractions are
given in Table 5.2. The sieves of different systems associated with a par-
ticular fraction do not always correspond closely in size. Some users also
reduce the number of sieves used in the ASTM method to 10, 30, 60, 100,
and the pan.
Table 5.3 describes typical particle size distribution percentages for the
ASTM and Pfungstadt sieves. These numbers may vary based on several vari-
ables including grain bill, mill gap spacing, and malt condition, but each grist
should be measured and recorded to enable standard acceptable ranges for
TABLE 5.2 Sieve Systems Used in the Brewing Industry

ASTM Size Pfungstadt Size MEBAK Size Fraction Retained
10 2.0 mm Husk
14 1.4 1 1.270 mm I 1.25 mm Husk
18 1.0 2 1.010 II 1.00 Coarse grits
30 0.6 3 0.547 III 0.50 Fine grits 1
60 0.25 4 0.253 IV 0.25 Fine grits 2
100 0.15 5 0.152 V 0.125 Flour
Pan Pan Pan Fine flour (dust)
TABLE 5.3 Typical Particle Size Distribution Percentages for the Grist

ASBC Sieve no. Distribution (%) EBC Sieve no. Distribution (%)
10 13
14 20 1 18
18 32 2 8
30 24 3 35
60 6 4 21
100 2 5 7
Pan 3 Pan 11
CASE STUDY 185
each brew. The pan fraction should be white flour, typically paler than the
fraction retained on the smallest sieve. The pan fraction should not have a
bitter taste or an astringent mouth feel. Problems here suggest excessive
pulverization of the hulls, which could lead to excessive extraction of tannins
and beta‐glucans into the wort.
There is more to grist than particle size distribution. The physical appear-
ance of the fractions can provide clues to milling and grain handling prob-
lems. Samples from the sieves should be spread on white paper and
inspected. Color photographs will be helpful for identifying changes. The
husk fraction should have the appearance of barely damaged husks. A 100 g
sample of the husk fraction should be gently dropped into a 500 mL gradu-
ated cylinder without tapping or compression, just rolling from side to side
to distribute the grist. The mass divided by the apparent volume is the
apparent bulk density (ABD). A low ABD indicates relatively intact hulls.
ABD should be monitored for consistency. Declining ABD over time may
indicate a slipping mill gap that should be corrected to prevent trouble-
some lauters.
1. Write a standard operating procedure for receiving bagged malt on pal-

lets from a truck.
2. Discuss the various types of conveyors in terms of their suitability for
transfer of malt from a dry mill to a grist case on the same floor in another
room.
3. Discuss the advantages and disadvantages of wet milling compared with
dry milling.
4. Give five safety items or procedures for dry mills and milling.
5. Under what circumstances would the use of a hammer mill be
indicated?
6. How will downstream beer production be affected if the mill gap spacing
is too wide?
CASE STUDY
A grist sample was collected from a six‐roller mill whose roller gaps were
1.60, 0.90, and 0.35 mm. After separating the size fractions on a set of
Pfungstadt sieves, the mass (g) of each fraction was weighed. Using the mass
TABLE 5.4 Particle Size Analysis

Mass Percent Targets
Sieve Mass (g) Min (%) Max (%)
1 51.6 15 20
2 7.6 5 10
3 38.3 28 42
4 38.8 18 24
5 21.0 4 8
Pan 14.5 8 15
Total 171.8
of the total sample, the mass percentage will need to be determined.

The brewery has set minimum and maximum percentages that are
acceptable for each sieve. The actual measurements and the target ranges
are given in Table 5.4.
1. Determine the mass percent for each sample. Prepare a bar graph showing
the measured mass percent for each sieve. Mark each bar with the target
range.
2. Compare the measured mass percent with the target range, and note any
deviations outside of the acceptable ranges.
3. What would you do to check or validate these measurements? What is
your anticipated observation?
4. What could have caused these results?
5. How might these results impact brewing operations or beer quality?
BIBLIOGRAPHY
CRC. ISBN 0‐5493‐2547‐1. Chap. 5
Fahy A, Spencer J, Dougherty J. 1999. Wort production. In McCabe JT (editor).
The Practical Brewer, 3rd ed. Master Brewers Association of the Americas. p. 104.
Freeman JA. 1951. Pest infestation control in breweries and maltings. J. Inst. Brew.
50(5):326–337.
Helber J, Barr J, Bird T, Brynildson M, et al. 2003. Malt grist by manual sieve test.
J. Am. Soc. Brew. Chem. 61(4):246–249.
Kunze W. 2014. Technology Brewing and Malting, 5th English ed. VLB. ISBN
978‐3‐921690‐77‐2.
Penn State Department of Entomology. 2001. Insect Advice from Extension.
http://ento.psu.edu/extension/factsheets/pdf/
Wilkinson R. 2001. Brewhouse optimisation Brewers’ Guardian 130(4):34–36.
Chapter 6
MASHING
Fermentable material in beer originates as starch from malt. This distinguishes

beer from other alcoholic beverages that use sugar directly from fruit, honey,
plant sap, and the like. Starch is insoluble and unfermentable; before the
yeast can use it, it must be converted into sugar. In the mashing process, the
grist is mixed with water and held at an optimal temperature for enzymes to
convert insoluble starch to dissolved carbohydrates. The resulting liquid is
called wort. The details of the mashing process, especially the temperature
and pH, have a decisive influence on the character and quality of the wort
and subsequently of the beer.
6.1 STARCH HYDROLYSIS
Before we discuss the conditions that affect mashing, we must understand the
processes we seek to influence. The mashing process hydrolyzes starch to a
mixture of fermentable sugars and unfermentable carbohydrates called
dextrins. Starch consists of long chains of glucose units condensed together
with all glycosidic links in the alpha (α, bent) configuration. Figure 3.8A
shows a type of starch called amylose. The amylose molecule consists of

187
188 MASHING
undreds of glucose units in one long chain with no branches. All glycosidic
h
bonds are alpha(1→4). Barley amylose averages about 650 glucose units.
There are two free ends; one end, called the reducing end, is a glucose with an
anomeric carbon that has a free −OH group. The other end has no free ano-
meric −OH group. Another type of starch, called amylopectin (Figure 3.8B),
contains alpha(1→4) chains with alpha(1→6) branches approximately every
30 glucose units. Barley amylopectin has an average of about 7000 glucose
units per molecule and has hundreds of non‐reducing (non‐anomeric) ends.
Figure 6.1 shows the details of an alpha(1→6) branch in which carbon 1, the
anomeric carbon of one glucose unit, links to carbon 6, the carbon atom that
hangs off the ring, of another glucose unit.
Brewing yeast usually cannot use carbohydrates with more than three
simple sugar units. They are not fermented, and they remain in the finished
beer. The ability of yeast to use trisaccharides (maltotriose) is variable. Even
some disaccharides, such as lactose, are not fermentable. Soluble carbohy-
drates with four or more glucose units are called dextrins. These soluble,
non‐fermentable carbohydrates raise the final gravity of the finished beer
and contribute to the body. Beer with high levels of dextrins might be
described as having a full mouth feel or body; one without might be described
as dry or having a thin body.
During mashing the starch converts to sugar in a reaction with water called
hydrolysis, shown in Figure 6.2. With each hydrolysis reaction, a new reducing
end is created. Starch will hydrolyze very slowly under ordinary conditions.
To bring about the reaction at a reasonable speed, a catalyst is required. In
the mashing process, enzymes from malt, such as amylase and limit dextri-
nase, catalyze the reaction. The process may be supplemented by additional
α(1→6) branch
α(1→4) link
Figure 6.1 Amylopectin structure.

ENZYMES 189
reducing end
reducing end
reducing end
Figure 6.2 Hydrolysis reaction.
sources of enzymes, usually purified from mold, although this practice is con-
trary to the Reinheitsgebot. In brewing sake, a Japanese beer made from rice,
the enzymes come from a mold called koji, which is grown on the rice during
a combined hydrolysis–fermentation step.
6.2 ENZYMES
Enzymes are biological catalysts made from proteins, usually incorporating

other ions and molecules. Enzymes act upon one or more target substrates
to make a product. Enzymes are unique among catalysts in their selectivity
and specificity. Selectivity is the ability of a catalyst to speed up a reaction
yielding a particular product among several possible reactions that could
occur between the reactants. Specificity describes the ability of a catalyst to
differentiate and interact with a particular target among a group of mole-
cules that could undergo a similar reaction. Alpha‐amylase catalyzes the
hydrolysis of starch, but it is inert to similar reactions on lipids, proteins, or
nucleic acids; it displays specificity. The products of alpha‐amylase‐catalyzed
hydrolysis of starch contain a complex mixture of sugars and dextrins;
alpha‐amylase is not selective. Beta‐amylase is also specific for starch, but
the only sugar it makes is maltose, a disaccharide; beta‐amylase is specific
and selective.
Most enzymes are named after their target (maltase hydrolyzes maltose)
or the reaction they catalyze, usually with the suffix “‐ase”. For example, alco-
hol dehydrogenase transfers hydrogen atoms from the −OH group in alcohol
to NAD+, giving a carbonyl group and NADH. As discussed in Section
“Reaction Rate” in Chapter 2, enzymes can work in either direction.
Sometimes this results in enzyme names that seem backward. For example,
190 MASHING
in alcoholic fermentation the hydrogenation of acetaldehyde to give ethanol

is catalyzed by alcohol dehydrogenase.
Enzyme specificity is governed by intermolecular forces between the
enzyme and the substrate, its target. Often in the tertiary structure of an
enzyme, there is a groove or cavity into which the substrate can fit. This
groove or cavity is called the binding site. R‐groups in or near the binding site
stick to groups on the substrate via intermolecular forces (Section 2.5). The
target substrate binds with higher affinity or more intermolecular forces than
nontargets. The bound substrate is then positioned to engage R‐groups on the
enzyme in a location called the active site (Figure 6.5A). This is the precise
location on the enzyme where the reaction occurs. This scenario is historically
described as a “lock and key” model. Often the binding of the reactants leads
to a change in the configuration of the enzyme that exposes the relevant
bonds and brings them into position for reaction at the active site. This type
of change is called an induced fit; it sometimes evokes images of opening and
closing doors or gripping tongs. When the reaction is complete, the product is
released, and the enzyme returns to its original form, ready to receive another
substrate molecule. The enzyme is not consumed in the reaction.
Figure 6.3 illustrates the lock and key model for invertase, an enzyme that
catalyzes the hydrolysis of sucrose (“inversion” because the rotation of plane‐
polarized light is reversed). The substrates are sucrose and water; the products
active site
binding site binding site
fructose invertase
sucrose
substrate
1
3
glucose
bound products 2 bound substrate
H2O
Figure 6.3 Lock and key model.

ENZYMES 191
are glucose and fructose. Invertase is a highly specific enzyme; it cannot

hydrolyze other disaccharides like maltose or lactose. In step 1, sucrose binds
to the enzyme. Only sucrose can fit the binding site of invertase. In step 2, the
bound sucrose reacts with water at the active site, giving bound products. In
step 3, the products, glucose and fructose, are released; the enzyme resets, and
it can then act on another sucrose molecule.
The speed (also called rate or velocity) of an enzyme‐catalyzed reaction is
proportional to the concentration of bound substrate. When there is a high
concentration of substrate, nearly every enzyme molecule is occupied by
substrate; adding more substrate will not increase the concentration of
bound substrate. The rate under these conditions is at a maximum; increas-
ing the substrate concentration will have no effect. When the concentration
of substrate is low, the rate is close to a direct proportion with substrate
concentration. Figure 6.4 models the effect of substrate concentration on
rate over the entire range of substrate concentration. The maximum rate is
marked Vmax.
Barley alpha‐amylase is one of the enzymes that hydrolyzes starch during
mashing. It is a complex protein structure with 403 amino acids, 3 calcium
ions (Ca2+), and 153 water molecules, folded into a specific shape, as shown
in Figure 6.5. The long tube is the backbone of the protein; in this model the
R‐groups and water molecules are omitted.
Some enzymes function as 100% protein, but many require additional
components called cofactors. When a cofactor is required, the enzyme will
function only when both the enzyme and the cofactor are present. Cofactors
may be organic or inorganic, protein, small molecule, or ion. As can be seen
in Figure 6.5, barley alpha‐amylase requires three Ca2+ ions (indicated by
gray spheres) that act as cofactors. Other metal ions including magnesium,
zinc, and iron act as cofactors in other enzymes involved in the brewing
process.
Vmax
Reaction Rate
Substrate Concentration
Figure 6.4 Rate of an enzymatic reaction.

192 MASHING
glu
asp
(A) (B)
Figure 6.5 (A) Barley alpha‐amylase. (B) Barley alpha‐amylase detail showing glu-
tamic acid and aspartate ion in the active site. Source: Drawing based on data from
Kadziola et al. (1994).
ALPHA‐AMYLASE MECHANISM
Alpha‐amylase increases the rate of hydrolysis of starch by as much as

a factor of 10 15, a quadrillion. Although the details of the mechanism
have not been unambiguously demonstrated, the scheme shown in
Figure 6.6 is accepted in broad outline. Figure 6.6A shows two sugar
units of a starch chain with a glycosidic link at the active site. The R’s at
the right and left represent the rest of the starch chain; the E’s at the
top and bottom represent the enzyme molecule. The group at the top
in Figure 6.6 (asp) is part of an aspartic acid R‐group. The group at the
bottom (glu) is part of a glutamic acid. Figure 6.5 shows these groups in
the context of the active site. In Figure 6.6B the glutamic acid donates
its hydrogen ion to the linking oxygen atom, forming an oxonium ion.
The anomeric carbon (red triangle) on the sugar on the left is attached
to two highly electronegative oxygen atoms, one of which now shares a
pair of electrons with a hydrogen ion; this makes the oxygen atom even
more hungry for electrons. These oxygen atoms pull electrons away
from the anomeric carbon, giving it some positive charge so it attracts
the negative charge on the aspartate group at the top. Figure 6.6C
shows the aspartate forming a bond with the anomeric carbon while
the C─O bond to the sugar on the right is breaking. The forming and
breaking bonds are shown as dotted lines. As this happens, the hydro-
gen atom flips from the equatorial direction to the axial direction (red
arrow). When the bond making and breaking are complete, the starch
ENZYMES 193
chain is broken. The part on the right is free and leaves; water (blue)
enters. The part of the starch chain on the left is bound to the enzyme
through the aspartate, as shown in Figure 6.6D. The water donates a
hydrogen ion to the glutamate, leaving a hydroxyl group, shown in
Figure 6.6E. The hydroxyl group attacks the anomeric carbon from
below. Breaking and forming bonds are shown as dotted lines in
Figure 6.6F. The hydrogen returns to the equatorial position (red
arrow). In Figure 6.6G the hydrolysis is complete, the carbohydrate
on the left is now free, and the enzyme has been restored to its
pre‐reaction state.
asp
glu
(A) (B)
(C) (D)
(E) (F) (G)

Figure 6.6 Barley alpha‐amylase mechanism.
194 MASHING
Non‐catalytic reactions typically go faster as the temperature is increased.

By contrast, the rates of enzyme‐catalyzed reactions usually reach a
maximum with temperature, but they slow down if the temperature is

increased further, as shown in Figure 6.7. The reason for the loss of activity
is that at sufficiently high temperature, the integrity of the three‐dimensional
structure of the enzyme begins to break down. The binding sites do not bind
as well, and the R‐groups in the active site lose the geometry they need to
enhance the reaction. The protein becomes denatured. Depending on the
enzyme and other conditions like pH, denaturation can be reversible, in
which case activity is recovered when the temperature is lowered. More
often, especially during the brewing process, denaturation is irreversible. At
sufficiently high temperature, all enzymes experience irreversible denatura-
tion. They unfold. Some organisms are adapted to extreme conditions like
high temperature. Their enzymes are heat tolerant. The effects of tempera-
ture on two different enzymes are demonstrated in Figure 6.7. Heat‐tolerant
enzymes can be useful in certain biotechnological applications, like polymer-
ase chain reaction (PCR).
Protein structure and enzyme activity are also affected by pH. Like opti-
mal temperatures, enzymes have an optimal pH at which their activity is high-
est, decreasing at higher or lower pH values. Because pH affects the electrical
charge on acid and base groups, interactions between different parts of the
protein molecule and between the protein and the substrate are influenced
by the surrounding pH. Figure 6.8 demonstrates the effects of pH on protein‐
hydrolyzing enzymes (proteases) isolated from two different organisms. The
Aspergillus niger protease may be added during fermentation to remove
haze‐forming proteins. For this application, an enzyme with sufficient activity
at pH 4.5, the pH of beer, should be used.
Enzyme conversion rates may decrease with time; the decrease is faster at
higher temperature. We think of the net enzyme activity as the total amount
100
activity (% of max)
80
human heat-tolerant
60 enzymes enzymes
40
20
0
0 15 30 45 60 75 90
temperature (°C)
Figure 6.7 Effect of temperature on enzyme activity.

ENZYMES 195
100 A. niger
80
60
activity (%)
F. meningosepticum
40
20
2 3 4 5 6 7 8 9 10
pH
Figure 6.8 Effect of pH on proteases from two organisms. Source: After Edens et al.
(2005).
100
80
activity (% of max)
60
α-amylase 65 °C
40
α-amylase 80 °C
20
β-amylase 65 °C
β-amylase 80 °C
0
0 10 20 30 40 50 60
time (min)
Figure 6.9 Alpha‐ and beta‐amylase activity: time and temperature.
converted during the reaction. Figure 6.9 shows the activity as a percentage of

the maximum during one hour at the specified temperature for the two main
amylose enzymes. The mash temperature is rarely decreased; mash tempera-
tures are only increased because activity that the enzyme had at the lower
temperature is lost at a higher temperature. Lowering the temperature does
not bring the activity back.
196 MASHING
6.3 MASHING PROCESS
Mashing may be the most complex of the brewing processes. Some of the criti-
cal process variables that affect the mashing outcome are the composition of
the grist, the hardness and alkalinity of the water, and the time/temperature
treatment. The soluble products of mashing that are significant for brewing
include fermentable and unfermentable sugars, dextrins, beta‐glucan, proteins,
other soluble nitrogen‐containing compounds, lipids, polyphenols, and flavor
and color compounds.
Mashing is essentially a continuation of the malting process. During malt-
ing, germination induces production of enzymes in the seed. The endosperm
cell walls are degraded, but the process is halted before extensive hydrolysis
of the starchy endosperm. Removal of water during kilning suspends enzyme
activity. Rehydrating the malt in the mash reactivates some of these enzymes.
The brewer uses these enzymes as tools to determine the sugar and protein
profiles of the wort by varying the mashing parameters. Important enzymatic
activities in the mash include:
• Starch degradation into fermentable sugars and dextrins.

• Protein proteolysis into peptides and amino acids; mostly accomplished
during malting.
• Beta‐glucan degradation; mostly accomplished during malting.
• Oxidation of fatty acids.
Starch Degradation
The primary function of mashing is the conversion of unfermentable starch
into fermentable sugars such as glucose, maltose, and maltotriose. Larger car-
bohydrates, especially those with an alpha(1→6) glycosidic linkage, will not
be fermented by the yeast; they will be retained in finished beer as dextrins.
Starch degradation during the mash occurs in three stages: gelatinization, liq-
uefaction, and saccharification.
Gelatinization Gelatinization is the process through which crystalline

starch granules take up hot water. Starch occurs in grain seeds tightly packed
in granules; the starch chains are bound to one another by hydrogen bonding.
During gelatinization, water molecules go between the starch molecules,
replacing the starch–starch hydrogen bonding with starch–water hydrogen
bonding. Hydration of starch causes the granules to swell and eventually to
burst. During gelatinization, the viscosity of the mash increases because long
starch molecules are released, and they restrict the motion of water. During
liquefaction and saccharification the viscosity of the mash decreases, because
MASHING PROCESS 197
Viscosity
gelatinization liquefaction saccharification

Time
Figure 6.10 Change in viscosity over time during starch degradation in the mash.
TABLE 6.1 Gelatinization Temperatures of Cereal

Grains Used in Brewing
Source Gelatinization temperature
Barley 59–65 °C (138–149 °F)
Maize (corn) 70–80 °C (158–176 °F)
Oats 55–60 °C (131–140 °F)
Rice 70–80 °C (158–176 °F)
Rye 60–65 °C (140–149 °F)
Sorghum 70–80 °C (158–176 °F)
Wheat 52–54 °C (126–130 °F)
the long molecules are broken into smaller pieces. Figure 6.10 demonstrates
the change in viscosity over time during the mash.
Barley has a gelatinization temperature around 59–65 °C (138–149 °F).
Starchy adjuncts, such as rice and maize (corn), require higher temperatures
for gelatinization, around 70–80 °C (158–176 °F). A comparison of grains used
in brewing and their gelatinization temperatures is displayed in Table 6.1. As
shown in Figure 6.9, barley enzymes are quickly destroyed at the elevated tem-
peratures needed for gelatinization of adjuncts like corn and rice, so these
adjuncts must be cooked in a separate vessel before they are added to the mash.
Special considerations for the use of adjuncts will be discussed in Section 6.5.
Liquefaction Liquefaction primarily refers to the reduction of viscosity

in the mash as the result of alpha‐amylase activity and the hydrolysis of
starch into smaller chains. The two main mashing enzymes are alpha‐
amylase (α‐amylase) and beta‐amylase (β‐amylase). These two enzymes
work by related, but not identical, mechanisms. As discussed in Section 6.2,
the big differences are in their selectivity and their stability in solution.
198 MASHING
Alpha‐amylase can hydrolyze a starch chain at any alpha(1→4) glycosidic link

except near an alpha(1→6) branch or at the end of the chain. Beta‐amylase
operates only at the second link from the non‐reducing end, so it removes two
glucose units at a time, yielding maltose. Importantly, beta‐amylase can only
cleave bonds from the non‐reducing end. The non‐reducing end is the end of
the starch chain without an −OH group on an anomeric carbon. If beta‐
amylase, but not alpha‐amylase, were present in the mash, it would take a very
long time to produce fermentable sugar because hydrolysis would be limited
by the availability of non‐reducing ends. Alpha‐amylase activity is needed to
create more non‐reducing ends upon which beta‐amylase can act.
Saccharification Saccharification refers to the complete hydrolysis of

starch into fermentable sugars: glucose, maltose, and maltotriose. The
combined activity of alpha‐ and beta‐amylase is required to fully hydrolyze
all starch. In this system, alpha‐amylase will cleave starch molecules at
alpha(1→4) bonds once every 7–12 glucose units. This creates a new non‐
reducing end upon which beta‐amylase can function. Due to the different
lengths of the chains created by alpha‐amylase cleavage, a different ratio of
glucose, maltose, maltotriose, and dextrins may be produced. A typical wort
sugar profile is shown in Table 6.2.
Variation in the mashing parameters (i.e. time, temperature, pH, liquor‐to‐
grist ratio) can alter the activities of the amylase enzymes, influencing the
wort carbohydrate profile.
Mash Temperature
Figure 6.11 models the effect of mashing temperature on the total wort solids,
on the fermentable wort solids, and on the percentage of wort solids that are
fermentable. This is a general trend whose details depend on the type of malt,
the mashing time, the mash temperature profile, the capabilities of the yeast
strain, and even the strain of barley from which the malt was made. Total
TABLE 6.2 Typical Carbohydrate

Profile of a Standard Wort
Sugar Percent
Maltose 50–60
Glucose 10–15
Maltotriose 10–15
Maltotetraose 2–10
Sucrose 1–5
Fructose 1–5
Dextrin 25
MASHING PROCESS 199
total solids 100

11
fermentability
10 90
fermentability (%)
9
wort solids (ºP)
fermentable solids 80
8
70
7
6 60
5
50
50 55 60 65 70
temperature (°C)
Figure 6.11 Extract and fermentability.
solids content increases with temperature by over 30% from 50 to 60 °C but
only by another 5% from 60 to 70 °C. Fermentable sugar goes through a
broad maximum from 52 to 68 °C and falls off at higher and lower tempera-
tures. The fermentability is maximum at about 55 °C and falls off at a higher
temperature, mostly because fermentable solid production is flat but total
solids increases. In the range from 60 to 68 °C, increasing mashing tempera-
ture increases solids (extract) and decreases fermentability. Brewers can vary
the mashing temperature to modify the character of the beer without much
effect on the ethanol content (alcohol by volume [ABV]), which is governed
by the amount of fermentable solids.
Mash pH
Enzymatic reactions, including mashing reactions, are generally affected by
pH (introduced in Section 4.1). The generally recommended range for mash
pH is 5.2–5.6, which falls between the optimal enzymatic pH for alpha‐ and
beta‐amylase. The mash pH should be monitored and recorded for every brew
at mash‐in. Higher pH tends to yield higher fermentability; lower pH favors
higher extract (original gravity).
Studies of the details of the effect of pH on mashing outcomes are sparse
and inconsistent. One reason for this is that it is not possible to adjust pH with-
out introducing ions other than H3O+ and OH−. Another technical issue is that
the pH of the same material at mashing temperature is lower than that at room
temperature where most measurements are made. For example, the pH of pure
water at 25 °C is very close to 7, but at 70 °C it is 6.4. Many reports are vague
about the conditions under which the pH was measured. Measuring pH at tem-
peratures far from the laboratory temperature is difficult and prone to error.
200 MASHING
The key variables determining mash pH are the alkalinity and hardness of
the liquor and the acidity of the malt. Alkalinity in brewing liquor is provided
by bicarbonate ion (HCO3−). Bicarbonate ion raises the pH by removing
hydronium ion: HCO3− + H3O+ → CO2 + 2H2O. High alkalinity in the liquor
can lead to high mashing pH.
Water alkalinity can be adjusted or compensated to adjust the mash pH.
The simplest brute‐force approach is adding acid directly to the mash. Acids
provide hydronium ion to replace that taken up by the bicarbonate.
Hydrochloric, lactic, phosphoric, and sulfuric acids are most commonly used.
It is essential that only food‐grade quality acid is employed. The complication
with acid additions is that every acid also provides a counterion. Hydrochloric
acid adds chloride (Cl−); lactic acid adds lactate (C3H5O3−); phosphoric acid
adds hydrogen phosphate (HPO42−); and sulfuric acid adds sulfate (SO42−).
Each may affect the character of the beer. WARNING: some of these acids
are potentially corrosive and they can release heat on addition to water.
Malt provides acidity and buffering to the mash. Dark malt is more acidic
than pale malt because the higher intensity kilning used to make dark malt
removes amines by the Maillard reaction. Because amines are basic, their
removal increases acidity. Mash acidity is also derived from the dissociation
of barley malt phosphates: H3PO4 ➔ H+ + H2PO4−.
The water alkalinity can be lowered by reverse osmosis, ion exchange, or
one of the other methods discussed in Chapter 4. Water hardness (calcium and
magnesium ions) can, to some extent, neutralize alkalinity. Calcium ion and, to
a lesser degree, magnesium ion react with phosphate in the malt to release
hydronium ion: 3Ca2+ + 2HPO42− + 2H2O → 2H3O+ + Ca3(PO4)2. Recent
research suggests that this effect is not as great as had previously been thought.
Lowering of the mash pH can be accomplished by:
• Adding calcium in the form of gypsum or calcium chloride.

• Adding dark or caramel malts.
• Adding a small amount of acidulated malt.
• Sour mashing via bacteria addition.
• Adding food‐grade acids.
6.4 MASH CONVERSION VESSEL DESIGN AND OPERATION
The mash vessel is the point at which barley malt is turned into brewer’s wort.
There are a variety of subtle design differences between different mashing ves-
sels, but all operate with similar objectives, to obtain extract from the malt and
to control the mash at specific temperatures that influence enzymatic activity.
The types of enzymes involved and the impact on beer will be discussed.
MASH CONVERSION VESSEL DESIGN AND OPERATION 201
Mashing In
Mashing begins with the addition of hot water, called hot liquor, to the grist,
a process called mashing in. The water is usually prepared in advance in a ves-
sel called a hot liquor tank (HLT). The optimal size of the HLT depends on
the mash volume, the time between brews, and the use to which the hot water
will be put. Hot liquor is required for foundation water, mashing, and sparg-
ing. The HLT may also serve as the source of water for rinsing and cleaning.
If multiple batches are brewed on the same day, the water needs to be ready
when the mash tun is clean from the previous batch. A general rule is for the
HLT to have a capacity three times that of the mash volume. Small HLTs run
the risk of insufficient amounts of hot liquor during production.
The grist from the mill is usually kept in a grist case until it is dispensed. The
initial temperature of the liquor before addition to the grist is called the strike
temperature. The temperature after mixing the liquor and grist is the mash‐in
temperature; it is always lower than the strike temperature, because the grist
absorbs heat. Calculations for determining the strike temperature are
discussed in the “MASH‐IN AND DECOCTION TEMPERATURE” box.
Dry spots, clumping, and uneven temperatures should be avoided while
mashing in. In small mashing vessels, the vessel is often filled with hot liquor
at strike temperature, and the grist added through the top while mixing. Dry
grain should always be added to water, because it can be difficult to mix if
water is poured on top of the grist. There are several disadvantages to adding
dry grist directly to hot water in the mash vessel. First, this method creates
dust. Not only is this a safety hazard and a contamination threat, but it can
lead to small losses in extract. Second, to reach the appropriate mash tem-
perature, the water must be hotter than the mash target. The first grist to be
added to the hot water experiences elevated temperatures that may deacti-
vate malt enzymes, negatively influencing mash parameters. Finally, directly
adding dry grist during mash can lead to dry clumps, called dough balls, that
do not hydrate well.
Some systems place a grist case directly above the mashing vessel to con-
tain dust during mash‐in. Ideally, the grist case should be large enough to hold
the entire malt bill for the brew, so that it can be added in a controlled and
consistent manner. The grist case is connected to the mash vessel by a short
pipe and is controlled by a slide valve, thus containing the dust. Figure 6.12
shows two grist cases. The smaller one on the left feeds the adjunct cooker;
the larger one on the right feeds the mash conversion vessel.
It is best to mix the grist and brewing liquor while maintaining the same
liquor‐to‐grist ratio the whole time. With proper control of the strike water
temperature, the resulting mash‐in temperature is held for the entire addition
process. This can be accomplished with a premasher, also called a foremasher.
These devices are typically installed in a pipe above the mash vessel, injecting
water at mash‐in temperature as the grist falls into the mash vessel, as shown
202 MASHING
Figure 6.12 Grist cases at Yuengling Beer Company, Pottstown, PA.
grist case
slide valve
premasher
brewing
liquor
mash tun
Figure 6.13 Premasher.
in Figure 6.13. To prevent clumping, the premasher may include mechanical

mixing, or it may be designed with water jets that produce strong mixing. The
Steel’s masher, used for traditional British ale, has a horizontal screw auger
followed by tines or rakes that mix the grist into the brewing liquor.
Prior to mash‐in, a small amount of foundation water, at the appropriate

strike temperature, should be added to the mash vessel. The volume of foun-
dation water should at least be enough to cover 25–50 mm (1–2 in.) above
the plate or mixer. Foundation water assists the spreading of the initial grist
and is essential if using a false bottom for a combined mash/lauter tun to
prevent clogs.
Liquor‐to‐Grist Ratio The amount of water per unit of grist is the liquor‐
to‐grist ratio, sometimes called the mash thickness (a misnomer, high liquor‐
to‐grist is thin mash). Liquor‐to‐grist ratios can run as low as 1.6 L/kg (0.2 US
gal/lb) for a very thick infusion that is difficult to mix. Or they can run as high
as 5 L/kg (0.63 gal/lb), giving a thin slurry that is easy to pump. Mashing
performance is significantly affected by mash thickness. A low liquor‐to‐grist
ratio mash retains beta‐amylase activity, resulting in higher wort fermentability.
The Iodine Check The effectiveness of the mashing program in hydrolyzing

starch can be quickly validated by an iodine test. Iodine is a light amber color,
turning dark purple in the presence of starch. To run the test, a few mL of
mash is placed on a white porcelain dish, and then a few drops of a solution
that is about 0.25% in iodine and 0.5% in potassium iodide are added. If the
solution turns purple, starch is still present. If the sample stays light brown,
there is no starch. A negative test does not mean all hydrolysis reactions are
completed. Iodine only interacts with long starch molecules, inserting itself
into the helical shape. Large dextrins and long polysaccharides will not test
positive, so this test is really only useful for monitoring early liquefaction. In
general, an all‐malt mash will produce a negative iodine test in 10 minutes or
less. Monitoring the time at which the test becomes negative can be a useful
method to monitor mash quality.
Mash Vessel Design

Once the grist has been added to the hot liquor in the mash vessel, it must be
gently mixed. In small systems, and in days of yore, the mash was stirred with
handheld oars. In moderate to large vessels, an agitator is built into the base
of the unit as shown in Figure 6.14. The agitator should be set away from the
walls and floor of the vessel to avoid crushing the hulls. Rotation speed will
vary depending on vessel size, but the agitator should not exceed a linear
speed of 2 m/s. Vigorous mixing applies shear forces that can damage the malt
hulls, leading to polyphenol extraction and astringent beer. Slow but consist-
ent mixing is essential to promote even temperatures, controlled enzymatic
activity, and good beer quality.
The strike temperature of the hot liquor is chosen so that, after mixing,
the mash reaches a target temperature. Afterward, it may be necessary to
204 MASHING
grist
case
liquor vent
manway
mash
pipe
steam
empty
stir
Figure 6.14 Mash conversion vessel.
maintain or to increase the temperature of the mash. Most modern mash

vessels are equipped with a steam jacket. Direct fire heating may also

be employed. In direct fire vessels, an agitator must operate continually to
prevent scorching and burning of grain on the floor of the vessel.
Larger breweries use a separate lauter tun (discussed in Chapter 7) for
wort separation, but smaller operations may use a combined mash and lauter
tun. In this design, a false bottom keeps the malt hulls off the floor of the ves-
sel and will permit lautering. If using a separate lauter tun, the entire mash is
pumped into the lauter tun when mashing is complete.
Mashing Steps and Parameters

The critical process variables during mashing that determine wort quality are
time, temperature, pH, and mash thickness. Regarding time and temperature,
the mash will be held at a temperature for a specified period called a step or
rest. Depending on the mashing regime, several rests may be performed.
Table 6.3 provides a summary of typical mash steps and their effects.
The number of steps and the specific time and temperature of each step
will depend upon the desired character of the wort. Most steps only require
15–20 minutes and need not exceed 30 minutes. A single step mash should
persist for at least 60 minutes.
The lowest temperature step, the acid rest, was historically used to help
lower the pH of the mash by promoting the activity of phytase, an enzyme
that frees phosphoric acid from phytic acid (Figure 6.15). Phytase is most
active between 35 and 52 °C and at a pH of 3–5. The resulting phosphates are
necessary building blocks of DNA, RNA, and ATP, and phosphates can
lower the pH of the mash to 4.8–5.2. Practical experience and well‐modified
malt used today indicate that mash pH is quickly and strongly buffered
TABLE 6.3 Effects of Temperature During Mash Rests

Temperature Step (effect)
35–40 °C (95–104 °F) Acid rest (ferulic acid release from hemicellulose;
phosphate release via phytase)
45–50 °C (113–122 °F) Protease rest (hydrolyzes proteins, increases FAN;
decreases foam stability)
45–55 °C (113–131 °F) β‐Glucanase rest (hydrolyzes glucans; decreases
viscosity)
60–65 °C (140–149 °F) Maltose production rest (optimal β‐amylase temp.)
66–70 °C (150–158 °F) Saccharification rest (promotes α‐amylase activity)
76–78 °C (168–172 °F) Mash‐out (decreases viscosity, deactivates enzymes)
Figure 6.15 Phytic acid.
f ollowing mash‐in. The buffering capability of the mash eliminates the need
for the acid step in most brews. One exception is German wheat beers, where
the rest is not to lower the pH, but to release ferulic acid. Free ferulic acid is
important in wheat beers, because it is decarboxylated to 4‐vinylguaiacol dur-
ing fermentation (by POF+ yeast), which contributes to the characteristic
phenolic flavor of the style.
Proteolytic enzymes are mostly deactivated during malting, but some
brewers try to take advantage of any residual activity by including a protease
or protein rest in their mash schedules. Protease hydrolyzes proteins from
barley into smaller fragments, peptides, and amino acids. The protein rest can
be used to increase FAN in the wort. A protein rest may be necessary to help
206 MASHING
TABLE 6.4 Optimal Temperature and pH Ranges of Mash Enzymes

Enzyme Optimal temperature Optimal pH
β‐Glucanases 40–60 °C (104–140 °F) 4.5–4.8
Proteases 45–50 °C (113–122 °F) 3.9–7.2
Lipoxygenase 45–55 °C (95–104 °F) 6.5–7.0
Phosphatase 50–53 °C (95–104 °F) 5.0
Limit dextrinase 55–65 °C (95–104 °F) 5.1
β‐Amylase 60–65 °C (140–149 °F) 5.4–5.5
α‐Amylase 70–74 °C (158–165 °F) 5.6–5.8
generate sufficient FAN when using adjuncts, but in all‐malt beers, it is unnec-
essary and potentially detrimental to beer foam. If the protein rest is on the
low end (45–50 °C), it may promote both protease and β‐glucanase activity,
while the higher end (50–55 °C) supports mostly β‐glucanase.
The effects of each mash step on beer quality are ultimately guided by the
optimal temperature at which the relevant enzymes are active. For this r eason,
a separate step for β‐amylase (optimal at 60–65 °C) and α‐amylase (optimal at
70–74 °C) is typically employed. Enzyme activity is also influenced by the mash
pH. A summary of general temperature and pH ranges for broad enzyme
groups in the mash is described in Table 6.4.
The optimal temperature and pH ranges for α‐ and β‐amylase do not pre-
cisely align. Many mash regimes employ both a maltose rest in the 60–65 °C
range followed by a saccharification rest in the 66–70 °C range. As shown in
Figure 6.9, β‐amylase activity is quickly lost at temperatures above 66 °C, so
sequential steps can maximize fermentability of the wort. Nonetheless, high
fermentability is not always the objective; some styles benefit from enhanced
final gravity. For mash tuns that lack heating capability, this can be a virtue
born of necessity. As the final step, most mashing programs involve a mash‐out
step above 72 °C to deactivate all enzymes, stabilize the wort, and decrease
viscosity to accelerate lautering.
Mash Heating Programs

Because most enzymes irreversibly lose activity at temperatures that exceed
their optimum range, but not at temperatures that are too low, mashing pro-
grams always increase rather than decrease the temperature. There are four
general temperature programs often used for mashing. Infusion mashing makes
no effort to change the mash temperature after mash‐in. The target temperature
is typically 65–67 °C (148–152 °F), which is within the narrow window of optimal
activity for both alpha‐ and beta‐amylase. Without temperature control, the
temperature may slowly cool from the mash‐in temperature as heat is lost to the
surroundings. Infusion mashing is most suitable for well‐modified malt.
In decoction mashing, a portion of the mash (typically one‐third) is heated

to boiling and returned to the mash tun to raise the temperature to the next
step. Usually the mash is allowed to settle, and a portion from the denser
phase is boiled. This avoids excessive loss of dissolved enzymes. The decoction
method, popular for German‐style brewing, dates from before thermometers;
the mash boiling point established a dependable temperature. Decoction is
suitable for malt that is not fully modified, because boiling helps gelatinize
recalcitrant starch granules.
A variation of decoction is double mashing, suitable when high temperature
gelatinizing adjuncts are used. The malt is mashed in at a low temperature. The
adjunct, like rice or maize grits, is heated in another vessel. Usually some malt
is included with the adjunct to help liquefy it and lower its viscosity. The adjunct
mash is boiled to gelatinize the adjunct. The entire contents of the adjunct mash
are then added to the malt mash, bringing it to the next temperature step. The
most modern mashing programs involve continuous control of the temperature
to take advantage of the properties of the enzymes in the mash.
MASH‐IN AND DECOCTION TEMPERATURE
Strike Temperature
Our objective is to calculate the strike temperature, which is the water
temperature needed to reach the desired mash‐in temperature, account-
ing for the heat needed to heat the malt and the tank and the heat
released by hydration of the malt. To set up the mash‐in problem, we
first write the energy conservation equation
Qwater Qgrist Qtank Qreaction 0
Qreaction, called the “slaking heat,” is energy released by chemical inter-

action of the dry grain with water. Because heat goes out of the reaction,
this term is negative. For malt with 4% moisture, Qreaction is −40 000 J/kg.
For the first 3 Q’s, Q = mass × specific heat × (Tinit – T), where T is the
final mash‐in temperature. We are looking for Tinit of the water. The spe-
cific heat of water is 4184 J kg−1 °C−1, and that of grist is 0.4 times that
of water. The relevant equation derived from some algebra is
strike T 0.4 MmaltT 0.4 MmaltTmalt CtankT CtankTtank 40 000 Mmalt

T
4184 Mwater 4184 Mwater 4184 Mwater 4184 Mwater 4184 Mwater
where T is the desired mash‐in temperature. Tstrike is the initial tempera-

ture of the water or the target strike temperature. The T’s with subscripts
(continued)
are the initial temperatures of the malt and tank. The M’s are masses in
kg. Ctank is the heat capacity of the tank. The heat capacity of the tank is
not often supplied by the manufacturer. Fortunately, the error intro-
duced by ignoring it is not large. Even more fortunately, Ctank can be
measured, as explained below. The calculation assumes that the supplies
are at the indicated temperatures when they reach the mash tank.
Suppose we want to mash 3333 kg of grain with 10 000 kg of water.
The desired mash‐in temperature is 68.0 °C. The initial temperature
of the tank and the malt is 22 °C. The heat capacity of the tank is
290 000 J/°C:
0.4 3333 kg 68.0 C 0.4 3333 kg 22.0 C
Tstrike 68.0 C
10 000 kg 10 000 kg
290 000 68.0 C 290 000 22.0 C 40 000 3333
4184 10 000 kg 4184 10 000 kg 4184 10 000 kg
71.2 C
This calculation is best managed in a computer spreadsheet.
Decoction Temperature
In a decoction, a portion of the wort is removed, boiled, and returned to
the mash. The mash temperature after the boiling wort is added to the
cool wort is given by the equation
Thot Mhot Tcold Mcold
T
Mhot Mcold
Suppose 3333 kg of boiling wort at 100.2 °C is added to 6667 kg of

wort at 35 °C. Plugging these numbers into the equation gives
100.2 C 3333 kg 35 C 6667 kg

T
10 000 kg
48.0 C
Measuring the Heat Capacity of a Tank

Meter water into the tank until the temperature sensor is covered.
Record the amount of water. Cover the tank, and allow the tank and the
water to equilibrate for an hour or so, with gentle stirring if available.
Record the initial temperature (Tcold). Then meter in hot water at a
known temperature (Thot). Record the amount of hot water added and
its temperature. Stir well and record the temperature (T). The heat
capacity of the tank is calculated from the following equation:
M hot T Thot Mcold T Tcold

Ctank 4184
Tcold T
THE USE OF ADJUNCTS 209
6.5 THE USE OF ADJUNCTS
An adjunct is a source of fermentable material that is not malted grain.

Adjuncts can provide starch that must undergo mashing, or they can supply
sugar that can be added directly to the kettle or even to the fermenter (if
sterile). Adjuncts are used as supplements to malted grain, seldom providing
more than 30–40% of the fermentable sugar unless additional enzymes are
added. Their major functions are to provide a crisp, light flavor and to enable
high‐gravity brewing. Some adjuncts increase fermentability to make beers
with low final extract, like light beer and malt liquor. Adjuncts are also less
expensive than malted grain, but the cost is somewhat offset because many
starchy adjuncts require a separate vessel for gelatinization (see Table 6.1).
Starch Sources
Starchy adjuncts provide no starch‐hydrolyzing enzymes. They depend on
other components of the mash to convert their starch. If high concentrations
of starchy adjuncts are used, it may be necessary to supplement the mash with
enzymes from other sources, typically molds. The most common starchy
adjuncts are maize (corn) and rice. Rice and maize contribute starch but are
neutral in flavor and low in color and contribute minimal protein and free
amino nitrogen. Maize, rice, and other grains are subjected to dry milling
before they arrive at the brewery to remove the germ and bran, which are
high in lipids that are undesirable in the brewing process. Maize milling yields
a distribution of particle sizes from grits to flour. Rice milling yields whole
rice grains, plus some broken grains that can be used in brewing. Starchy
adjuncts can also be prepared from sorghum and millet. Additional milling is
usually done at the brewery before the grain is cooked. Maize, rice, sorghum,
and millet do not contain gluten, so they can form the basis for gluten‐free
beer. The labeling of food as gluten‐free requires adherence to strict govern-
ment regulations. Grains that can be malted, including barley, wheat, oats, rye,
sorghum, and millet, can also be used as unmalted adjuncts. These adjuncts
generally require adjustments to the milling and mashing processes because
of their physical and chemical properties, such as high beta‐glucan content,
high protein, and lack of starch‐hydrolyzing enzymes.
Neither rice nor maize will gelatinize fully at mashing temperature, so
they must be cooked in a separate process before they are mixed with the
malt mash. The milled grain is mixed with water at 40–50 °C (104–122 °F).
Starch‐degrading enzyme is provided, either by adding malt or mold‐derived
enzyme to the cooker. This prevents the mixture from setting up like pud-
ding. The mixture is then heated and boiled for about 20 minutes. The boiling
mixture is then added to the main malt mash to heat it to the saccharification
temperature.
210 MASHING
It is possible to gelatinize some starchy adjuncts during manufacture to

avoid the cooking step. Flaked adjuncts are treated with hot air or steam and
then pressed between hot rollers. Flaked barley, maize, rice, wheat, and oats are
common. Micronization is a similar process, but the grain is treated with radiant
heat instead of steam. Grains can also be torrified, a process of h eating in hot
air, causing the grains to expand like popcorn and become gelatinized. Torrified
wheat, corn, and barley are typical. Because flaked, micronized, and torrified
cereals are gelatinized in production, they can be added directly to the mash.
Sugar Sources
The addition of sugar adjuncts increases the initial gravity of the wort
without requiring mashing. This is essential in high‐gravity brewing, where
concentrated beer is brewed from a high initial gravity wort, typically 18–20°
Plato. It is difficult and highly inefficient to mash enough grain to make
high‐gravity wort. Instead, lower‐gravity wort is supplemented with sugar.
The high‐gravity wort is then fermented and conditioned. The beer is diluted
with deaerated, carbonated water to the correct ethanol content before
release to customers.
Another application of sugar sources is in the brewing of very strong beer.
Sugary adjuncts can be added during fermentation to avoid, to some extent,
osmotic stress on the yeast that would result from pitching it into strong wort.
Some sugar sources, like candi sugar, honey, molasses, and maple syrup, give
special flavors to the beer. They can be quite expensive. Another flavorful
adjunct is malt extract, which is prepared by mashing grain, separating the
wort, and concentrating it by evaporation. Extract is available in syrup and
powder form. Different types of malt yield different flavors of extract.
The most common sugar sources derive from wet milling of maize. Maize
kernels are soaked in water containing sulfur dioxide. Starch is separated
from the other components by a sequence of milling, filtration, flotation, and
centrifugation in a device called a hydrocyclone. The starch emerges sus-
pended in water and is hydrolyzed with acid or with enzymes to give a variety
of products with different sugar profiles including dextrose corn syrup, refined
liquid dextrose, high fructose corn syrup, and high maltose corn syrup.
Evaporation can yield a solid called corn sugar (mostly glucose). A summary
of common sugar adjuncts used in the brewery is provided in Table 6.5.
Sugar adjuncts are typically used at 5–15% of the total grain bill. They are
best added to the boil kettle with ~10 minutes remaining to ensure steriliza-
tion. Sugar additions provide no FAN or zinc, which are essential nutrients for
yeast health. Sugar adjuncts only contribute flavor if they were caramelized
during manufacture, like molasses, brown sugar, and candi sugar. Molasses is a
dark, viscous syrup obtained as a by‐product of refining sugarcane. It contains
about 85% solids and moderate amounts of calcium, magnesium, iron, and
ENZYMES AND PROCESSING AIDS 211
TABLE 6.5 Sugar Adjuncts

Name % Glucose % Maltose % Maltotriose % Dextrins Other
Dextrose 100 0 0 0 0
(glucose)
Corn syrup 45 38 3 14 0
High maltose 10 60 0 30 0
Maltodextrin 0 1.5 3.5 95 0
Sucrose 0 0 0 0 100% sucrose
Invert sugar 50 0 0 0 50% fructose
phosphate. Molasses is around 50% fermentable. Brown sugar is typically

88% sucrose, 8% invert sugar (an equal mixture of glucose and fructose), and
4% molasses. Belgian candi sugar, in its finest form, is refined beet sugar that
has been caramelized. Otherwise, it is caramelized invert sugar, potentially
from alternative sugar sources.
Malt Extract Malt extract is prepared by evaporation of beer wort to give a

syrup (liquid malt extract [LME]) or powder (dry malt extract [DME]). Malt
extract has no functioning enzymes, but it does contain free amino nitrogen and
other yeast nutrients that are in the original wort. It gives color and flavor to the
beer. Malt extract should be boiled like any wort. Malt extract is not as stable in
storage as unmilled grain. It can be difficult to handle in large qualities because
the syrup is very viscous and the powder absorbs water and steam forming
sticky clumps. For the same amount of wort solids, malt extract is relatively
expensive, so brewers who use it do so largely to boost the solids content of their
own wort. Malt extract is not available in as many varieties as is malt. Nonetheless,
it is possible to brew beer with malt extract as the only source of fermentables.
6.6 ENZYMES AND PROCESSING AIDS
Enzymes and processing aids are sometimes added to the mash, usually to
overcome processing difficulties occasioned by undermodified malt, non‐
diastatic adjuncts, hulless adjuncts, or excessive beta‐glucan.
Rice Hulls
Rice hulls are a processing aid that provide no extract or flavor, but they can be
used to promote filterability during lautering, especially with glucan‐rich
adjuncts or those that lack hulls. Grain hulls prevent stuck sparges by increasing
the permeability grain bed during lautering. They are typically used at 2–5% of
the total grist. Rice hulls must be pre‐wet and rinsed before use to remove dust
212 MASHING
that can compromise clarity and flavor. They can be rinsed with the sparging
apparatus in the lauter tun before transfer of the mash.
Farbebier
Very dark wort is fermented to produce Farbebier (Ger: colored beer), which
is sometimes used in small quantities to increase beer color, especially by
brewers who comply with the Reinheitsgebot. Farbebier has a color of around
4000 °SRM, so the amount needed does not significantly affect the flavor or
other properties of the beer.
Enzymes
Enzyme preparations in solid or solution form are available as brewing pro-
cessing aids. They are usually extracted from cultures of bacteria or mold.
Any enzymes used for brewing must be certified for food use. Nonetheless,
their levels of activity and the virtually inevitable presence of other enzymes
may not be standardized. Enzymes prepared by different suppliers using dif-
ferent purification protocols may behave quite differently. Brewers should
use reliable suppliers that can deliver enzymes with consistency. Enzyme
preparations must be stored cool and used fresh, or their activities may
decline over time. Enzymes can be useful in many stages of brewing. Here we
will discuss those that are added to the mash. Some commercially available
enzymes are too stable for brewing use. Enzymes that are not deactivated by
boiling or pasteurization may create problems in packaged beer.
Alpha‐Amylase Alpha‐amylase hydrolyzes alpha(1→4) glycosidic bonds

that are not too close to branches on a starch chain. If there is insufficient
alpha‐amylase activity during mashing, the wort fermentability will be low.
Alpha‐amylase from various species of the aspergillus mold has maximum
activity around 60–65 °C (140–149 °F). This enzyme is not as stable as barley
alpha‐amylase, but it can be useful to provide activity when adjuncts dilute
the malt. Some alpha‐amylases from bacteria are more thermally stable.
These are used to liquify the adjunct mash‐in the cereal cooker.
Limit Dextrinase Limit dextrinase, also called pullulanase, debranches

starch by hydrolyzing alpha(1→6) glycosidic links. Acting alone, the enzyme
makes a minimal contribution to fermentability, but it creates more substrates
for alpha‐ and beta‐amylase.
Glucoamylase Glucoamylase, also called amyloglucosidase, hydrolyzes a

single glucose unit from the non‐reducing end of a starch chain. Depending
on the microbial origin, it may or may not be able to hydrolyze alpha(1→6)
ENZYMES AND PROCESSING AIDS 213
β-amylase
non-reducing end
glucoamylase
α-amylase
limit
dextrinase
Figure 6.16 Targets for enzymes.
branch points. Glucoamylase is often added in the fermenter to make highly

attenuated beer styles, like light beer, malt liquor, and brut IPAs. Use in the
mash is possible, but it will hydrolyze maltose to glucose, potentially leading
to problems due to catabolite repression. Figure 6.16 schematically shows
target bonds for these starch hydrolysis enzymes.
Beta‐Glucanase Beta‐glucan (Figure 3.11) is a gum that, when dissolved in

wort, raises the viscosity, slowing down lautering and other filtration processes.
It comes from degradation of grain cell walls. Slow filtration exposes the wort
to possible oxidation and allows it to extract polyphenols from grain. Well‐
modified malt has little beta‐glucan, but undermodified and unmalted grain
can have enough to interfere with brewing. Beta‐glucanase hydrolyzes the
beta‐glucan, quickly lowering the mash viscosity.
Pentosanase/Xylanase Plant cell walls contain insoluble cellulose, plus a

variety of potentially soluble carbohydrates, including beta‐glucan and
pentosans, which are polysaccharides containing pentoses. Two of the major
pentoses are xylose and arabinose. The pentosan‐degrading enzyme usually
used in brewing is arabinoxylase. Used in conjunction with beta‐glucanase, it
can improve processability. The risk is that arabinoxylase can release ferulic
acid from its ester linkages to the pentosans, allowing it to dissolve in the
wort. Depending on the fermentation conditions, the ferulic acid is converted
into 4‐vinylguaiacol, a strongly flavored phenolic compound. Some beer
styles, notably weizenbier, are expected to have 4‐vinylguaiacol (Figure 2.20),
but it is a defect in others.
Protease Proteases hydrolyze proteins. In mashing, they are used to increase

free amino nitrogen, especially in mashes with a high content of adjunct. Yeast
needs free amino nitrogen to make nitrogen‐containing compounds for their
life functions. Protease should be used cautiously, because it can hydrolyze
foam‐positive protein, leading to well‐fed yeast but deficient foam.
214 MASHING
1. What are the process goals of the mash? What are the major process
inputs and outputs?
2. In this drawing of a starch fragment, locate reducing end(s), non‐reducing
end(s), 1→4 glycosidic links, and 1→6 glycosidic links.
CASE STUDY 215
3. In the drawing for problem 1, locate points of action for alpha‐amylase,

beta‐amylase, limit dextrinase, and glucoamylase.
4. Describe what is meant by the fermentability of wort.
5. What is the relative percentage of most common carbohydrates in the
mash?
6. What critical process variables of the mash would you change to create
a dry beer?
7. You have a grain bill of 4000 kg with a liquor volume of 100 hL. Calculate
the strike water temperature to achieve a mash‐in temperature of 65 °C.
8. What is the purpose of a premasher?
9. Describe the best practices for mashing in.
10. What is the effect of temperature and pH on general enzyme function?
Be as specific as possible by describing the effect on mashing enzymes.
11. Why is a slow gentle mash mixer recommended over vigorous stirring?
12. Design a mash program including time and temperatures to include a pro-
tein rest, maltose rest, saccharification rest, and mash‐out step. Explain the
purposes of each step by describing specific enzymatic activity promoted
during each step.
13. Determine the amount of mash required in a single decoction step to
raise the temperature of a mash from 55 to 65 °C assuming a boiling
temperature of 100 °C.
14. Describe how the following mash conditions might (i) affect enzyme
activity and (ii) influence the character of the finished beer: a thin mash
at 4 kg/L, a mash pH of 5.8, a single step infusion mash at 68 °C (155 °F)
for 60 minutes, and a mash‐out at 76 °C (170 °F).
15. Why does rice need to be cooked in a separate vessel before use in a
brewer’s mash?
CASE STUDY
A brewery has a dark ale with an original extract of 14 °P and a final extract
of 4 °P. Mash‐in is at 69 °C (156 °F). Recently, the original extract has fallen to
13.5 °P, and the final extract has drifted up to 6 °P, which is well out of the
specification. What are some likely causes for this problem in the mash?
Propose a program to diagnose and fix the issue, preferably without excessive
expense, downtime, and loss of good will.
216 MASHING
BIBLIOGRAPHY
Bamforth CW. 2001. pH in brewing: an overview. MBAA Tech. Q. 38(4):1–9.

Barth R, Zaman R. 2015. Influence of strike water alkalinity and hardness on mash
pH. J. Am. Soc. Brew. Chem. 73(3):240–242.
Briggs DE, Boulton CA, Brookes, PA, Stevens R. 2004. Brewing Science and Practice.
CRC. ISBN 0‐8493‐2547‐1. p. 46–49. Detailed discussion of added enzymes.
Edens L, Dekker P, van der Hoeven R, Deen F, de Roos A, Floris R. 2005. Extracellular
prolyl endoprotease from Aspergillus niger and its use in the debittering of protein
hydrolysates. J. Agric. Food Chem. 53(20):7950–7957.
Fix G. 1999. Principles of Brewing Science. Brewers Publications. ISBN
978‐0‐937381‐74‐8. Chap. 1.
Kadziola A, Abe J, Svensson B, Haser R. 1994. Crystal and molecular structure of
barley alpha‐amylase. J. Mol. Biol. 239(1):104–121.
Krottenhaler M, Back W, Zarnkow M. 2009. Wort production. In Eßlinger HM
(editor). Handbook of Brewing. Wiley‐VCH. ISBN 978‐3‐527‐31674‐8. Chap. 7.
Kunze W. 1999. Technology of Brewing and Malting, International Edition. VLB. ISBN
3‐921‐690‐39‐0. Chap. 3.
Lewis MJ, Robertson IC, Dankers SU. 1992. Proteolysis in the protein rest of mashing –
an appraisal. MBAA Tech. Q. 29(4):117–121.
Sammartino M. 2015. Enzymes in brewing. MBAA Tech. Q. 52(3):156–164. Readable
coverage of malt enzymes as well as added enzymes.
Chapter 7
WORT SEPARATION
After mashing is complete, the mash tun contains a mixture of dissolved car-
bohydrate and undissolved particles, including grain hulls, fats, and protein.
During separation, the carbohydrate‐rich wort is removed. It will be required
for subsequent fermentation. The major goal of wort separation is to extract
as much of the carbohydrates as possible from the grain bed while avoiding
transfer of hulls or extraction of harsh tannins. There are several methods for
wort separation; each is a variation on filtration. The wort is run through
pores that are too small to admit the undissolved particles but large enough
to allow a satisfactory flow rate for the wort. In lautering, the hulls of the grist
serve as the filter medium. All wort separation methods involve two steps: (i)
running off the first wort and (ii) sparging (rinsing) the grains to produce
second wort.
7.1 WORT SEPARATION PROCESSES
Lautering (Ger: pure; clear) is the process of wort separation in which the spent
grains serve as filter material. The process is completed with one of three
types of equipment: a lauter tun, a combined mash/lauter tun, or a mash filter.

217
218 WORT SEPARATION
The lauter tun and mash filter are separate vessels from the mash tun and
require a low shear pump to transfer the entire contents of the mash.
Lauter Tun
Lautering is typically performed in a dedicated vessel called the lauter tun
(Figure 7.1). It has a wide diameter to allow for a shallow grain bed depth and
a wide flow area. This design increases flow by increasing the flow area (item
1 in Table 7.1) and decreasing the depth of the grain bed (item 2). A bed depth
of 25–50 cm (10–20 in.) is common.
A few centimeters above the true bottom of the vessel is a false bottom
with slotted plates to hold up the grain and to allow wort to pass. The false
bottom supports the grain bed but does not perform the filtration. The design
sparge
rake
sparge water
wort out false bottom grain bed

(A)
rakes area of detail false bottom detail

(B)
Figure 7.1 (A) Lauter tun. Source: Barth (2013). © 2013 Wiley. Used with permis-
sion. (B) Mash/lauter tun; Levante Brewing Company with detail of false bottom.
Source: Photo: Naomi Hampson.
WORT SEPARATION PROCESSES 219
TABLE 7.1 Application of Darcy’s Equation to Flow Rate in the Lauter

Increase Flow/Lower Pressure Drop Decrease Flow/Increase Pressure Drop
Wide flow area Narrow flow area
Shallow grain bed Deep grain bed
Large grain particles Finely ground grain particles
Low wort viscosity High wort viscosity
Loose grain packing Tight grain packing – collapsed grain bed
Higher temperature (lower viscosity) Lower temperature (higher viscosity)
Low β‐glucans (low viscosity) High β‐glucans (high viscosity)
of the false bottom is critical. It is designed to give minimal pressure drop if it

is kept clear of deposits. The slots must be narrow enough to prevent the pas-
sage of spent grain but wide enough to prevent clogging. A common design
element is to mill the underside of the slots slightly wider than the top to
prevent blockage. With slot gaps around 0.7 by 80 mm, the total open area in
a false bottom is about 10%.
The lauter tun is also equipped with rotating knives or rakes (also called
cutting units) that slowly dig furrows in the grain bed to promote flow rate.
The grain bed should only be raked if the flow rate is low or the differential
pressure is high. Each rake arm is equipped with several knives that are
designed to make channels efficiently without collapsing the grain bed.
The height of the rake can be raised or lowered depending on the turbidity of
the wort. If the wort is turbid, the rake should be raised. If the wort is clear,
the rake should be lowered as close to the false bottom as possible. Some
rakes include a pivoting plough‐like crosspiece that assists spent grain
removal.
Before transfer of the mash, hot water is added to the lauter tun, with
enough volume to slightly cover the false bottom. This water, called founda-
tion water, pre‐warms the lauter tun and prevents air pockets under the false
bottom. Because foundation water will dilute the mash, the minimum amount
should be used. The entire contents of the mash tun are then pumped into the
lauter tun from above the false bottom. Some particles may initially slip
through the false bottom; therefore the early wort with particles is gently
pumped from below the false bottom and returned above the false bottom, an
operation called vorlauf [Ger: forerun]. The vorlauf sets up a bed of grain on
the false bottom and is run until the wort is clear. It is this grain bed that
serves as the filtration medium, trapping small particles and clarifying the
wort (Figure 7.1).
Once the wort is clear, it is sent to the boil kettle. The wort is allowed to
run through several valves in the true bottom, from which it is transferred to
the kettle, sometimes via an intermediate vessel called a prerun tank. Runoff
should take 90–120 minutes. The first wort is collected until the grain bed is
220 WORT SEPARATION
just visible. At this point sparge water is sprayed onto the top to maximize
wort extract. The wort collected after sparging is called second wort. Sparging
is discussed in Section “Sparging.”
Most lauter tuns have a grain‐out port for the spent grain. When wort sepa-
ration is complete, the port is opened, and the knives are positioned to drive
the grain into a collection bin.
The lauter process has some disadvantages. These include:
• Complexity of the moving parts, including the knives and their raising/
lowering gear, the sparge arm, and the grain‐out system.
• Dilution of the wort with foundation water and sparge water limits the
strength of the wort that can be efficiently obtained.
• Large requirement for floor space.
Mash/Lauter Tun
Small breweries and traditional British ale breweries use the same vessel for
mashing and wort separation. The mash tun has a slotted false bottom like
that of a lauter tun. The vessel is deeper and narrower than a lauter tun to
conserve heat. The grain bed may approach 1−2 m deep, significantly deeper
than a dedicated lauter tun. The traditional mash tun has no knives, so the
wort must percolate through the entire bed. These design elements may
increase lauter time as compared with a dedicated lauter tun. There is also no
transfer of the mash to another vessel, so a subsequent brew cannot begin
until the grain is removed.
Mash/lauter tuns are more susceptible to a set or stuck mash. If the wort is
drawn off too quickly, pressure builds up that compacts the grain bed, closing
the spaces through which the wort flows. When knives are unavailable, the
bed must be elevated by pumping water from under the false bottom, a pro-
cess termed underletting. This method completely disrupts the grain bed and
requires that vorlauf be repeated.
Mash Filter
Mash filters are most common in large breweries where extract recovery effi-
ciency is critical. Mash filters, also called filter presses, came into use for wort
separation in 1901. The unit consists of:
• A fixed plate with accommodation for piping called the head.

• A movable plate, called the follower, connects to a screw or hydraulic
ram to hold the plates together against the pressure of the feed pump.
• A stack of vertically oriented plates fitted with gaskets form chambers.
• Each chamber has a filter cloth supported by one wall of the chamber.
Grooves or corrugations in the wall supporting the filter cloth allow the
clear wort to drain.
The filtration process starts with pumping the mash into the chambers.
Pressure from the pump drives the clear liquid through the filter cloths and into
drains on the outlet sides of the chambers. After filtration, the pressure is
released, and the plates are separated one at a time, allowing the solid to drop
into a box below. The modern form of the mash filter, shown in Figure 7.2, was
introduced by Meura Corporation in 1987. It is a conventional plate and frame
filter with the addition of an elastic membrane that can expand under air or
water pressure to drive the contents of the chamber against the filter cloth. This
results in lower moisture in the draff (<70% compared with 85% for a lauter
tun) and higher extract recovery. Some models have two kinds of plates, one
with a membrane on each side and one with a filter on each side. Other models
have identical plates, each with a filter on one side and a membrane on the other.
The filtration cycle starts with pumping mash into the bottoms of the
chambers (Figure 7.2A). As the mash enters, the pressure drives wort through
the filter pads to runoff channels behind them. When all wort is transferred,
the mash valve is closed, and the membranes are inflated with compressed air,
driving wort from the grain and through the filter cloths (Figure 7.2B). Hot
water is pumped through the mash channels to sparge the grain as the air in
the membranes is released (Figure 7.2C). The volume of sparge water admit-
ted should match with the membrane fluid released to maintain the integrity
of the filter cake. Sparge water remaining in the grain is pressed out by inflat-
ing the membranes again.
Because the wort is driven through the grain under pressure, maintaining
high permeability is less important than it would be for gravity feed. Brewers
take advantage of this by crushing the grain to small particles in a hammer
mill. The small particles are mashed more efficiently, so less grain is needed
for the same extract. The wort separation process is faster; no vorlauf is
required. Mash filter manufacturers claim that they can process 14 batches a
day. The mash filter is more efficient in water and energy use than the lauter
tun. It produces a drier draff, saving transportation costs for spent grain. The
pressure and the shallow grain bed provide less flow resistance to viscous
wort, allowing the use of a greater variety of malts and adjuncts than is practi-
cal with other separation systems. For small breweries, the high capital for
installation ordinarily does not match the savings in efficiency. Even small
breweries in remote locations where the costs of malt, water, utilities, and
draff disposal are high may benefit from mash filtration.
Nessie Filter A novel mash filtration system, called “Nessie,” was introduced
by the Ziemann Holvrieka Company in 2016. The system relies on rotating
222 WORT SEPARATION
membrane
filter
cloth
mash
clear
wort
(A)
air
(B)
water
(C)
Figure 7.2 (A) Mash filtration, filling. (B) Mash filtration, compression. (C) Mash
filtration, sparging.
circular porous sintered stainless steel filter wheels mounted vertically. Two
wheels are connected at the rim to form a cylindrical vessel whose sides are
the wheels. Mash is fed in between the wheels and clear wort comes out the
sides. The rotation of the unit carries the grain to a chute. The demonstration
system has four pairs of wheels through which the grain flows in sequence.
Weak wort from the last two units is fed back to the previous units, and sparge
water is added to the fourth unit. The Nessie system is designed for continuous
operation. At the time of this writing, brewers have had little experience with
this system.
Sparging
After the first wort is transferred to the boil kettle from the lauter tun, the
grain is sprayed with hot 71–78 °C (160–172 °F) water to wash additional
sugar from the grain, a process called sparging. The sparge water picks up
additional extract from the grain bed and carries it to the kettle.
Batch sparging is a simple method where the wort is drained from the
grain bed completely during the lauter phase. The lautering vessel is then
refilled with water, the grain bed is re‐established, and then it is drained again.
Today, the first and second wort are usually combined, but in the past, the
second runnings were used to make a low‐alcohol beer called small beer or
table beer. Continuous sparging (also called fly sparging) is a method of
supplying a continuous sprinkle of water on the grain bed, such that water
addition rate matches the wort drain‐out rate. This practice is most common,
as it maintains the filter bed. A thin layer of water is maintained over the
grain bed to prevent excessive oxidation. Sparging must be monitored,
because excessive sparging can dilute the wort and extract harsh‐tasting
tannins from the hulls.
There are several sparging devices including simple spray balls, spray
nozzles, and sparge arms, which are rotating pipes with holes throughout.
Even coverage with spray water is critical to avoid channeling, which leads to
a loss in extract.
Figure 7.3A shows the grain bed before sparging. The spaces between the
grains are filled with wort. In Figure 7.3B, sparge water is added at the top and
wort is drawn from the bottom of the vessel. In this view, enough sparge water
has been added to displace the wort in the upper portion of the bed. Sugary
wort is still attached to the outside of the grains, illustrated by the grain bor-
der. Figure 7.3C shows the situation when most of the wort between the par-
ticles has been driven out. Additional water carries the entrained sugar,
starting at the top (or wherever the sparge water enters).
224 WORT SEPARATION
(A) (B) (C)
Figure 7.3 Sparging.
second
Wort strength
wort
Volume
Figure 7.4 Extract recovery from wort separation.
As sparging continues, the sugar content of the wort decreases rapidly. In

addition, the pH will rise as the sparge water displaces the acidic compounds
from the malt. Sparging is usually terminated when the specific gravity of the
runoff falls below 1.005 (2 °P) or the pH exceeds 6. Subsequent runoff is gener-
ally of poor quality and will contain excessive concentrations of phenolic com-
pounds or minerals extracted from the grain. Some breweries attempt to recover
value from this weak wort by adding it to the mash‐in water of the next batch.
The sparging water should be consistent with the mashing water. If any salt
additions were made to the mash water, the same additions should be made
to the sparge water. Sparge water benefits from pre‐acidification to pH 6 to
prevent extraction of tannins.
The general pattern of extract recovery during the wort separation is
shown in Figure 7.4. The first wort collected during the lauter is high in extract.
First wort strength is typically 4–6 °P higher than the target beer. Because of
sparging, the extract decreases in the second wort. The deeper the grain bed,
the more slowly the wort strength declines; thus more sparging water is
needed for extract recovery. It is advantageous to minimize the amount of
sparge water required so that high‐gravity wort is collected. Water can be
added to lower the specific gravity if desired, but raising the gravity requires
extensive boiling, which takes time, consumes energy, and influences the
FLOW AND PRESSURE 225
character of the beer. Another consideration is that the wort separation

process is usually the slow step, so less sparging means faster brewing.
Depending on the beer and the recipe, wort separation is halted when:
• The target extract is recovered in the kettle.

• The target volume is obtained in the kettle.
• The runoff strength drops below 2 °P.
• The runoff pH exceeds 6.
7.2 FLOW AND PRESSURE
Differential Pressure
The principles of fluid flow are relevant to every aspect of beer production,
but they are the key issues in wort separation. Differential pressure is the dif-
ference in pressure under the false bottom and the pressure above the grain
bed. If the differential pressure is too high, the force compresses the grain bed
and fills the slots of the false bottom, stopping flow and creating a stuck mash.
Many lauter tuns are equipped with simple measurement tools called manom-
eters (Figure 7.5), which measure the liquid pressure at two points. One is
installed below the false bottom and one is installed above the grain bed.
With sight glasses placed next to one another, the difference in liquid heights
on the manometers indicates the differential pressure. Typically, 50–150 mm
(2–6 in.) is an acceptable range during the lauter.
The pressure exerted by a column of liquid is given by
P gh
where ρ is the density of the liquid (in kg/m3), g is the acceleration of gravity
(9.8 m/s2), and h is the height of the column (in m). One of the important
M1 M2 M1 M2
L
CV CV
(A) (B)
Figure 7.5 Differential pressure. M1 and M2, manometers; CV, control valve.
(A) Valve closed and (B) valve open.
226 WORT SEPARATION
results of fluid dynamics is that the sum of all the pressure drops in the flow
path is equal to the total pressure. In Figure 7.5A the valve is closed, stopping
all flow. The liquid in both manometers comes up to the liquid level in the
tank, showing no loss of pressure in the grain bed or the valve. The pressure
below the false bottom is the full system pressure. The entire pressure drop
occurs at the valve. In Figure 7.5B the valve is partially open, and the liquid
flows through the system. The pressure due to gravity above the grain bed
remains unchanged, but the flow through the bed causes a pressure drop,
represented by the difference between M1 and M2. The grain bed and the
control valve each provide part of the pressure drop. We can increase the
pressure drop at the control valve by making its opening smaller. This will
reduce the pressure drop at the grain bed, and it will lower the flow rate.
During brewing operations, the differential pressure should be monitored.
Excessive pressure should be relieved by reducing flow either by slightly clos-
ing a valve or by reducing the speed of a pump. Never completely stop flow.
Slight pressure is required to maintain the organization of the grain bed.
Darcy’s Equation
The grain bed is an example of a packed bed. Another example is a filter, like
diatomaceous earth. The packed bed resists the flow of wort requiring there
to be differential pressure across the bed for fluid movement. The greater
the resistance to flow, the greater the pressure needed to overcome it.
Equivalently, the greater the flow rate, the greater the pressure differential
across the bed. These concepts are captured in Darcy’s equation:
BA P
Q
L
where Q is the volume flow rate, B is the permeability, A is the area of the bed
perpendicular to the flow direction, ΔP is the pressure drop at the bed, η is the
viscosity of the wort, and L is the depth of the filter bed. Permeability is
proportional to the square of the diameter of the particles that make up the
filter medium multiplied by the cube of the bed porosity. There are equations
that can be used to estimate the permeability, but application to beds of grain,
where the particles are irregular and are not all the same size, is challenging
work best left to chemical engineers.
Nonetheless, Darcy’s equation is very useful to brewers in a qualitative
way. Consider a simplification of the equation as follows:
Flow rate bed permeability filtration area pressure /

wort viscosity bed depth
LIPID REMOVAL 227
Brewers can use Darcy’s equation to determine how changes in lauter

performance will influence runoff speed. For example, if the wort is drawn off
more quickly, the differential pressure increases. As another example, con-
sider what happens if a larger diameter lauter tun is employed. Assuming the
same mash volume, the filtration area increases (A) and thus the flow rate
increases. Some considerations of lauter equipment and processes on flow
rate are described in Table 7.1.
7.3 LIPID REMOVAL
Brewing grain contains about 3% lipid (dry basis). Of this, about 90% is
removed during wort separation. Wort turbidity is caused by an excess of
long‐chain fatty acids. Although some lipid in the wort is beneficial to yeast
health and fermentation, lipids are generally undesirable. Excessive lipid in
the fermenter wort leads to:
• Faster fermentation.
• More vicinal diketones (VDK) but faster VDK reduction.
• Lower esters.
• Increase in amino acid uptake by yeast.
• More higher alcohols.
• Less foaming during fermentation.
• Variable foam stability.
Because of its large role in lipid removal, wort separation has an impor-
tant effect on wort quality. Consider a batch of grain containing 100 kg of
lipid. If 88% of the lipid is removed during wort separation, 12 kg remains.
If, by contrast, 92% of the lipid is removed, 8 kg remains. The less efficient
lipid removal (by four percentage points) produces a wort with 50%
more lipid.
The traditional mash/lauter process provides the most lipid removal,
followed by the lauter tun. Mash filtration is generally less efficient for lipid
removal. Some factors that enhance lipid removal include:
• Deep gain bed.

• Narrow openings in the false bottom.
• Slow runoff of wort.
• Slow rake speed (<3 m/min).
• Shallow raking (more than 5 cm above the false bottom).
228 WORT SEPARATION
7.4 MANAGEMENT OF SPENT GRAINS
Brewing generates about 20 kg of spent grain per hectoliter of beer (50 lb/US
bbl). In small systems, the grain can be collected by manually shoveling or
raking into collection tubs. Lauter tuns usually have sweep arms as part of the
rake system that drives the draff into discharge pipes. Mash filters open plate
by plate, releasing the draff to a bin below. For larger volumes, the draff is
moved by auger, progressive cavity pump, or rotary screw with compressed
air to a holding tank. With adequate storage, spent grain can be held for about
seven days until significant spoilage occurs.
The water content of spent grain is 80% or more for combined mash/
lauter tuns, around 75% for a dedicated lauter tun, and as low as 65% for a
mash filter. These differences are quite significant in several ways. If the draff
output is 20 kg/hL at 80% moisture, the dry content weighs 4 kg. At 65%
moisture, the same 4 kg of dry material would come to 11.4 kg of wet draff.
The difference of 8.6 kg is nearly 9 more liters of beer sold instead of
discarded.
Most truck freight volumes for spent grain are around 22 600 kg (50 000 lbs)
per truck. A rule of thumb on spent grain generation is about 18 kg/hL of beer
(50 lb/bbl), so one truckload corresponds to about 1300 hL (1000 bbl). Draff
for shipment must be kept below 80% moisture due to the risk of shifting
weight distribution in transit. Spent yeast after fermentation may be mixed
with the draff as long as moisture remains below 80%.
Spent grain has significant value as animal feed. Yeast and trub can be
mixed with the draff, but no filter aids on other non‐feed materials can
be included. Some food safety regulations that apply to animal feed will
need to be followed, including documentation practices. Using the grains
for animal feed is almost always a much better option than disposing of it
as waste.
Some considerations in designing for spent grain management include:
• How to collect draff after wort separation.

• How to transport the draff within the brewery. Minimal use of convey-
ors saves maintenance and operating costs. Draff that falls behind and
under equipment will need to be cleaned up before it rots and makes an
unsanitary situation.
• How to store the draff for shipment. Wet draff can be stored for no more
than one week in a closed bin. Storage should accommodate somewhat
more than a full truck load so that if the truck is late, there is still room
to brew.
• Trucks need around 4 m (13 ft) overhead clearance from the draff
storage bin.
BIBLIOGRAPHY 229
1. What is the purpose of wort separations? Describe the typical process

inputs and outputs for each step of the process.
2. What some factors that limit the rate at which wort can be separated?
3. Compare and contrast the use of a dedicated lauter tun with a combined
mash/lauter tun.
4. List the pros and cons of using a mash filter over a lauter tun.
5. Identify three factors about lauter tun design that influence the pressure
drop across a bed of particles.
6. What is sparging? What are its benefits and risks?
7. How does the use of a mash filter influence the milling process?
8. Considering Darcy’s equation, propose three changes the brewery could
make to improve (speed up) the lautering process.
CASE STUDY
Case Study 1
You are the Director of Operations at a brewery with a 10 bbl brewing sys-
tem. You have noticed an increase in total lauter time over the last several
brews. Standard protocol takes about 1.5 hours, but the last batches have
taken more than two hours. Explain your approach to identify, verify, and cor-
rect this increase in lauter time.
Case Study 2
You are the Brewing Manager at a brewhouse with an annual production
volume of 100 000 bbl. Recently your sensory team noted an increase in lin-
gering bitterness attributed to astringency in the finished beer. Explain which
set(s) of quality control data you would review next in order to troubleshoot
the problem. Selecting the two most likely scenarios, explain your approach
to verify and correct this increase in astringency.
BIBLIOGRAPHY
Anness BJ, Reed RJR. 1985. Lipids in Wort. J. Inst. Brew. 91:313–317.
230 WORT SEPARATION
Becher T, Ziller K, Wasmuht K, Gehrig K. 2017. A novel mash filtration process (part
1). Brauwelt Int. 35(3):191–194.
Kunze W. 1999. Technology Malting and Brewing, International Edition. VLB. ISBN
3‐921690‐39‐0. p. 224–250.
Master Brewers Association of the Americas. Wet Spent Grains. https://www.mbaa.
com/brewresources/TechTips/Pages/Wet‐Spent‐Grains—Tank‐Suggestions‐for‐
the‐Craft‐Brewer.aspx.
O’Rourke T. 2003. Mash separation systems. Brewer Int. 3(2):57–59.
Chapter 8
BOILING, WORT CLARIFICATION,

AND CHILLING
After wort has been collected from the spent grains, the sugar‐laden liquid is
sent to the boil kettle. Here it will be boiled for at least 60–90 minutes. The
most common methods of heating the boil kettle are by direct flame or by
steam. After boiling, the wort may be clarified in a whirlpool tank. The hot
wort is then chilled in a heat exchanger and oxygenated before entry into
fermentation.
There are multiple process goals for boiling including:
• Isomerization of hop alpha acids.

• Sterilization of the wort.
• Enzyme inactivation.
• Formation and removal of trub.
• Removal of volatile off‐flavors.
• Addition of wort clarifiers.
• Development of flavor and color.
• Concentration of the wort.

231
232 BOILING, WORT CLARIFICATION, AND CHILLING
Isomerization of hop alpha acids provides the characteristic bitterness of

beer. In Section 4.3 we covered the chemistry of hops and the isomerization
reaction. The high temperatures of boiling drive the formation of soluble,
bitter iso‐alpha acids. Boiling hops in wort also extracts other hop com-
pounds; however many hop aroma compounds are lost with the steam. Early
addition hops are those added for the length of the boil. Early addition hops
promote bitterness. Late addition hops are those added with only 0–20 min-
utes of boil time remaining. Late addition hops promote flavor and aroma
with less contribution to bitterness.
Sterilization of the wort is critical because microorganisms may have
entered the production process at multiple points. While the brewhouse
should be kept in clean condition, malt is laden with bacteria and wild yeast
that may survive the temperatures of the mash. Elimination of possible con-
tamination by these microbes during boiling helps to maintain consistency
during fermentation.
Enzyme inactivation fixes the carbohydrate contents of the wort. While
most malt enzymes are denatured at mash‐out temperatures, boiling destroys
any remaining activity. Fixing the carbohydrate content ensures a consistent
ratio of fermentable sugar to unfermentable dextrin, yielding a consistent
product.
Formation and removal of trub is necessary to remove hop debris, dena-
tured proteins, and precipitated lipids. Many proteins are denatured during
the boil and are unable to refold. Hydrophobic or nonpolar patches become
exposed. The nonpolar sections of the protein coagulate, stick to lipids and
nonpolar polyphenols, and drop out of solution as a precipitate. There are
two types of break material formed during wort processing, hot break and
cold break. Hot break is formed during the boil and is removed in the whirl-
pool while the wort is still hot. Cold break forms after the wort is cooled, typi-
cally in the chiller. It may or may not be removed before fermentation
depending on the brewery.
Removal of volatile off‐flavors is needed for compounds like dimethyl
sulfide (DMS). The molecule has a very low aroma threshold, contributing a
flavor of canned corn. DMS removal is covered further in Section “Dimethyl
Sulfide.”
Addition of wort clarifiers, also called kettle finings, improves long‐term
clarity of the finished beer by removing proteins and/or polyphenols. The high
temperature and convection of the boil causes rapid solubility and d ispersion
of clarifying agents. The most common wort clarifying agent is carrageenan,
also called Irish moss. Carrageenan is a negatively charged polymer that binds
to positively charged proteins, which then precipitate with the trub.
Development of flavor and color is the result of increased Maillard
reactions. Previously discussed in Section “Types of Malt,” Chapter 4, in the
context of flavor changes during malting, this same process occurs in boiling
HEAT TRANSFER 233
wort, as wort is rich in simple sugars and amino acids. The Maillard reactions
produce molecules with caramel, toast, and biscuit flavors while also darkening
the color of the beer by a few SRMs.
Concentration of the wort is achieved through evaporation. Over a period
of 60 minutes, evaporation of 5–10% of the wort is common. As the boiling
intensity increases, so does the evaporation. A gentle, rolling boil leads to a
lower evaporation rate and better formation of hot break as a result of lower
shearing forces.
8.1 HEAT TRANSFER
Principles
Boiling and chilling are heat transfers; heat moves from one medium to
another. The general term for a device that transfers heat is a heat exchanger.
Some examples of heat exchangers used in brewing include steam boilers,
wort boilers, energy recovery equipment on boiling kettles, wort chillers, jack-
eted fermenters, and flash pasteurizers. Refrigeration units have two heat
exchangers, one to accept heat on the cold side and one to release heat on the
hot side. A heat exchanger has two materials, nearly always fluids, at different
temperatures separated by a material that conducts heat.
Heat always moves from the higher temperature to the lower temperature:
dT
Heat rate kA
dx
where the heat rate is the speed at which heat is transferred (power), k is the
thermal conductivity, A is the area across which the heat travels, and dT/dx is
the temperature gradient, the change in temperature over a given distance.
The minus sign indicates that the heat flows in the direction opposite the
temperature gradient, from hot to cold. This equation is only easy to use when
the conducting material is uniform throughout and the temperature gradient
is the same throughout, a situation that seldom arises in practice. The equa-
tion is more useful to show general trends. For example, heat flows faster
when there is more surface for heat transfer, when the material through which
heat flows is a good conductor, when the temperature difference across the
conductor is greater, and when the conductor is thinner.
Heat transfer is complicated in boiling, because steam lowers the effective
thermal conductivity. Table 8.1 gives thermal conductivities of materials of
interest to brewers. Some highlights are the very high conductivity of copper
and aluminum, the relatively low conductivity of carbon steel and stainless
steel, and the insulating properties of water, steam, and carbon (representing,
perhaps, the effect of burned‐on coatings on wort heating surfaces).
TABLE 8.1 Thermal Conductivities of Various

Materials
Material Conductivity (J s−1 m−1 K−1)
Air 0.024
Aluminum 205
Carbon 1.7
Copper 401
Ethylene glycol 0.25
Iron, cast 55
Steel, carbon 54
Steel, stainless 16
Water, ice 2.18
Water, liquid 0.58
Water, steam 0.016
Source: Data from The Engineering Toolbox. Provided
to illustrate concepts only.
The high thermal conductivity of copper combined with its favorable material
properties made it the material of choice for boiling kettles and heat exchanger
pipes in the past. Even today, the boiling kettle is sometimes called a “copper.”
Today, stainless steel is commonly used for heat exchange surfaces, despite its
relatively poor thermal conductivity. Its superior strength and stiffness allow thin-
ner plates and tubes to be used, compensating to some extent for its poor thermal
conductivity. Stainless steel is not wet by water as well as copper, leading to prob-
lems that we will discuss in the section on boiling technology. The decisive issue
is that stainless steel can be cleaned with materials like sodium hydroxide
(caustic) that would damage copper. Stainless steel is also less prone to corrosion.
Aluminum is not suitable for direct contact with wort or beer because it is cor-
roded by acids. Aluminum cans are protected by a chemical lining.
Heat Exchangers
The two most common types of heat exchangers in brewing are the shell and
tube exchanger and the plate exchanger. The shell and tube exchanger con-
tains tubes carrying one fluid surrounded by a shell carrying the other
(Figure 8.1). The plate heat exchanger has a stack of plates with spaces
between them. Fluid flows in alternating spaces, typically in opposite direc-
tions. The arrangement of the plates in the stack is shown schematically in
Figure 8.2. Any heat exchanger is most efficient when the hot and cold fluids
flow in opposite directions. In the case of the shell and tube exchanger in
Figure 8.1, cold fluid entering the tubes at the left is warmed by lukewarm
fluid in the shell. The already hot fluid in the tubes at the right needs the
hottest fluid in the shell to give it more heat.
HEAT TRANSFER 235
Figure 8.1 Shell and tube heat exchanger.
coolant
wort
Figure 8.2 Plate heat exchanger, expanded for clarity. Source: After Brigg et al.
(2004).
The critical issue in all types of heat exchanger is that the fluids themselves
are poor heat conductors. To get satisfactory heat exchange, the fluid must
move in a way that brings all parts of it close to the heat exchange surface.
This is accomplished by establishing turbulent flow in the fluid. Turbulent
flow causes the fluid to mix well across the inside of the channel that carries
it. The more turbulent the flow, the thinner the boundary layer, which is a
stagnant layer against the channel walls. Heat will cross the boundary layer
by conduction through the poorly conducting fluid, so a thinner boundary
layer is good for efficient heat exchange. Turbulence is encouraged by high
flow rates, high density, low viscosity, and features like projections or dimples
in the wall of the channel.
8.2 BOILING TECHNOLOGY
Removal of undesired flavor compounds and to some extent coagulation of

lipids and proteins during the boil are favored by maximizing contact of the
hot liquid with the resulting steam. Volatile compounds can only escape from
the liquid at the liquid–vapor interface. Lipids and proteins initially concen-
trate at the liquid surface, so more surface area offers more opportunity for
molecules to find one another, bind together, and form a solid. In a simple
boiling system, wort‐steam contact occurs largely at steam bubbles, so the
amount of contact depends on the vigor of boiling. More advanced systems
produce wort droplets or other high‐surface configurations, so coagulation
and stripping of volatiles occurs with less evaporation, saving energy and time
and putting less thermal stress on the wort.
Boiling is the largest consumer of energy in the brewhouse, which makes it
a perennial target for improved efficiency. New proprietary systems are con-
tinually placed on the market as others are, with less fanfare, discontinued.
Even a simple boiling system can be made much more efficient by the inclu-
sion of energy recovery from the steam. As we cover some of these systems,
we will deal with the basics of how they work.
SAFETY NOTES
Flame
Heating by flame should not be undertaken without provision for
venting the firebox to the outside. This applies to flame used directly on
the kettle and to flame used to raise steam. Flame produces toxic fumes,
including colorless, odorless, and highly toxic carbon monoxide (CO).
A CO monitor/alarm should be installed and tested regularly.
Boilover
Any boiling process is susceptible to boilover, where foam accumulates
on top of the kettle, leading to overflow of boiling liquid. Boilovers are
particularly robust with wort, because proteins and polyphenols can
stabilize foam. Exposure to wort boilover can cause severe, extensive,
life‐threatening burns. The problem is exacerbated when the victim is
on a narrow catwalk or ladder with no good escape route. A dedicated
water hose to spray down a kettle should always be in easy reach of the
brewer. In addition, the use of a level detector connected to a cutoff
switch or valve to remove heat if the foam reaches an abnormal level is
recommended. All standard operating procedures for the boil should
involve safety considerations for a boilover. The details of the plan
depend on the layout and procedures of your brewery.
BOILING TECHNOLOGY 237
Vacuum
Many brewery vessels are heated by steam jackets. Steam jackets of any
size must have one or more valves to let air in and out. When steam is
admitted, the air must be allowed to escape, or it will prevent the steam
from reaching all parts of the jacket. When the steam is turned off, it will
condense, leaving a vacuum in the jacket unless air is admitted. The
vacuum can crush the vessel. Even without such a dramatic failure, the
repeated push and pull will weaken the metal. The solution is a thermo-
static air vent−vacuum breaker (TAVB). The TAVB is a valve that lets
air out until the heat of the steam closes it. On the cooling cycle, it lets
air in to prevent a vacuum from forming. Every jacketed vessel should
have a properly installed and maintained TAVB.
About Steam
If a sample of water (or any other liquid) is sealed in an evacuated (no air)
box, the water molecules have a broad range of energies whose average
increases with increasing temperature. As the temperature increases, some
molecules have enough energy to break free of the forces keeping them in the
liquid. They evaporate and enter the vapor phase. Once in the vapor phase,
some molecules will strike the surface of the liquid and become captured and
condensed, rejoining the liquid phase. The rate (speed) of evaporation
depends strongly on the temperature. The rate of condensation depends
mostly on the concentration of molecules in the vapor, which is proportional
to the pressure.
At the start, the pressure is low and evaporation dominates. As the pressure
builds up, the rate of condensation rises and becomes equal to that of evapo-
ration. The situation where a process and its reverse reach the same rate is
called equilibrium. In the case of vapor–liquid equilibrium, the pressure
reaches a steady value as long as the temperature does not change. The pressure
at which this occurs is called the vapor pressure; it is strongly dependent on
the temperature. Figure 8.3 shows pressure/temperature data for water
plotted in the form of a phase diagram. Above and to the left of the line is the
vapor region; the water exists in the form of superheated steam. Below and to
the right is the liquid region. The pressures and temperatures on the line itself
represent liquid in equilibrium with saturated steam. Selected vapor pressure
data are provided in Table 8.2.
The boiling point of a substance is the temperature at which its vapor pres-
sure is equal to the pressure upon it. Table 8.2 can be used to show that the
boiling point of water at 1.99 bar is 120 °C. If liquid water at 140 °C were to be
used to heat a vessel, the water and all its plumbing and pumps would have to
160
140 vapor
120
temperature (°C)
100
80
60 liquid
40
20
1 2 3 4 5 6
pressure (bar)
Figure 8.3 Phase diagram of water.
TABLE 8.2 Vapor Pressure

of Water
Temperature (°C) VP (bar)
10 0.01
20 0.02
30 0.04
40 0.07
50 0.12
60 0.2
70 0.31
80 0.47
90 0.7
100 1.01
110 1.43
120 1.99
140 3.62
160 6.18
Source: Data from Rumble (2017).
operate above 3.62 bar (37.8 psig). The boiling point of beer wort is higher
than that of pure water at the same pressure by about 0.2 °C per degree Plato.
Steam in breweries is often saturated at about 4 bar, giving a temperature of
144 °C. When saturated steam is used to provide heat, the steam temperature
remains the same as long as the pressure is constant. Steam provides heat by
condensing to water. At 4 bar, each kilogram of steam condensed releases
about 2100 kJ of heat (960 BTU/lb). In practice, saturated steam is contami-
nated, to some extent, with a mist of liquid water. The portion of the steam
that is in the liquid phase will not release heat; 4 bar steam that is 5% liquid
will release only 1995 kJ/kg (0.95 × 2100 kJ/kg) of heat on condensation. The

fraction of the steam that is vapor is called the quality of the steam.
The water produced by condensation of steam must be removed or it will
interfere with steam flow. Steam traps are located at low points in the system.
The trap opens in response to the presence of liquid water. The most common
type of trap has a bulb that floats on the water, opening the valve when there
is water in the trap and closing it when there is no water to float the bulb. The
steam trap should be mounted over a drain or routed to a collection tank
for reuse.
About Boiling
Boiling is not as simple as it seems. When heat is applied to a vessel, the
material of the vessel and the rate of heat transfer influence the boiling pro-
cess. Up to a point, the speed at which steam forms on a heated surface
increases as the surface becomes hotter. At higher surface temperatures, the
boiling rate decreases with increasing temperature. This paradoxical behavior
occurs because there are two modes of boiling influenced by the wettability
of the material. On a wettable surface or at low surface temperatures, a
bubble forms, and then part of it breaks off and floats away, leaving a smaller
bubble that grows as more steam is generated. This mode is called nucleate
boiling. Nucleate boiling is desirable because heat transfer, and hence boiling
rate, is rapid.
At higher surface temperatures or on non‐wettable surfaces, the bubbles
grow more rapidly than they can break off. The attached bubbles combine to
form a film of steam. The film interferes with the flow of heat from the s urface
to the liquid, so boiling slows down. This mode is called film boiling. Here the
surface of the vessel becomes significantly hotter than the liquid. This can
cause scorching of wort. Materials like copper, which are wet by water, are
less susceptible to film boiling.
Boiling Systems
Direct Fire Kettle In direct fire boiling, the wort is heated by a fire under
the kettle (Figure 8.4). The major advantage of direct fire is the simplicity and
low cost of the equipment. Because of the uneven heating of the kettle
surface, some caramelization of the wort is likely, especially at hot spots. The
resulting flavor may be a defect or a desired style characteristic. Both the fire
side and the wort side of the kettle are subject to accumulation of solid
deposits, called fouling, which interferes with heat exchange, so the kettle
must be cleaned often. The flame must not be lit until the entire bottom of the
kettle is covered with wort; otherwise the wort will boil dry and char in places.
For the same reason, the flame must be extinguished before the kettle is
Figure 8.4 Direct fire at Philadelphia Brewing Company.
heating
jacket
Figure 8.5 Jacketed kettle. Convection mixing of wort shown.
empty. Direct fire is not energy efficient. A significant fraction of the heat
produced bypasses the wort and goes up the flue. Direct fire becomes less
practical for large kettles, because volume of wort outpaces the external area
of the kettle. Direct fire is unusual in kettles above 35 hL (30 bbl).
Jacketed Kettle In a jacketed kettle, a hot fluid—usually steam—is

conducted through an enclosed space on the outside of the kettle and brought
into contact with the bottom and sides of the kettle, as shown in Figure 8.5. In
this example, the heating is applied asymmetrically, which enhances wort
mixing by convection (curved arrows). The temperature of the fluid in the
jacket must be higher than the target temperature for the wort. Steam is the
most common method of kettle heating in breweries. Steam operates at

pressures of 2–4 bar absolute (15–45 psig), making the steam plumbing
relatively easy. However, it does require substantial capital investment for
double‐walled jackets, piping installation, and a boiler facility. Steam
requirements across the entire brewery should be taken into consideration,
because large changes in demand can cause inefficient heating. Jacketed
kettles have a limitation of about 235 hL (200 US bbl).
Internally Heated Kettle Wort can be boiled by a coil of tubes inside the
kettle that carries steam or even combustion products from a flame. These
systems have fallen out of favor because of limitations on how much tubing
surface can be accommodated in the kettle and especially because cleaning
and maintenance can be complicated.
An internal calandria is a shell and tube heat exchanger mounted inside
the kettle. The unique feature is that the tubes are open at the upper end or
both ends to allow wort to flow in and out. Steam is provided to the shell to
boil the wort. The wort is propelled upward by the convection current created
by steam flow, in which case both ends of the tubes are open, or it can be
pumped. Intermediate and combined systems using mechanical pumping as
well as steam‐driven pumping are in use. Usually, the output of the calandria
shoots up to a deflector plate that breaks up the liquid into droplets, as shown
in Figure 8.6. The extra surface on the droplets facilitates removal of volatiles
at a moderate rate of evaporation. Some calandrias have an auxiliary output
below the liquid surface to provide mixing. The heat exchanger tubes provide
extra surface for heat exchange, to some extent overcoming the size limita-
tion of direct fired and jacked kettles.
External Calandria Putting the heat exchanger outside of the kettle

removes the limitation on heat transfer surface. A pump cycles the wort from
wort spreader
steam tube
condensate
Figure 8.6 Internal calandria.

boiling/stripping
wort layer
cone
gutter
Merlin wort boiler
circulation pump
tangential
wort pipe
whirlpool
from lauter tun
Figure 8.7 Merlin wort boiler.

®
the bottom of the kettle through an external shell and tube heat exchanger.
The heated wort is returned onto a wort spreader above the liquid level in the
kettle. As with the internal calandria, wort droplets from the spreader enhance
boiling efficiency. Because the size of the unit is not limited by the dimensions
of the kettle, more heat exchange surface is provided. More surface can
exchange the required amount of heat at lower temperature, reducing fouling
of exchange surfaces and potentially enhancing wort quality.
Merlin The Merlin®, introduced by Steinecker (now Krones) in 1999, is a

unique wort boiling/stripping system whose central element is a steam‐heated
cone that boils the wort, as shown in Figure 8.7. Wort from the wort separation
unit is pumped into a whirlpool, which is a device for wort clarification
explained in Section “Hot Wort Clarification.” A circulation pump delivers
the wort to the top of the conical heater, from which it flows under gravity in
a thin layer to a gutter at the base of the Merlin vessel. Wort from the gutter
is fed by gravity to a tangential pipe back into the whirlpool, causing slow
whirlpool action. After a rest of about 10 minutes, circulation is resumed
briefly to remove any remaining volatiles, and then the wort is chilled. It is
claimed that the Merlin system can function satisfactorily with as little as 4%
evaporation.
Direct Steam Injection Steam at a temperature higher than the boiling

point can be added directly to wort to boil it. The energy of the steam is used
to break up the wort into droplets, facilitating the removal of undesired
volatile compounds. Standard brewery steam, called process steam, is not
suitable for direct steam injection. Instead, culinary steam must be prepared,
either in a separate boiler or by treatment of process steam. Steam injection
avoids the problem of fouling of the heat exchange surface. The major
disadvantage of steam injection is dilution of the wort by condensation of the
injected steam.
Continuous Boiling The continuous wort boiling process involves heating

the wort at high pressure to about 135 °C for a specified time without boiling
and then lowering the pressure to allow boiling to occur. The key advantage
is that because the process is continuous, heat from the later steps can be used
in the earlier steps. Figure 8.8 illustrates one version of the process. Wort from
the lauter tun or mash filter is heated in three stages to about 135 °C under
pressure, so it remains liquid. The temperature is maintained in a holding tube
for about three minutes. The pressure is released in two stages in flash vessels
in which part of the wort boils into steam. The steam from the second, cooler
flash vessel preheats the incoming wort. The steam from the first, hotter flash
vessel provides additional heat. The third heating stage uses fresh steam from
the boiler to heat the wort to the final temperature of 135 °C. The condensate
from the three heat exchangers can be used to heat water for other operations.
The process only works in a brewery that is in continuous operation. To
maintain continuity, it is recommended that several wort separators provide
feed and several whirlpools accept the output of the boiling unit. Although
the concepts behind continuous boiling were developed many years ago, few
breweries use it.
Energy Recovery
Boiling is the single largest consumer of energy in the brewery; it consumes
about 30% of the energy expended for wort production. Nearly every brew-
ery makes some effort to reduce the cost and environmental impact of the
burning of fuel for wort boiling. The most straightforward way to conserve
90 °C 112 °C 135 °C
fresh steam
heat exchangers
70 °C
from wort
separation 100 °C 120 °C
2 1
flash vessels
to whirlpool holding line
Figure 8.8 Continuous boiling.
energy is not to use it at all. Many of the boiling systems described above are
designed to use less energy by reducing the amount of evaporation while
maintaining good wort quality. Nonetheless, even a very efficient boiling sys-
tem evaporates at least 4% of the wort. Evaporating 1 L of water from beer
wort at 1 atm pressure requires 2.3 MJ of heat.
The simplest recovery scheme to recapture the energy of evaporation is to
condense the vapor from the kettle and use the heat to warm water. This can
be accomplished by spraying cool water into the steam. Water is heated to
about 90 °C (194 °F) in this way, but the presence of volatile flavor compounds
from the boil can limit its use.
Direct contact of steam with water is avoided by using a heat exchanger.
The hot water prepared in this way can be stored in an insulated tank
for general heating tasks, such as heating water for mashing, cleaning,
and rinsing. A tall, narrow tank will supply hotter water from the top
(90–95 °C = 194–201 °F) and cooler water (70–80 °C = 158–176 °F) from the
bottom.
The usefulness of energy is greater at higher temperature. For example, if
the temperature of the steam is increased to 110 °C (230 °F), it can assist with
wort boiling. Table 8.2 shows that saturated steam at 110 °C has a pressure of
1.43 bar (6.2 psig). By compressing the steam from atmospheric pressure,
which is 1.01 bar (0 psig) at sea level, to 1.43 bar, the temperature will increase
to 110 °C. Most of the energy to accomplish this temperature rise comes from
condensation of some of the steam, while some comes from the mechanical
work of compression. When the compression is provided by a mechanical
compressor, typically powered by an electric motor, the process is called
mechanical vapor recompression (MVR). The compression can also be

provided by a steam jet, a process called thermal vapor recompression
(TVR). The compressor used for MVR is noisy and a likely source of mainte-
nance issues. The steam jet for TVR presents fewer such issues but generates
extra condensate. If there is a use for this extra hot water, TVR can be
advantageous.
Hot Wort Clarification

After boiling, the wort has a heavy load of solid particles. Some of this mate-
rial is spent hops, and some is material precipitated from the wort during
boiling, called hot break or trub. The total wet mass of solids is typically in the
range of 1–1.5 kg/hL (2.5–4 lb/bbl) of wort but varies depending on the
strength of the wort and the hopping rate. On a dry basis, the hot break has
about 50–70% protein; 15–20% polyphenols, including insoluble hop resins;
and a few percent of other materials, including fatty acids. It is desirable to
remove this material to avoid excessive solids in the chiller, filtration issues
after fermentation, and the persistence of haze‐forming materials. Before
clarification, the wort should be protected from shear forces that will disrupt
the hot break particles, making them difficult to remove.
Hop Back When leaf hops are used, the hops and hot break can be filtered
out in a device variously called a hop back, hop jack, or montejus (formerly
there were distinctions among these). The hop back is a vessel with a slotted
false bottom or a mesh screen. The hot wort with hops is pumped into the
vessel where the hops are caught on the false bottom or screen and serve to
filter out the hot break particles. Wort entrained in the solid may be recovered
by sparging, or it may be wrung out by driving the hops against a screen with
an auger or belt. Many brewers are reluctant to recover wort in this way
because of potential quality issues. Some brewers add additional aroma hops
to the hop back to give the beer a hoppy aroma. The wort is then chilled
before there is any opportunity for the aroma compounds to vaporize out.
Whirlpool The whirlpool is the most common method for wort clarification.
It is most suitable when hops are introduced in the form of pellets, powders, or
liquid products rather than as leaf hops. The whirlpool is a separate cylindrical
vessel, typically with a flat bottom or a slight slope toward the outlet. Optimal
whirlpool geometry is a height‐to‐diameter ratio of 1 : 1. A pipe enters the
vessel from the side at about 30° from the tangent to the wall, as shown in
Figure 8.9. When the wort is introduced through this tangential pipe, it rotates
in the vessel. The momentum provided by filling the whirlpool may be enough
to keep the wort rotating, or it may be necessary to use a pump to recirculate
the wort to keep it moving. The rotation of the wort drives the trub and hop
cloudy
wort in
clear wort out trub cone
Figure 8.9 Whirlpool.
particles toward the outer wall from which they settle to the bottom and then
collect in a cone‐shaped pile at the center. Once all the wort is in the tank, it is
allowed to swirl for 10–20 minutes. After this time, the clear wort is pumped out
from an outlet at the bottom. Some tanks are designed with three or four
sequential outlets along the side of the tank, with the last outlet on the bottom.
Sequential outlets permit precise removal of wort while maintaining the trub
pile. By slowing the runoff rates near the trub pile, the integrity of the pile is
promoted, which may lead to higher wort recovery.
Whirlpools should be designed to have no projections or dead legs that
obstruct flow. Sometimes, when there are issues with eddy formation, flat
circular rings, called Denk rings, are installed. The rings are about three‐quar-
ters of the inside diameter of the vessel and 25–60 cm (10–24 in.) above its
floor. The rings suppress secondary eddies that interfere with the flow pattern
in the whirlpool.
Small breweries may use the boil kettle as a whirlpool. As one would
expect, a dual‐purpose vessel is not as effective as individual single‐purpose
vessels. When the kettle is used as a whirlpool, it is not available for the next
batch of beer, so the brewing cycle is longer. The kettle is not optimized as a
whirlpool, so it may lack tangential inlets and optimal outlets. Furthermore,
the presence of thermometer probes, dip tubes, and other obstructions may
create eddies.
Wort Stripping Sometime an extra step, called wort stripping, is added after
wort clarification to remove any remaining undesired volatile compounds.
One configuration is to run the wort down a column lined with beads, which
causes the wort to spread in a thin layer. Steam is run up the column to
remove the volatile compounds. Wort stripping is not appropriate for beer
styles in which hop aroma is desired.
BOILING CHEMISTRY 247
8.3 BOILING CHEMISTRY
Hop Acid Isomerization

A major function of wort boiling is to isomerize alpha acids, which are precursors
to the hop bittering compounds in beer. Three alpha acids account for about
98% of these compounds in hops; they differ only in one side chain. The three
main compounds are shown in Figure 8.10 along with a generic alpha acid in
which the variable portion is shown as R. Before isomerization, the alpha
acids are insoluble and are not flavor active. During boiling the alpha acids
are slowly converted (isomerized) to iso‐alpha acids, shown in Figure 8.11.
Bonds on asymmetric carbon atoms are represented as a solid wedge emerg-
ing toward the viewer and a dashed wedge receding away from the viewer.
(A) (B) (C) (D)

Figure 8.10 Alpha acids. (A) Humulone. (B) Cohumulone. (C) Adhumulone.
(D) Generic alpha acid.
(A) (B) (C)
(D) (E) (F)

Figure 8.11 Iso‐alpha acids. (A) cis‐Isohumulone. (B) cis‐Isocohumulone. (C) cis‐
Isoadhumulone. (D) trans‐Isohumulone. (E) trans‐Isocohumulone. (F) trans‐
Isoadhumulone.
Isomerization introduces an additional asymmetric carbon atom, so there are

six iso‐alpha acids. The absolute configurations were established quite
recently; older literature may not be correct.
The isomerization reaction is first order, that is, its rate (speed) is directly
proportional to the amount of alpha acid present. Other factors that affect
the rate are temperature (faster at higher temperature), pH (faster at higher
pH), and the concentration of metal ions like Mg2+ (faster at higher concen-
tration). The rate is lower when the carbohydrate content of the wort is
higher. Under normal wort boiling conditions with hop pellets, no more than
about 30% of the available alpha acids are isomerized and soluble. The
amount of iso‐alpha acids produced is less than the amount of alpha acids
consumed. This is because once the iso‐alpha acids are formed, they can
undergo degradation to non‐bitter compounds.
Hop Dosing
Hops or hop products can be introduced to the brewing process during b
oiling
or at several other points:
• First wort hopping. The hops are put into the kettle before the wort from
the separation process is added. This is anecdotally said to give smooth
bitterness.
• Boiling hops. Hops are added to the kettle when boiling begins. This is
the usual way to provide bitterness to beer. If the hops are added manu-
ally, the heat should be cut off during addition to minimize the risk of a
boilover. This method and first wort hopping retain little aroma from the
hops.
• Late kettle addition. Hops are added part way through the boiling pro-
cess to decrease the loss of aroma compounds in the steam.
• Hop back or whirlpool addition. Hops are added to the hop back (for
leaf hops) or the whirlpool (for pellet hops). When the hot wort is pro-
cessed in the vessel, aroma compounds picked up by the wort have no
opportunity to escape with the steam, so they are retained at least until
fermentation. They may still contribute bitterness through extraction of
hulupones and humulinones (Figures 4.22 and 4.24).
• Dry hopping. Hops are added to the fermenter at some point in the fer-
mentation process. Equipment to perform the dry hopping operation
without introducing air is called a hop doser, but is also known under a
variety of trade names mostly based on projectile weapons (hop rocket,
hop cannon, hop gun, hop bazooka, etc.). These devices permit purging
of the hops with carbon dioxide. They then use pressure to push the hops
into the fermenter. Dry hopping greatly enhances hop aroma, especially
BOILING CHEMISTRY 249
when the hops are added after most of the fermentation process is com-
plete, minimizing loss of aroma in the carbon dioxide. Isohumulone
decreases during dry hopping because it sticks to the hop solids.
However, loss of bittering from isohumulone can be compensated by
release of humulinone (Figure 4.24), which dissolves readily from the
added hops. The result can be gain or loss of bitterness from dry hop-
ping, depending on the balance between the iso‐alpha acids lost and the
humulinone released.
HOP CREEP: OVER‐ATTENUATION FROM DRY HOPPING
Dry hopping can cause unexpected refermentation in a fermenter or

packaged beer. Historically this was observed as hop creep, whereby an
otherwise terminal gravity beer demonstrated an additional decline in
specific gravity after dry hopping. Hops, like many plants, contain small
quantities of starch hydrolysis enzymes, including alpha‐ and beta‐
amylase and smaller amounts of limit dextrinase and amyloglucosidase.
These enzymes, if not deactivated by boiling, can convert unfermenta-
ble dextrins in packaged beer to fermentable sugars. If a dry‐hopped
beer is packaged before accommodating the dry hop creep, it may lead
to dangerous carbon dioxide pressure and out‐of‐specification alcohol
concentration.
Laboratory studies have shown a 2 °P increase in attenuation of fin-
ished beer to which hops and yeast have been added. This additional
attenuation could increase carbonation by 4 volumes and alcohol con-
tent by 1% by volume. The pressure caused by increased carbonation
could lead to dangerous failure in the packaging.
Dimethyl Sulfide
Dimethyl sulfide (DMS: CH3─S─CH3), although noticeable in most lager
styles, is regarded as an off‐flavor, especially when present in excess. The
details of DMS production are covered in Chapter 12. Boiling can lower the
DMS concentration by a process called steam distillation. Because of its vola-
tility, the DMS is carried off with the steam. To keep DMS to a low level,
condensate from the DMS‐containing steam must be removed; it should not
drip back into the kettle. Exhaust vents from the kettle should be designed
with condensation collection traps. At boiling temperature, DMS is continu-
ously made from precursors in the malt. Unless the wort is cooled quickly
after boiling, more DMS will be made in the hot wort. DMS can be made
from a different precursor during fermentation, so vigorous boiling and rapid
cooling may not be the entire solution. Excessive DMS may also be removed
by carbon dioxide released during vigorous fermentation. Slow fermentation
or unhealthy yeast may give rise to DMS in beer.
8.4 CHILLING
Chillers
Before yeast is added to start fermentation, the wort must be chilled to a
compatible temperature, which can be as low as 8 °C (46 °F) for lager yeast. In
the past, hot wort was put into a broad shallow vessel called a coolship, where
it released its heat to the surrounding air. The method is seldom used today,
except to produce special flavor effects. The two disadvantages are potential
for contamination from microorganisms in the air and the amount of time
and space required. Also, there is little potential to recover energy from wort
cooled in a coolship.
Nearly all commercial breweries use some form of fluid‐cooled heat
exchanger, generically called a chiller, to chill wort. The most common type of
chiller is the plate heat exchanger (Figure 8.2), sometimes called a Paraflow.
The plate heat exchanger takes little space, is enclosed and isolated from
environmental microbes, is easy to sanitize, can cool a large volume of wort
quickly, and can recover a good fraction of heat from the wort in the form of
hot water (70 °C = 158 °F or more). The efficiency of heat exchange is greater
when the difference between the temperature of the wort and that of the
coolant is larger.
More rapid cooling and a lower final temperature can be attained when
two chillers are used in series. The first chiller uses ordinary water as a cool-
ant, and the second uses a refrigerated coolant, which can be chilled water,
water with ethylene or propylene glycol, or alcohol to prevent freezing, or
refrigeration fluids such as hydrochlorofluorocarbons (HCFCs). Two‐stage
cooling can reduce the load on the refrigeration unit and save energy. The
flow capacity and final temperature for a chiller depend on the number and
size of the cooling plates, the inlet temperature of the coolant, and the rate of
flow of the coolant and that of the wort. Another significant factor is the
buildup of material on the plates. If the cooling capacity of the chiller is insuf-
ficient, wort will have to be run more slowly, so some of it will have to wait for
a long time before chilling. This could result in an increase in DMS in the
beer. The chiller is a potential source of microbial contamination; it should be
regularly monitored for cleanliness. The chiller should be taken apart for
inspection and gasket replacement on a regular schedule.
CHILLING 251
Cold Break
About 40−350 mg/L of solid material, called cold break, precipitates into the wort
on chilling, rendering it cloudy. Cold break is about half protein, and most of the
rest is polyphenols and carbohydrates. The solid is very fine and does not settle well.
It can be removed by filtration or by blowing small air bubbles through the wort to
make a layer of foam, to which much of the cold break adheres. Most brewers
do not attempt to remove cold break. Some reasons to omit this step are as follows:
• Indications that the presence of cold break can be beneficial to

fermentation.
• An additional process on chilled wort risks introduction of microbial
contamination.
• Injection of air can deplete antioxidant properties of the beer.
• An additional step adds time and expense.
Cold break can be measured with an Imhoff cone. These long, transparent
cones contain volumetric gradations to quantify sedimentation. Cold trub
levels are often reported in mg/L or mL/L and should be used to check
consistency from each brew. Imhoff cones can also be used to measure lauter
turbidity, hot break, and yeast flocculation.
Oxygenation
Dissolved oxygen (DO) is an important nutrient for yeast. The yeast cells do
not use the oxygen for respiration; rather they need it to synthesize new plasma
membranes during cell division. Oxygen is added directly after c hilling because
the solubility of gas increases as the liquid temperature decreases. The usual
target for oxygen is 7–18 mg/L (5–13 mL oxygen/L at 0 °C and 1 atm).
Oxygen is typically added to wort in‐line as it exits the chiller. Once fer-
mentation begins, no more oxygen should be added. Oxygen can be added
directly to wort as food‐grade oxygen. Air can be used, but the partial pres-
sure and hence the solubility of oxygen from air is only 21% of that from pure
oxygen at the same pressure. The solubility of oxygen in beer wort is about
20% less than that in pure water at the same temperature and pressure.
Equipment for wort aeration includes ceramic or stainless steel sintered
porous stones or a Venturi device. Dissolved oxygen (DO) in wort can be
monitored with a selective membrane electrode.
All equipment that is or could be exposed to pure oxygen under pressure
must be rated for oxygen service. The system must be designed and maintained
to avoid dangerous reactions. The regulator inlet must be free of dirt, dust, tape,
and solvents. The tank valve should be opened slowly to avoid a dangerous
oxygen hammer, which can result in steel and brass becoming combustible.
1. What is the purpose of the boiling step? Describe the critical process
inputs and outputs for the procedure.
2. Identify six places in a brewery where heat exchange takes place.
3. Compare and contrast direct fire systems with steam‐driven calandrias.
4. What is the role of turbulence in heat exchange?
5. Of the materials listed in Table 8.1, copper and aluminum have the highest
thermal conductivities. Why is stainless steel favored in brewery heat
exchangers?
6. As the heating power to a boiler is increased, the boiling rate reaches a
maximum and then declines. Explain this phenomenon.
7. Describe trub. What is it? How is it formed? Why is it removed? How is
it removed?
8. What is an external calandria?
9. Describe essential design elements of a whirlpool.
10. Explain the influence of dry hopping on perceived bitterness in finished
beer.
11. Discuss the importance of wort aeration. Consider what the effects
of under‐oxygenation and over‐oxygenation might be on yeast
performance.
CASE STUDY
You are the Regional Director for Craft Brewery Acquisitions at a major
brewery organization. One of the flagship brands of a recently acquired
brewery, an American light lager, was moved to production at another facility.
You have since received many consumer complaints about this beer, which
detail a disappointing change in flavor. The complaints began after the produc-
tion location was moved. To follow up, you conducted a sensory evaluation of
the original beer from the original location (Beer A) and the new beer from
the new location (Beer B). Beer A is noted as having significant canned corn
flavor, which complements the lager style. This flavor is completely absent in
Beer B; it is not true to type. Explain the potential reasons for this change in
flavor upon moving production to another location. Propose the next course
of action to identify, verify, and correct this change at the new location.
BIBLIOGRAPHY 253
BIBLIOGRAPHY
Anness BJ, Bamforth CW. 1982. Dimethyl sulphide—a review. J. Inst. Brew.
88:244–252.
Bamforth CW. 2014. Dimethyl sulfide—significance, origins, and control. J. Am. Soc.
Brew. Chem. 72(3):165–168. An accessible update to the 1982 Anness review.
Brigg DE, Boulton CA, Brookes PA, Stevens R. 2004. Brewing Science and Practice.
CRC. ISBN 0‐8493‐2547‐1.
The Engineering Toolbox. www.engineeringtoolbox.com.
Holmes CP, Hense W, Donnelly D, Cook DJ. 2014. Impacts of steam injection technol-
ogy on volatile formation and stripping during wort boiling. MBAA Tech. Q.
51(2):33–41. doi:10.1094/TQ‐51‐2‐0514‐01.
Kapral D. 2016. Applications and importance of thermostatic air vents and vacuum
breakers in the brewery: vacuum crushed vessels are unusable. MBAA Tech. Q.
53(3):137–139. doi:10.1094/TQ‐53‐3‐0723‐01.
Kattein U, Herrmann M. 2009. Comparison of different wort‐boiling systems and the
quality of their worts and resulting beers. MBAA Tech. Q. 46(4):1–6. doi:10.1094/
TQ‐46‐4‐1012‐01.
Kirkpatrick KR, Shellhammer TH. 2018. Evidence of dextrin hydrolyzing enzymes in
cascade hops (Humulus lupulus). J. Agric. Food Chem. 66(34):9121−9126.
Kollnberger P. 1984. Wort boiling systems – new developments. MBAA Tech. Q.
21(3):124–130.
MBAA. Master Brewers Brewery Safety. https://www.mbaa.com/brewresources/
brewsafety/Pages/default.aspx.
Ockert K. 2014. Raw materials and brewhouse operations. MBAA Practical Handbook
for the Specialty Brewer, Vol. 1. Master Brewers Association of the Americas. ISBN
0‐9770519‐1‐9.
O’Rourke T. 2002. The process of wort boiling. Brew. Int. (June):26–28. Brief descrip-
tions and advantages and disadvantages of several boiling systems.
Rehberger A, Luther GE. 1999. Wort boiling. In McCabe JT (editor). The Practical
Brewer, 3rd ed. Master Brewers Association of the Americas. Chap. VII. p. 165–199.
Rumble JR. 2017. Handbook of Chemistry and Physics, 98th ed. CRC Press. ISBN
9781498784559.
Steenackers B, De Cooman L, De Vos D. 2014. Chemical transformations of charac-
teristic hop secondary metabolites in relation to beer properties and the brewing
process: a review. Food Chem. 172:742–756. About hop bitter compounds.
Urban J, Dahlberg CJ, Carroll BJ, Kaminsky W. 2013. Absolute configuration of beer’s
bitter compounds. Angew. Chem. Int. Ed. 52:1553–1555. doi:10.1002/anie.201208450.
Weinzierl M, Niedaner H, Stippler K, Wasmuht K, Englmann J. 2000. Merlin – a new
wort boiling system. MBAA Tech. Q. 37(3):383–391.
Willaert R. 2001. Wort boiling today. Cerevisia 26:217–230.
Chapter 9
FERMENTATION
After wort is made in the brewhouse, it is oxygenated and sent to a fermenter

where yeast is added for fermentation. This begins the cold side of the brew-
ing process. It is often said that brewers make wort; yeast makes beer. The
brewer’s job is to provide the yeast with the most favorable environment for
making good beer. The process by which yeast converts the sugar in wort to
ethanol and carbon dioxide is alcoholic fermentation. Ethanol and carbon
dioxide are primary flavor compounds in virtually every style of beer.
Fermentation also yields many flavor‐active, minor products that can have a
significant effect on the character of the beer, discussed further in Chapter 12.
In this chapter, we will discuss the basic process of fermentation, including the
underlying chemistry. We will discuss fermentation equipment and design, process
monitoring and control, and best practices for yeast management in the brewery.
9.1 FERMENTATION PROCESS
Yeast, when first pitched into wort, undergoes a classic microbiological

growth curve consisting of a lag phase, an exponential phase or logarithmic
(log) phase, a stationary phase, and finally, a decline phase. This growth curve

255
256 FERMENTATION
is demonstrated in Figure 9.1. In classic microbiological growth curves, these

four phases represent the life cycle of microorganisms in a liquid culture.
During the lag phase, the cell count does not change. During the logarithmic
(log) or exponential phase, cell division occurs, resulting in a rapid increase in
total cell count. During the stationary phase, the rate of cell division is the
same as the rate of cell death; thus total cell count reaches a plateau. Finally,
during the decline phase, cell death prevails, and the total cell count declines.
If we think of beer fermentation as a microbiological culture system, the
fermentation curves are slightly different, particularly because we start with a
high number of yeast cells and maintain ideal conditions to prevent cell death.
Furthermore, we often measure only the yeast in suspension and not the total
cell count. The amount of yeast in suspension during fermentation is a useful
tool to monitor fermentation. An illustration of a typical fermentation curve
for ales is shown in Figure 9.2.
Lag Phase
During fermentation, the lag phase can last from 1 to 15 hours for properly
pitched wort or up to 48 hours for underpitched wort. During this phase, the
yeast cells acclimate to the environment, assimilate or absorb nutrients, and
prepare for cellular division. There is little to no fermentation during the
lag phase.
All‐malt wort is typically an adequate source of the necessary amino acids,
vitamins, and minerals required for normal yeast cellular physiology.
Important vitamins include riboflavin, biotin, and inositol. Important miner-
als include sodium, phosphorus, sulfur, copper, iron, zinc, and potassium. All
these nutrients are required to produce new proteins and enzymes that will
stationary phase
log cell count
log decline
phase phase
lag
phase
time
Figure 9.1 Classical microbiological growth curve.
FERMENTATION PROCESS 257
lag
log stationary decline
25
20 temperature (°C)
15
wort
strength (°P)
10
5
yeast in suspension (× 107)
0
–5
0 2 4 6 8 10 12 14 16
days
Figure 9.2 Typical trends over time during fermentation of an ale.
help the yeast cells grow, divide, and conduct alcoholic fermentation. Without
enough nutrients or number of cells, the fermentation may be delayed or
sluggish or lead to off‐flavors.
Of the most essential minerals that yeast require, zinc is one that may be
insufficient in wort. Yeast cells require 0.1–0.2 ppm of zinc, which they cannot
produce themselves. Zinc is supplied by malt, but much of it is bound in an
inaccessible form. In addition, some of the zinc adsorbs upon (sticks to the
surface of) trub and is removed in the whirlpool. Zinc is a cofactor for yeast
alcohol dehydrogenase, an essential enzyme required for alcoholic fermenta-
tion. With insufficient zinc in wort, fermentation may stall or be sluggish. Zinc
is also required for flocculation, which is the clumping together of yeast cells;
it facilitates better yeast harvesting and beer clarity.
Zinc is a common additive in commercial yeast nutrients or it may be sup-
plied by addition of zinc sulfate heptahydrate (ZnSO4·7H2O) or zinc chloride
(ZnCl2). Because zinc is adsorbed by trub, zinc salts should be added directly to
the fermenter. Zinc addition must be carefully controlled; too much zinc can be
detrimental to yeast health, leading to decreased fermentation rates and even
cell death. Because the Reinheitsgebot forbids the addition of zinc salts, some
German breweries provide zinc by placing a zinc electrode in the lauter tun.
As the cells grow and prepare for cellular division during the lag phase, the
presence of oxygen in wort is critical. An oxygen concentration of 8–15 ppm
by weight is recommended in wort before fermentation. The yeast cells need
the oxygen to produce sterols and unsaturated fatty acids, which are essential
components of the cell membrane. Oxygen‐deficient wort leads to insuffi-
cient nutrient uptake due to poor membrane integrity and thus reduced
viability and cell growth. Wort with a high solids content characteristic of
258 FERMENTATION
high‐gravity brewing may require a second dose of oxygen 12–18 hours into
fermentation to prevent stalling because of osmotic stress and a need for
more cell growth. Too much oxygen may lead to excessive cell multiplication,
leading to consumption of wort sugar for yeast growth rather than ethanol
production.
Growth Phase
Once the cells are prepared to divide, they will enter the exponential (log)
phase of growth. It takes about two hours for a yeast cell to divide. At the
recommended pitching rates (see Section “Pitch Rate and Addition of
Yeast”), yeast will only divide two to three times during a normal fermenta-
tion. During this time, yeast will assimilate amino acids, small peptides, and
sugar in a particular hierarchy. The classification of amino acid assimilation is
shown in Table 9.1. Amino acids have been grouped into four categories
based on their rates of assimilation by yeast, though some variation may exist
between strains.
During cellular division and early fermentation, many key flavor molecules
are produced from metabolic processes (see Chapter 12). Fermentation begins
during the growth phase. Sugars are then assimilated in a particular order,
which is important for fermentation performance. Figure 9.3 shows the con-
centrations of the major sugars during fermentation. The removal of sugar by
fermentation is called attenuation. Sucrose is taken up rapidly and is completely
attenuated in 10 hours. Fructose increases at first, because it is released by the
hydrolysis of sucrose. When the sucrose is depleted, glucose and fructose
decline rapidly and are completely attenuated after 24 hours. Maltose is assim-
ilated slowly, and maltotriose even more slowly, and dextrins (soluble carbo-
hydrates with four or more sugar units) are not fermented at all.
Maltose and maltotriose are carried into the cell by proteins in the cell
membrane called permeases. The activities of these transporters are sensitive
TABLE 9.1 Amino Acids Grouped Assimilation Rate by Brewer’s Yeast

Group A Group B Group C Group D
Fast Intermediate Slow No assimilation
Arginine Histidine Alanine Proline
Asparagine Isoleucine Glycine
Aspartic acid Leucine Phenylalanine
Glutamic acid Methionine Tryptophan
Glutamine Valine Tyrosine
Lysine
Serine
Threonine
6
glucose
2 fructose
sucrose
concentration (g/l)
0
60
maltose
50
dextrins
40
30
20
maltotriose
10
0
0 10 20 30 40 50 60 70
time (hours)
Figure 9.3 Typical trends for carbohydrate assimilation by yeast during ale fermen-
tation. Note the expanded scale for glucose, fructose, and sucrose. Source: After
Boulton and Quain (2006).
to glucose concentration. In a process known as catabolite repression, if an

excessive amount of glucose is in the wort, maltose and maltotriose will not
be utilized and assimilation will be inhibited. This is not usually a problem in
all‐malt wort, but when high concentrations of sugar adjuncts are used,
uptake may be inhibited, resulting in a high final gravity (FG).
Stationary Phase
Fermentation continues and is completed in the stationary phase of fermen-
tation. Although the total number of yeast cells remains the same throughout
fermentation, yeast cells flocculate or sediment during this phase. Thus, the
260 FERMENTATION
number of cells in suspension declines. This phase is considered part of the

conditioning or maturation process.
Certain esters, phenols, higher alcohols, sulfur compounds, and other fla-
vor compounds produced during fermentation remain in the beer. Other fla-
vor compounds such as acetaldehyde and diacetyl are reabsorbed and
reduced by yeast cells during the conditioning process. This concept is illus-
trated in Figure 9.4 and will be further discussed in Chapter 12.
Decline Phase
The final stage of fermentation is the decline phase; in the context of the
brewing process, it is considered cold crashing or cold conditioning. The total
cell number does not decline as a result of cell death, but rather there is a
large decline of yeast in suspension because flocculation is promoted during
this phase. Cold crashing involves slowly lowering the temperature to −1 °C
(30 °F) over the course of several days to promote flocculation. Moving too
quickly into the cold crash, before the stationary or conditioning phase is
complete, will lead to excessive amounts of acetaldehyde or diacetyl in the
beer. It is recommended that ale be cold conditioned for two to seven days
with longer conditioning times as required for colloidal stability. Lager is
usually cold conditioned for several weeks.
Pitch Rate and Addition of Yeast

The number of yeast cells added to the fermenter per volume of beer is called
the pitch rate. The pitch rate is of critical importance for the flavor of the
beer; consistency in yeast pitch rate is essential for consistency in beer quality.
organic acids
concentration
acetaldehyde esters
VDK suspended yeast
fermentation conditioning
time
Figure 9.4 Flavors from fermentation.
In general, underpitching wort will promote flavors associated with cellular

metabolism, like esters. On the other hand, overpitching wort will negatively
affect yeast health, which is especially important if the yeast will be reused for
subsequent batches. Fewer yeast cells in an underpitch means longer lag
times, slower fermentation rates, and the potential for inadequate attenua-
tion. In contrast, overpitching leads to a shorter lag time, faster fermentations,
but the potential for a thin body. Overpitching puts stress on the yeast, which
can lead to poor foam quality. Stress can cause yeast cells to secrete a pro-
tease enzyme that hydrolyzes foam‐positive proteins and interferes with
foam quality. A summary of the general effects of pitch rate on beer quality is
displayed in Table 9.2. As would be expected, these effects depend upon yeast
strain and wort character. Optimal pitching rates must be determined by the
brewer and kept consistent during production.
How much yeast slurry should be added to the fermenter? How is pitch
rate determined? There are several methods for determining the amount of
yeast to add to a fermentation. The method employed depends on the techni-
cal capabilities and size of the brewery. The easiest method is addition by
weight or by volume. It is recommended that 0.4–1.2 kg of yeast slurry per
hectoliter (1–3 lb per barrel) is sufficient for fermentation. While this method
will make beer, it is inconsistent because the number of yeast cells in a mass
or volume of slurry is variable. Pitching based entirely on weight or volume of
slurry yields inconsistent fermentations.
Pitching by weight or by volume can be made more accurate by estimating
percent solids of the slurry. A rough estimate of the cell count in a yeast slurry
is 25 million cells/mL for each percent solids, so a slurry with 40% solids
would contain about 1 billion (109) cells/mL. To determine the percent solids,
mix the yeast well to distribute the cells evenly in suspension. Collect a spe-
cific volume of the resuspended slurry in a graduated container. Allow the
slurry to settle overnight at 0–4 °C or centrifuge and then determine the
TABLE 9.2 Pitch Rate Effects on Beer Quality

Underpitch Overpitch
More yeast growth Less yeast growth
Longer lag phase Short lag phase
Longer fermentation Shorter fermentation
Slower diacetyl reduction Faster diacetyl reduction
Increase in esters Decrease in esters
Decrease in fusel alcohols Increase in fusel alcohols
Increase in sulfur compounds Increase in autolysis
Under attenuation risk Optimal attenuation
Full body Thin body
Better foam retention Poor foam retention
262 FERMENTATION
ercentage of solids compared to the total volume. This method may vary by
p
strain or by trub amount. To correct for trub volume, add 1 mL of a 50% solu-
tion of sodium hydroxide (caustic) to 50 mL of yeast slurry. The caustic will
dissolve the trub, leaving only yeast after settling or centrifugation.
WARNING: Sodium hydroxide is dangerously corrosive; it must be prepared,
handled, and disposed of only by properly trained persons.
The most accurate and best method for determining the amount of yeast
in a slurry is to count the cells. One way to do this is with a hemocytometer.
A hemocytometer is a modified microscope slide with a well of a fixed depth
and a grid etched in as shown in Figure 9.5. To obtain an accurate cell count,
one should determine the number of cells in a square 1 mm on an edge
(1 mm2). For yeast, the center square is typically used. If the yeast culture is
dense, counting the entire 1 mm2 space can be challenging; thus it is standard
practice to count five different 0.2 mm2 smaller squares within the center
square (indicated in Figure 9.5 as the magnified box in the upper right). The
total number of cells in five boxes is then multiplied by 5 to approximate the
0.05 mm
0.20 mm
1 mm
Figure 9.5 Hemocytometer for cell counting.

cell count in the total 1 mm2 space. This number can be used to infer the
umber of cells per milliliter (see “Determining Cell Count in a Slurry” box
n
for more details).
DETERMINING CELL COUNT IN A SLURRY
To count yeast, 10 μL of a diluted slurry is added to the hemocytometer

chamber. Using a compound light microscope, a 40× objective is used to
visualize the grid. For best accuracy, five squares are counted within the
central 1 mm2 grid, typically the four in the corners and one in the center.
The number of cells within each 0.2 mm square should be around 20–70
cells. If the number is more than 100, then further dilution is required.
The total of for the five squares is multiplied by 5 to estimate the total
cell number within the 25 squares in the 1 mm2 grid. The chamber is
0.1 mm deep, so the volume is 1 mm2 × 0.1 mm = 0.1 mm3 = 10−4 mL. To
calculate the cell number per milliliter, use the following equation:
Cells per milliliter (Total number of cells in 1 mm 2 grid)

Dilution factor (10 4 )
The dilution factor depends on how the slurry was prepared prior to
counting. If the slurry was diluted 1:100, this number is 100. If the slurry
was undiluted, it is 1. The 104 unit is the conversion factor to go from the
grid volume of 0.1 mm3 to 1 mL. To calculate the total cell number in a
slurry, the number of cells per milliliter is multiplied by the total slurry
volume in milliliters.
To practice, assume you have prepared a yeast sample for counting by
diluting 2 mL of slurry to a final volume of 100 mL for a dilution factor
of 100/2 = 50. You pipetted 10 μL into the hemocytometer. The follow-
ing cell counts were recorded in five 0.2 mm2 grids: 31, 21, 22, 28, 22. The
sum of these numbers, 124, is multiplied by 5 to estimate the cell count
in 1 mm2: 124 × 5 = 620 cells in 1 mm2. Cells per milliliter are determined
by the following: 620 cells × 50 × 104 = 3.1 × 108 cells/mL. If the sample
came from a 40 L slurry, then the total cell count is (3.1 × 108 cells/mL) ×
40 L × (103 mL/L) = 1.24 × 10 13 cells.
With many yeast strains, counting cells in the slurry as‐is can be difficult
due to high cell density and/or extensive flocculation. If the yeast is too dense,
a 1:10 or 1:100 dilution is often required. This is best accomplished with 1×
phosphate‐buffered saline (PBS). Water can be used if PBS is not available. If
264 FERMENTATION
the yeast cells are highly flocculent, the sample should be diluted 1:10 with
0.5% sulfuric acid or 0.5 M EDTA pH 7.0 and slowly stirred with a stir bar for
several minutes. Pipetting and dilution must be done precisely to ensure
accurate cell counts.
Cell counting can be used to determine the amount of yeast, but exactly how
much yeast should be added to wort? The industry standard is to pitch 1 × 106
(1 million) cells/mL/°P of the target wort for ale and 1.5 × 106 cells/mL/°P for
lager. This is more of a general recommendation than an inviolable standard.
Many ale strains provide improved flavor when underpitched (7.5 × 105/mL/°P).
Conversely, overpitching (1.5 × 106/mL/°P) will lead to a faster fermentation.
For high‐gravity brews (higher than 16 °P), it has been demonstrated that
significant drops in viability occur after only 24 hours at normal pitching rates;
thus pitching rate is increased depending on the wort strength (°P).
CALCULATING PITCH VOLUME
The total number of viable cells required to pitch a batch of wort is
Viable cells required Desired pitch rate in cells / mL

Wort volume in mL
Suppose we are pitching 10 bbl of 12 °P wort at the industry standard

for ale of 106 cells/mL/°P. The desired pitch rate is 12 °P × 106 cells/mL/°P.
The wort volume is 10 bbl × 117.4 L/bbl × 1000 mL/L = 1.174 × 106 mL.
The cells required come to 1.174 × 106 mL × 12 × 106 cells/mL = 1.35 × 10 13
cells. We will pitch with the slurry whose cells we counted in the previ-
ous box to be 3.1 × 108 cells/mL. We calculate the volume of slurry
needed from mL slurry = cells needed/cells/mL = 1.35 × 10 13 cells/3.1 ×
108 cells/mL = 4.35 × 104 mL = 43.5 L.
Inclusion of Viability
Viability is measured as a percentage. During cell counting on a hemo-
cytometer, the total number of cells and the number of dead cells
(stained blue with methylene blue) are recorded. Percent viability is
determined by
Total number of cells Dead cells

% Viability 100%
Total cells
In the previous box we counted 124 cells. Suppose that six of them stained
blue with methylene blue.The percent viability is (124 − 6)/124 × 100% = 95%.
The percent viability can be used to determine the total number of viable
cells in a slurry or to determine how much more of a slurry to add. To get the
pitch volume including only viable cells, we divide by the fractional viability:
0.95. So we should pitch 43.5 L/0.95 = 45.8 L.
Viability and Vitality
The first criterion for satisfactory fermentation performance is live yeast
cells. Yeast cells that display signs of life are said to be viable. Live and dead
yeast cells look the same under the microscope, so indicators of life and death
must be applied to make the distinction. Methylene blue and methylene
violet are perhaps the most frequently used indicators for viability. These
dyes are readily absorbed by all yeast cells, living or dead, staining them blue.
Viable cells quickly reduce the dye, turning it colorless. Under the micro-
scope, viable cells are colorless; dead cells stain blue. Combined with cell
counting, this provides a quick way to estimate viability.
A cell can be hanging on to life, but still be in poor condition. The distinction
between strong, healthy cells and weak, vulnerable cells is vitality. But what is
the difference between viability and vitality? Is there any need to d ifferentiate
between the two in brewing? In truth, the difference can be s ubtle, but we like
to think of viability as “capability of surviving” and vitality as “metabolic state
characteristic of the ability to thrive under stress.” A yeast cell might be alive
(viable), but is it also capable of thriving in the presence of stress (vital)?
Measuring viability with methylene blue, or the similar methylene violet, is
common practice because it is cheap and easy. Nonetheless, it has drawbacks.
First, when yeast viability is reduced below 90%, the method grossly overes-
timates viability. Second, actively dividing cells reduce the dye more slowly,
which can lead to misinterpretation. In general, if yeast viability is c onsistently
less than 90%, an alternative method of measurement should be considered.
Other membrane‐permeable dyes can only enter the cell when the mem-
brane is compromised, i.e. dead. One such dye, propidium iodide, binds to
DNA and fluoresces. Slurry pH is also an effective and easy tool to examine
overall quality of brewing yeast. As yeast viability declines, the pH increases.
This is a quick tool for measuring the quality of yeast slurries in which the pH
of the barm beer is determined.
Capacitance, which is the ability to store electric charge, serves as another
viability indicator. An intact viable cell acts as a small capacitor, because
charge is stored by the plasma membrane. If the cell is dead, the membrane is
disrupted and cannot store charge; hence it makes no contribution to the
capacitance. A capacitance probe produces a radio‐frequency electric field
and measures the electrical impedance (resistance to high‐frequency current).
266 FERMENTATION
The impedance is inversely proportional to the capacitance. The capacitance

is directly proportional to the number of live cells in the sample chamber.
A benefit to using capacitance is that trub, other solids, and gas do not influ-
ence the measurement.
Replication capacity measures the ability of yeast cells to divide. The yeast
is diluted and spread on an agar medium in a Petri dish. Viable yeast cells
multiply to form colonies that grow to become visible. The colonies are
counted, and the count is multiplied by the dilution factor to obtain the total
viable number of cells. This method is severely limited by time as it takes
24–48 hours to see yeast colonies. The test can be run more quickly under a
microscope, because it takes less time for a colony to become recognizable
under magnification. Microscopic examination of a sample of yeast cells to
determine the fraction that are budding, called the budding index, can also
provide viability information.
Several automated cell‐counting systems have been developed to help the
user standardize and expedite cell counting. Devices such as the Cellometer®
(Nexcelom, Lawrence, MA), the Countstar® (ABER Instruments,Aberystwyth,
West Wales), and the Nucleocounter® (ChemoMetec, Allerød, Denmark) use
cell imaging systems to calculate cell number. They may also include reagents
and methods for including viability and vitality measurements.
Rate of oxygen uptake, sugar uptake, carbon dioxide release, and ethanol
release in laboratory fermentations are effective methods for measuring
vitality. Vitality can also be measured by the quantification of intracellular
carbohydrates. Glycogen is a storage polysaccharide that is an indicator of
vitality. It is quickly depleted in early fermentation but is then replenished
shortly thereafter. Trehalose, a disaccharide of glucose, is another indicator of
vitality. This sugar protects the membrane during stressful conditions like
dehydration and freezing. Intracellular pH is another measurement of vital-
ity. Healthy yeast cells drive out hydrogen ions. More active yeast cells have a
pH around 6.5, while less vital yeast will be around pH 4–5. Intracellular pH
can be measured with fluorescent pH indicators.
For highest accuracy, cell counting should be combined with measurement
of cell viability; dead cells should not be included in the count when deter-
mining pitch rates. For example, if a brewer pitched yeast that was only 80%
viable, then the actual number of productive yeast cells added would be short
by 20%. The count of viable cells can be used to refine measurements based
on slurry weight or volume to allow the faster, more convenient slurry methods
to yield reliable pitch rates.
The Importance of Temperature

Temperature directly affects yeast performance. Temperature should be pre-
cisely controlled for each stage of fermentation. The optimal temperature
depends upon the yeast strain, the beer style, and the characteristics of the
fermentation. In general, if fermentation is too cool, yeast performance will
be slow with the potential for premature flocculation. If fermentation is too
hot, yeast will divide and ferment more quickly but at the cost of a significant
increase in off‐flavors like fusel alcohol and acetaldehyde. Centuries of brew-
ing practice have identified the typical temperature ranges for the various
stages of fermentation, which are provided in Table 9.3 for the production of
ales and lagers. These ranges represent typical numbers and may vary depend-
ing on the beer and the yeast.
In the laboratory, yeast grows best at 30–32 °C (86–90 °F). For most
brewer’s yeast propagations, 25–28 °C (77–82 °F) is recommended. For beer
production, ale fermentations are conducted around 15–22 °C (60–72 °F) and
lager fermentations at 8–14 °C (46–57 °F). All fermentations are pitched at a
slightly cooler temperature than primary fermentation to permit the yeast to
acclimate and to accommodate a slight temperature rise from heat generated
during early fermentation.
For an ale fermentation, the wort might be pitched at 15 °C (58 °F) with a
primary fermentation at 18 °C (64 °F). Beer specific gravity or density should
be checked and recorded daily to monitor fermentation progress. Primary
fermentation typically lasts 4–10 days. When the fermentation is 2–3 °P from
final attenuation, the temperature may be raised 2–3 °C (5–8 °F) for two to
three days to facilitate the reduction of diacetyl. This step is called the d
iacetyl
rest. After the diacetyl rest, the beer is slowly cooled to 0 °C (32 °F). The green
beer is then conditioned at this temperature for zero to seven days depending
on the style or the need.
For a lager fermentation, the wort might be pitched at 7 °C (45 °F) and
allowed to ferment for 5–14 days at 9 °C (48 °F). After primary fermentation,
the beer may be subjected to a diacetyl rest at 11 °C (52 °F) for two to three
days. Then the beer is slowly cooled at a rate not exceeding 2 °C (4 °F) per
hour, until 4 °C (39 °F) is reached. The beer is conditioned at this temperature
for two to six weeks, a process called lagering [Ger: warehouse].
Selection of an optimal fermentation temperature depends on the yeast
strain employed and the flavor characteristics desired. Across multiple yeast
TABLE 9.3 Typical Temperature Ranges for Modern Fermentations

Ale Lager
Stage Minimum Maximum Minimum Maximum
At pitching 15 °C (58 °F) 22 °C (72 °F) 6 °C (42 °F) 11 °C (52 °F)
At primary 16 °C (60 °F) 25 °C (77 °F) 8 °C (48 °F) 14 °C (57 °F)
fermentation
Cold conditioning −1 °C (30 °F) 6 °C (43 °F) −1 °C (30 °F) 6 °C (43 °F)
268 FERMENTATION
strains there are large variations in fermentation temperature ranges. For

example, certain Scottish ale strains prefer cooler temperatures in the 16 °C
range, whereas some Saison strains benefit from warmer temperatures above
22 °C. In fact, some brewers permit a free temperature rise during fermenta-
tion with Saison strains, as some have been reported to p roduce excellent
flavors at temperatures as high as 35 °C (95 °F). Yeast providers usually rec-
ommend fermentation temperatures for their individual yeast strains.
Throughout fermentation, yeast releases heat as a result of metabolic
activity. This causes the temperature to increase, especially within the cone of
the fermenter where yeast collects. Without proper temperature control, the
temperature of the fermentation will continue to rise with potential
detrimental effects on beer and yeast quality. Typical characteristics of fer-
mentations conducted too warm include:
• Fast attenuation.
• Poor yeast viability and autolysis.
• High fusel alcohols.
• High acetaldehyde.
The target pitching temperature is typically 2–3 °C cooler than fermenta-

tion temperature. After pitching, the temperature is raised to the fermenta-
tion target over a period of 18–36 hours. Most flavor compounds are
produced in the first 72 hours of fermentation, illustrating the importance of
temperature control from the outset of fermentation. Near the end of fer-
mentation, before final gravity has been reached, the temperature may be
raised another 2–3 °C over one to two days to help promote final attenuation
and expedite acetaldehyde and diacetyl reduction during conditioning.
The expected temperature changes for an ale fermentation are shown in
Figure 9.2.
Once flavor maturation has been attained, the beer is cold crashed to as
low −1 °C (30 °F). Because of the presence of ethanol, which has a freezing
point of −114 °C (−173 °F), beer has a freezing point below −2 °C (28 °F). The
fermenter should be cooled no faster than 1–2 °C/h. Rapid cooling causes
thermal stress that can reduce yeast viability by more than 10%. Cold condi-
tioning ultimately promotes yeast removal from beer due to flocculation, and
it helps to remove colloids, giving improved clarity after filtration.
Krausen, Brandhefe, and the Use of Antifoam

As yeast releases carbon dioxide, foam called krausen is generated in the
fermenting beer. Depending on the stage of fermentation, more CO2 and thus
more foam is produced. It is recommended that the fermenter be filled only
to 70% capacity to provide headspace for krausen.
Traditionally, fermentation progress was tracked by the appearance of the

krausen. In the earliest stages of fermentation, as the yeast cells divide, a fine
layer of bubbles or foam may appear. Low krausen indicates the onset of vig-
orous fermentation and is marked by fine bubbles with light brown caps. High
krausen indicates peak fermentation with the maximum foam height and the
largest foam bubbles. As fermentation slows, the krausen collapses, leaving
dark brown foam caps. And finally, with completion of fermentation, the
krausen collapses completely, leaving a dirty brown layer. The krausen ring, or
brandhefe, is often left behind on the fermenter wall as the high krausen
collapses. This layer of cold break containing lipids, protein, and yeast can be
very difficult to clean after it dries. After the fermenter CIP cycle, the effec-
tiveness of removing the brandhefe should be visually inspected.
Some traditional brewing practices require physical removal of the brand-
hefe during fermentation. If left to fall back into finished beer, autolyzed
yeast (yeast cells that have been damaged by their own enzymes) in the
brandhefe can cause an astringent bitterness. Some brewers permit foam to
gush out of the airlock during fermentation to avoid a buildup of the brand-
hefe. This practice has the disadvantage of loss in final beer volume and loss
of beer foam‐positive proteins; it is not recommended.
The brewer can protect the foam quality of the finished beer by adding an
antifoam during fermentation, eliminating the krausen. This seems counterin-
tuitive, but by adding antifoam during fermentation, more foam‐active
proteins are retained in the finished beer, thus improving its foam. Also
important is that the use of antifoam allows the fermenter headspace to be
more completely filled, so more beer can be made. By avoiding krausen loss
in a blow‐off tube, more yeast is retained for reuse.
The most commonly used antifoam products are food‐grade silicone‐based
materials. The Reinheitsgebot forbids them, and the US Food and Drug
Administration (FDA) has strict rules on their use. For silicone‐based anti-
foams, the FDA requires that no more than 10 ppm of silicone can be present in
finished beer. Silicone‐based antifoam sticks to yeast during fermentation; thus
most will be removed from finished beer with appropriate removal of yeast.
When silicone is used, it would be prudent to take extra care to remove the
yeast effectivity. Practices that wring extra beer from yeast should be tested
carefully for their effect on the finished beer. Strict adherence to m
anufacturer
recommended concentrations is essential to avoid carryover into finished beer.
Alternative antifoam products have been successfully developed that use natu-
ral oils and hop products. Vegetable oil products have the added benefit of
improving yeast health while potentially reducing wort o xygenation needs.
Tracking Fermentation
In modern fermentations, fermentation progress is monitored by a beer
property that varies with solids content. The solids content in beer is mostly
270 FERMENTATION
carbohydrate, much of which is consumed during fermentation. We will draw

very clear distinctions among the measurement (specific gravity, refractive
index), the interpretation (solids content, degrees Plato), and the significance
to the fermentation process (degree of fermentation, real attenuation). We
will call attention to the suitability of various sensors as in‐line, on‐line, and
off‐line analyzers. In‐line analyzers are mounted in the pipes or vessels to
provide continuous monitoring of the process. On‐line sensors are installed
near the process so that a sample can be diverted to the sensor for analysis.
The analysis can be automated or under operator control. Off‐line analysis
requires that a sample be collected and carried to a laboratory.
Solids and Ethanol Content The extract, or solids content, of wort or beer

is the fraction or percentage of the sample that consists of dissolved solids.
The extract in wort before fermentation is the original extract (OE); that
after fermentation is the real extract (RE) also called the final extract. Wort
is a mixture of various carbohydrates, proteins, and inorganic material. Beer
has all of these plus ethanol and small amounts of other volatile organic
components. The usual measurements of extract and alcohol make simplifying
assumptions to give results at an appropriate level of detail without consuming
excessive laboratory time and expense. For extract, the sample is compared
with a reference sample containing only water and sucrose. A sample of wort
that gives the same measurement (specific gravity, refractive index, etc.) as a
solution of 11% sucrose in water is considered to have an OE of 11%, or
11 °P, irrespective of the exact composition of the solids actually present. For
beer, the volatile and nonvolatile components must be selectivity analyzed.
A sample of beer whose volatile components when dissolved in the same
mass as the original beer give the same measurement as that of 5% ethanol
by weight would be considered 5% alcohol by weight (ABW). For example,
suppose we distill 100 g of beer and separately collect the distillate (the part
that boils) and the residue (the part that does not boil). We add water to each
fraction to bring each to 100 g. If the refractive index of the distillate is the
same as that of 5% ethanol by weight in water, the beer is considered 5%
ABW, irrespective of the nature of the components actually present. If the
specific gravity of the residue is the same as that of 4% sucrose by weight in
water, the RE of the beer would be considered 4 °P.
Density/Specific Gravity Density is the mass of a sample divided by its

volume. Specific gravity is the mass of a sample divided by the mass of an
identical volume of water. Alternatively, the specific gravity can be calculated
from the density of the sample divided by the density of water. For example, a
specific gravity of 1.050 means that the substance is 5% heavier than an equal
volume of water. The density, in units of g/mL or kg/L, is numerically close to the
specific gravity. Specific gravity is measured with a calibrated hydrometer that
displaces an amount of water whose mass is equal to the mass of the hydrometer.
High precision hydrometers that can accurately measure to the thousandth are
most suitable for commercial breweries. Before use, the hydrometer should be
clean and dry. The specific gravity is read where the bottom of the liquid meniscus
crosses the hydrometer scale, as d
emonstrated by the dashed red line in Figure 9.6.
The specific gravity of wort before fermentation is called the original
gravity (OG) or initial gravity, and the specific gravity of the wort after fer-
mentation is called the final gravity (FG). A brewer should keep daily logs of
density or specific gravity to monitor fermentation progress. Once the s pecific
gravity is stable for three days, it is considered the FG. OG and FG are used
to estimate alcohol by volume. The calculation is complicated, because the
density varies with both solids content and alcohol content. Equations in
0.990
1.000
10
20
30
40
50
60
70
80
90
Figure 9.6 Hydrometer showing specific gravity of 1.062. Source: Photo © 123rf.com.
Roger Siljander.
272 FERMENTATION
Chapter 15 relate estimated alcohol content, real degree of fermentation

(RDF), and real extract (RE) to OG and FG, but they may not be reliable
enough for labeling and taxation.
Density or specific gravity can be determined to high precision off‐line
by weighing a known volume of sample at a controlled temperature in a
pycnometer, a glass vessel that can be reproducibly filled with an exact vol-
ume. This method takes about 30 minutes in the hands of a skilled operator;
it is too slow for most beer production and has been generally abandoned
by the industry. A more rapid and advanced method involves the oscillating
density meter, or densitometer, which consists of a U‐shaped tube filled
with sample. The tube is made to vibrate and the vibrational period (time
per cycle) is measured. The vibrational period is proportional to the square
root of mass of the tube plus sample. The mass and volume of the tube are
known, so the density can be calculated. Devices based on this principle
often take the form of in‐line analyzers or of on‐line portable handheld
units (Figure 9.7).
Figure 9.7 Handheld densitometer.

Certain wort or beer parameters can affect density measurements and may
cause errors in interpretation. For example, beer must be decarbonated
before an accurate measurement can be made. Also, density is affected by
temperature, so unless temperature compensation is included in a device,
steps should be taken to ensure the sample is read at 20 °C (68 °F). Finally,
ethanol is less dense than water, so this needs to be considered for density
measurements during and after fermentation. Further discussion on the
effects of ethanol on density is given below.
Refractometer Refractive index, also called index of refraction, is the ratio

of the speed of light in a vacuum to that in the sample; it can be measured
with a device called a refractometer. When light enters a low index (fast light)
material, like a sample of beer wort, from a high index material like a glass
prism, the light bends toward the high index material. If the angle of the light
entering the low index sample is flat enough, all the light can be bent out of
the sample. The angle at which this happens is called the critical angle; it can
be used to determine the index of refraction of the sample. The refractive
index of water varies in a predictable way when sucrose is added. The higher
the sugar concentration, the slower light travels in it, so the higher the
refractive index. As with density, the presence of alcohol can introduce a
substantial discrepancy in the measurement of solids content, so much so that
a refractometer is only recommended for OE measurements. Refractometers
can be used as in‐line devices, if precautions are taken to deal with the
presence of ethanol, gases, and light scattering by undissolved solids.
Degree of Fermentation/Attenuation The fraction of the mass of pre‐

fermentation dissolved solids lost in fermentation is the real degree of
fermentation (RDF). For example, if the wort after boiling contained 100 kg of
dissolved solids and the fully fermented beer contains 35 kg of dissolved solids,
the amount fermented is 65 kg, and the RDF would be 65%. One complication
is that the mass of the beer is lower than that of the wort because some of the
sugar is converted to carbon dioxide and some to yeast, neither of which is part
of the beer. For example, suppose 1000.0 kg of wort with OE of 16 °P yields
943.8 kg of beer with RE of 5.42 °P. The mass of wort solids is 1000 kg × 0.16 =
160 kg. The mass of beer solids is 943.8 kg × 0.0542 = 51.2 kg. The RDF is given by
Mass wort solids Mass beer solids

RDF 100%
Mass wort solids
which comes to 68%. The real attenuation, which is the percentage decrease
in the concentration of dissolved solid (degrees Plato), is not the exactly the
same as the RDF. In the example above, the OE is 16 °P and the RE is 5.42 °P.
The equation below gives the real attenuation:
274 FERMENTATION
OE RE
RA 100%
OE
which comes to 66%. The difference between the RDF of 68% and the RA of
66% is not huge, but it is quite significant.
In the previous example, the RA was 5.42 °P. Although a 5.42% solution of
sucrose in pure water would have a specific gravity of 1.023, the ethanol in the
beer (ABV = 7.0%) lowers the specific gravity to 1.008. So far, we have been
dealing with straightforward reality. We now leave all of that behind and see
what happens if we were to calculate the solids content of the beer from the
specific gravity as though the ethanol were not there. The solids content cor-
responding to a specific gravity of 1.008 is 2.05%, which is called the apparent
extract (AE). The degree of fermentation based on this imaginary solids
content is 87%, called the apparent attenuation:
OE AE
AA 100%
OE
To take one more step back from reality, we can use the approximation
that the extract is approximately proportional to the specific gravity minus
one. We will call the attenuation calculated from specific gravities the approx-
imate apparent attenuation:
OG FG
AAA 100%
OG 1
Chapter 15 has more detail about the relationships among specific gravity,
solids content, alcohol content, and degree of fermentation.
There is a valid way to determine the real (not apparent) degree of fer-
mentation. Take a sample of beer and decarbonate it by stirring. Weigh the
sample or a representative portion, enough to insert a hydrometer. Boil the
sample carefully until its volume is less than two‐thirds of the volume before
boiling. Cool the sample. Add purified water to bring the mass back to its
original value. This is the water and the solids, but the alcohol has been boiled
off. Now determine the specific gravity at 20 °C and look up the solids content
on a Plato table. This is the final or real extract. Of course, this is strictly an
off‐line method.
After fermentation, how do we know if all available extract was fermented?
We need to know the attenuation limit, which is measured by a forced fer-
mentation test. A 200 mL sample of wort is taken before fermentation. The
wort is then overpitched with 15 g of fresh yeast slurry or 2 g of rehydrated dry
yeast. Using a stir bar or gentle shaking to accelerate fermentation at 20 °C,
FERMENTATION REACTIONS 275
the final gravity should be reached in 48 hours. The attenuation limit of a

given wort can be influenced by a variety of factors including yeast perfor-
mance and changes in wort fermentability due to changes in process. The
forced fermentation test is also useful when troubleshooting poor attenua-
tion. Results will help determine whether the problem comes from yeast
performance (forced fermentation test is lower than the observed FG) or

wort quality (the forced fermentation test is higher than usual due to elevated
unfermentable sugars as a result of inconsistent mashing).
9.2 FERMENTATION REACTIONS
The biological purpose of fermentation in yeast is to capture chemical energy

in the form of adenosine triphosphate (ATP) from fermentable sugar. In
contrast to respiration, fermentation uses no oxygen. The net reaction for
alcoholic fermentation is C6H12O6 + 2ADP + 2H3PO4 → 2CH3CH2OH + 2CO2
+ 2ATP + 2H2O. This reaction occurs in 12 steps, each with a specific enzyme.
The chemical details of fermentation are shown in Figure 9.8. Many of the
compounds have acid properties, so the charge and number of hydrogen
atoms depend on the pH. To make it easier to follow the reactions, we show
all acids in the acidic (with H+ bound) form, hence pyruvic acid (C3H4O3)
rather than pyruvate ion (C3H3O3−). The first ten steps are called glycolysis, or
the Embden–Meyerhof–Parnas pathway. Some form of glycolysis is carried
out in every living cell. Steps 11 and 12 are the ethanol synthesis reactions;
their biological purpose is to regenerate NAD+ from NADH. In addition to
the main products, fermentation potentially produces small quantities of
many compounds that can have a major influence on the flavor of the beer.
From the point of view of the yeast cells, the important product of fermen-
tation is ATP. All living cells need a constant supply of ATP for their life
functions. For the brewer and the drinker, the key product is ethanol, the
psychoactive ingredient in alcoholic beverages.
Each step of the glycolysis pathway is catalyzed by an enzyme, mostly
named after the reaction or its reverse. For example, reaction 12 is catalyzed
by alcohol dehydrogenase, even though the actual reaction, hydrogenation of
acetaldehyde, is the reverse. Under conditions of plenty of ethanol and NAD+,
the same enzyme would catalyze dehydrogenation instead of hydrogenation.
Eleven other enzymes are involved.
In step 1, one of the ─OH groups on a sugar (glucose is shown, but other
sugars can also serve) is condensed with a phosphate group that comes from
the hydrolysis of ATP. The hydrolysis consumes a water molecule, and the
condensation releases one.
In step 2, the glucose phosphate molecule rearranges to give fructose
phosphate. This makes the molecule more symmetric. The oxygen is in the
1 2 3
glucose glucose-6-phosphate fructose-6-phosphate fructose-1,6-diphosphate

4
2-phosphoglyceric 8 7 6 5
acid
3-phosphoglyceric acid 3-phosphoglyceroyl glyceraldehyde-3- dihydroxyacetone

9 phosphate phosphate phosphate
10 11 12
phosphoenol pyruvic acid acetaldehyde ethanol

pyruvate
Figure 9.8 Glycolysis and ethanol synthesis.
276
FERMENTATION REACTIONS 277
middle of the five‐member ring, and a one‐carbon side chain hangs off the
ring on each side of the ring oxygen.
Step 3 is similar to step 1. Another ─OH group is phosphorylated by ATP
on the corresponding carbon to the right of the ring oxygen. Fructose diphos-
phate (sometimes called fructose bisphosphate) is essentially identical across
a line going through the ring oxygen and cutting through the bond opposite
it. This is where the molecules will come apart. Up to this point, far from
making ATP, the pathway has used up two molecules of ATP.
In step 4, the molecule breaks down the middle, leaving two 3‐carbon frag-
ments, each with one ─OH group, one phosphate group, and one carbonyl
(C═O) group. Two bonds are broken, and two bonds are made; the bonds
made are the second bonds in the C═O double bonds. The two products are
sugar phosphates, but one is an aldose (C═O on an end carbon) and the other
is a ketose (C═O on the middle carbon).
In step 5, the two sugar phosphates interconvert. Because step 6 uses
only the aldose, the net effect is to convert the ketose (dihydroxyacetone
phosphate) to the aldose (glyceraldehyde phosphate). From this point on,
we will follow only one of the two molecules produced in step 4, but keep in
mind that each glucose molecule gives rise to two of the molecules shown.
Step 6 is an oxidation reaction in which one of the hydrogen atoms on
phosphoric acid (H3PO4) and one on the end carbon of the aldose react with
NAD+ to give NADH and a hydrogen ion. The resulting compound, phospho-
glyceroyl phosphate, is an anhydride, that is, a condensation compound of two
acids. Figure 9.9 shows that if we were to hydrolyze off the top phosphate, the
products would be phosphoric acid and a compound with a ─COOH group
(highlighted), a carboxylic acid called 3‐phosphoglyceric acid.
In step 7, adenosine diphosphate (ADP) is phosphorylated to ATP by
phosphoglyceroyl phosphate. This is an ATP payoff step. Because it happens
twice for each glucose molecule that originally reacted, the ATP molecules
consumed in steps 1 and 3 are replaced.
In step 8, the phosphate migrates from the end to the middle carbon atom
of the three‐carbon chain. This prepares the way for the production of a high‐
energy compound in step 9.
Figure 9.9 Hydration of phosphoglyceroyl phosphate.

278 FERMENTATION
Figure 9.10 Formation of pyruvic acid.
In step 9, water is eliminated to give phosphoenol pyruvate, a high‐energy

compound.
Step 10 is the phosphorylation of a second ADP to give ATP. We can
understand this reaction as a combination of two reactions. The phosphate
group is hydrolyzed, leaving an ─OH group. A compound with an ─OH
group on a carbon that has a double bond is an enol (EEN‐all). Enols are
usually unstable; the ─OH hydrogen shifts to the other end of the double
bond, and the second bond in C═C shifts to form a C═O double bond, giving
pyruvic acid as shown in Figure 9.10.
This completes the glycolysis process proper. Two ATPs were hydrolyzed
to ADP (one per 3‐carbon unit) and four ADPs were condensed to ATP (two
per 3‐carbon unit). The net production of ATP is two molecules per molecule
of glucose. During glycolysis, two molecules of NAD+ per glucose were
reduced to NADH in step 6. The process cannot continue unless the NAD+ is
regenerated. The next two steps, which are the ethanol synthesis reactions,
regenerate the NAD+.
Step 11 releases carbon dioxide to give acetaldehyde. In step 12, NADH
reduces acetaldehyde to ethanol, an essential component of alcoholic bever-
ages. This regenerates the NAD+ that was consumed in step 6.
9.3 ENERGY AND ATP
Energy
Energy can be modeled as an imaginary fluid that enters a system to perform
a non‐spontaneous function and then exits when the system does something
spontaneous. A key feature is that energy is not created or destroyed, but it
can be degraded by being converted into a less usable form. One way to store
energy for use in electrical systems is to use electrical energy to pump water
to a high reservoir. When more electricity is needed, the water, pulled by
gravity, is released through a turbine that generates electricity. The water in
the high reservoir has potential energy by virtue of its position. It has less
potential energy at the bottom of the turbine race, but some of the decreased
energy was transferred to the turbine and then to the electrical grid. The fall-
ing of the water is spontaneous. It is coupled through the electrical grid to
non‐spontaneous processes like pumping beer. None of these transfers are
perfect; some of the energy is cast off as waste heat.
ENERGY AND ATP 279
Every living yeast cell constantly uses energy. When a compound is made that
has more energy within its molecules than the starting materials, energy must be
supplied. Energy is used to drive reactions that otherwise would go in the reverse
direction and to move materials in the direction opposite to the direction that
they would otherwise flow. In a mechanical system, we might store energy in a
spring. We can recover the energy by having the spring do work as it relaxes to
its unstressed position. Energy can be stored in chemical compounds in a similar
way, but the underlying mechanism is the interactions of charged bodies. If we
use energy to drive like charges together or pull unlike charges apart, that energy
can be recovered by letting the charges return to their normal positions. In the
case of yeast cells during fermentation, this energy is provided by the break-
down of sugar in the glycolysis reaction. Many chemical reactions are accompa-
nied by release of energy. If nothing is done to capture and channel the energy,
the energy will be released to the surroundings as heat. To use the energy to
drive a desired process, we need to couple it to some device like a turbine, or a
spring, or an electrochemical cell. In living cells, the coupling is done by ener-
getic molecules. The energetic molecules quickly release their energy to support
the life processes of the yeast. Ultimately, all the energy released by the fermen-
tation process is degraded to heat. If all of this energy were trapped in the fer-
mentation vessel, the temperature would increase beyond acceptable limits. For
this reason, cooling must be provided to control the temperature of fermenta-
tion vessels, and specifically the yeast slurry, as will be discussed in Section 9.6.
ATP
In most sequences, the molecule that connects the process that releases
energy and the one that uses energy is adenosine triphosphate, ATP. The
hydrolysis reaction of ATP to ADP is shown in Figure 9.11. This reaction
releases energy in a way that can be coupled to drive a non‐spontaneous pro-
cess. Often the phosphoric acid (PA) gets attached to another molecule, as in
Figure 9.8, reactions 1 and 3. When energy is available, it can be used to con-
dense ADP and phosphoric acid to make ATP. ATP is highly energetic and
unstable. ATP that is not immediately needed is used to make intermediate
storage compounds that last longer, like sugar or starch.
Figure 9.11 ATP hydrolysis.

280 FERMENTATION
9.4 OXIDATION, REDUCTION, AND NAD
Reactions involving the gain or loss of electrons by atoms are called oxida-
tion–reduction reactions. The atom that loses electrons is said to be oxidized,
and the one that gains electrons is reduced. Often the molecules whose atoms
are oxidized or reduced are themselves said to have been oxidized or reduced,
as long as oxidation and reduction occur on different molecules. If an atom is
oxidized, another atom must be reduced; the total number of electrons does
not change. A reaction that is sometimes used to remove iron from brewing
water is 2Fe2+ + Cl2 → 2Fe3+ + 2Cl−. It is easy to see that each Fe2+ ion loses an
electron and each chlorine atom gains an electron.
There are many important reactions in which it is not so easy to follow the
loss and gain of electrons. To deal with these cases, we use a system of allocat-
ing electrons called oxidation numbers. The oxidation number is a fictive
charge that an atom would have if all unshared electrons were assigned to
that atom and all shared electrons were assigned to the more electronegative
atom sharing them. The sum of the oxidation numbers on all atoms in an ion
or molecule adds up to the charge on that ion or molecule, so for the reaction
above, the oxidation numbers are +2 for Fe2+, zero for each chlorine atom in
Cl2, +3 for Fe3+, and −1 for Cl−. For more complicated cases, we need a process
for determining the oxidation number. We will apply this process to ethanol
step by step. The first step is to draw the Lewis structure showing all valence
electrons, shared and unshared, as dots, as shown in Figure 9.12A. The elec-
tronegativities of the atoms involved can be found in Figure 2.3: H = 2.2;
C = 2.6; O = 3.4. Next, starting with the most electronegative atom, oxygen in
this case, draw a circle around each atom that allocates all unshared electrons
to the atom and the shared electrons to the more electronegative atom of the
bond. If there is a bond between two atoms of the same electronegativity,
allocate half of them to each atom. Do the same for the remaining atoms, in
order of decreasing electronegativity until all valence electrons have been
allocated. Ethanol has a total of 20 valence electrons, as shown in Figure 9.12A.
Figure 9.12B shows the electron allocation for oxidation numbers. The oxy-
gen atom gets its two nonbonding pairs, both electrons in the bond with
carbon, and both electrons in the bond with the hydrogen for a total alloca-
tion of eight electrons. The carbon atom on the right gets neither of the two
H H H H
H C C O H H C C O H
H H H H
(A) (B)
Figure 9.12 Electron allocation. (A) Ethanol, Lewis dot diagram. (B) Ethanol with
electron allocations.
OXIDATION, REDUCTION, AND NAD 281
electrons in the bond with oxygen, all four of the electrons in the bonds with
the two hydrogens, and one of the two electrons in the bond with the carbon
on the left for a total allocation of five electrons. The carbon on the left gets
the remaining seven electrons.
To determine the oxidation number for each atom, subtract the number of
electrons allocated from the periodic table main group number. For the six
hydrogens, 1 − 0 = +1. For the carbon on the left, 4 − 7 = −3. For the carbon on
the right, 4 − 5 = −1. For the oxygen, 6 − 8 = −2. The sum of the oxidation
numbers is (6 × +1) − 3 − 1 − 2 = 0; ethanol is uncharged. The allocation for
acetaldehyde is shown in Figure 9.13.
In acetaldehyde, the oxidation numbers are the same as in ethanol except
for the right carbon, which has an oxidation number of 4 − 3 = +1. In the
alcohol synthesis reaction (step 12 in Figure 9.8), the reactant (starting
material) is acetaldehyde, and the product is ethanol. The oxidation number
of the corresponding carbon atom goes from +1 to −1 in the course of the
reaction. Acetaldehyde is reduced by two electrons. The electrons to reduce
the acetaldehyde come from a complicated molecule called nicotinamide
adenosine dinucleotide (NAD), which exists in two forms, NADH and
NAD+. Figure 9.14 shows NADH being oxidized to NAD+. The electrons
released by this reaction reduce another molecule, acetaldehyde in this
case. NAD is a cofactor in many cell processes involving oxidation or reduc-
tion. The part of the molecule that releases or accepts electrons is the nitro-
gen‐containing nicotinamide ring shown at the top of Figure 9.14 with
oxidation numbers highlighted. Figure 9.15 shows the electron allocations
from which the oxidation numbers were calculated. The circles are color‐
coded according to the number of allocated electrons. Oxidation numbers
of two of the carbon atoms in this ring change under oxidation. The carbon
atom opposite the nitrogen goes from oxidation number = −2 in NADH to
oxidation number = −1 in NAD+. The carbon atom to the right of the nitro-
gen goes from oxidation number = 0 to oxidation number = +1. The net
change in oxidation number is +2; two electrons are released. Acetaldehyde
gains these two electrons in converting to ethanol. In alcoholic fermenta-
tion, the purpose of the alcohol synthesis reaction is to oxidize NADH to
regenerate NAD+, which is needed for the oxidation reaction in step 6 of
Figure 9.8 as well as for other cell processes. If oxygen were involved,
NADH would be oxidized in a different pathway in which the electrons are
ultimately taken up by oxygen and additional ATP is generated.
H
H C C H
H O
Figure 9.13 Electron allocation for acetaldehyde.

282 FERMENTATION
–2 –1 –1
–1 0 0
0 +1
0 –3 0 –3
+
Figure 9.14 NADH oxidation to NAD+. Oxidation numbers highlighted.
H H H
H C C H C C
C C C C
HC C
H H C C
H
N N
C C
+
NADH NAD
Figure 9.15 Electron allocation in NADH and NAD+.
9.5 FERMENTATION EQUIPMENT
Beer is generally classified as either ale, which is fermented at 18–22 °C (64–

72 °F), or as lager, which is fermented at 8–15 °C (46–59 °F). Most ale is
fermented with a species of yeast called Saccharomyces cerevisiae, which
tends to rise to the top with CO2 bubbles during fermentation. Lager beer is
fermented with Saccharomyces pastorianus (formerly called Saccharomyces
carlsbergensis) yeast, which sinks to the bottom. Eventually all yeast sinks,
but some ale fermenters take advantage of the rising tendency of ale yeast.
After wort is prepared, chilled, and oxygenated in the brewhouse, it is pumped
into a fermentation vessel, or fermenter. Fermenters have been made in a
range of sizes, shapes, and materials. Commercial fermenters are usually in
the range of 1200 L (12 hL = 10 US bbl)) to 600 000 L (6000 hL = 5100 bbl).
They are usually made of stainless steel. Fermenters larger than about 2000 hL
FERMENTATION EQUIPMENT 283
must be made on‐site, which adds to their cost. The major objectives of the
fermenter are as follows:
• Safely vent carbon dioxide produced by fermentation.

• Protect the beer from contamination by unwanted microbes.
• Carry away heat generated by the fermentation process.
• Allow the yeast to be recovered from the beer.
Once yeast is added to the wort, the mixture is regarded as fermenting

beer. When fermentation is complete, the beer may require additional condi-
tioning for maturation or carbonation. Beer should always be free from
microbiological contamination, which would prevent the collection and reuse
of yeast in subsequent fermentations.
Cylindroconical Fermenters
The most popular fermenter configuration is the jacketed stainless steel
cylindroconical vessel (CCV), shown in Figure 9.16. The upper part of the
vessel is cylindrical, and the lower part forms a cone, usually with sides slop-
ing about 60° from horizontal. A cooling jacket surrounds parts of the vessel
to carry away the heat generated by fermentation. In some systems there are
two or three independently controlled jackets, usually one for the cone and
one or two for the cylinder. It is highly recommended that for CCVs larger
than 10 hL, a dedicated jacket for the cone, distinct from the jacket for the
cylinder, be used to more precisely control the heat generated by yeast during
fermentation. This concept is further discussed in Section 9.6.
The wort and yeast are typically added to a CCV through a fill/empty line.
This line connects to an inner racking arm that is placed above the expected
level of the yeast, allowing the beer to be collected without disturbing the
yeast. Often the racking arm is configured in an “L” shape, allowing rotation
of the arm. In some systems this pipe enters from the bottom port. On the
top of the fermenter is a vent pipe that allows the carbon dioxide to escape,
as well as plumbing for a CIP system. At the bottom of the cone is a valve
that is used to collect yeast or to drain the tank during cleaning. The zwickel
is a port to provide samples for quality measurement. Figure 9.16 is simpli-
fied. In working systems all lines are connected to the CIP system. There are
sensors in the fermenter and in its jacket to monitor temperature, pressure,
and possibly specific gravity or some other indication of the progress of
fermentation.
An often overlooked but essential component of CCVs and other closed
vessels is a pressure relief valve (PRV). Pressure relief valves are typically
connected to the top of a fermenter through a tri‐clamp connection. Pressure
284 FERMENTATION
CIP inlet
relief
valve
coolant out
cooling jacket
vent
manway
blow-off coolant in
hose
zwikel
coolant out
fill/empty
cooling jacket
Coolant in
drain
collect yeast
Figure 9.16 Cylindroconical fermenter.
changes are frequent in a CCV, and if pressure changes in a closed vessel, the
tank may implode, damaging the tank, or explode, an extreme safety risk.
Pressure relief valves for fermenters must be able to vent in either direction.
The pressure relief valve prevents vacuum failure by allowing air to enter the
tank if the tank pressure gets too low or for gases to escape from the tank if
excessive pressure builds up. It is important that pressure relief valves be reg-
ularly inspected and subject to CIP cleaning, as clogged or damaged pressure
relief valves may result in failure. Fermenter pressure relief valves are nor-
mally mounted at the top of the fermenter where they can only be reached by
a ladder. They are bulky and heavy. If provision to make servicing them safer
and more convenient can be built into the fermenter design, they are more
likely to get regular inspection and maintenance.
FERMENTATION EQUIPMENT 285
Vacuum in a CCV only occurs when the tank is unvented, resulting in a

closed system where valves were either mistakenly closed or blocked. The
reduction in pressure may result from one of the following scenarios:
• Pumping or draining liquid from the tank.

• A hot CIP step followed by a cold rinse.
• A caustic (NaOH) wash after fermentation without removing the carbon
dioxide. The carbon dioxide reacts according to NaOH + CO2 → NaHCO3.
If the tank is sealed, this reaction can remove gas, leaving a vacuum.
Pressures less than 0.2 bar below atmosphere (0.8 bar absolute = 3 psi of
vacuum) can crush a fermenter. Even if the tank is not sealed, the loss of
caustic to this reaction will interfere with CIP effectiveness.
After fermentation, the yeast sediments and falls into the cone. This allows
the yeast to be harvested with minimal loss of salable beer. Because the sys-
tem is closed, the risk of contamination of the beer or the yeast is minimized.
Independently controlled cooling jackets allow the temperature to be made
cooler on top to promote mixing by convection or cooler on the bottom to
promote sedimentation of the yeast. The uncluttered interior of the CCV
makes cleaning and sanitation with standard CIP equipment easy and inex-
pensive. For best sanitation, the interior surfaces should have a smooth finish,
especially the cone area.
Open Fermenters
There are still breweries that use open vats, especially for fermentation of ale.
The ale yeast and resulting carbon dioxide form a layer on top of the beer,
providing some protection from contamination. In some open fermenters
there is a provision to collect some of the yeast during fermentation for use in
subsequent batches. The Yorkshire square‐style open fermenter, shown in
Figure 9.17, has two chambers separated by a deck. The deck has an opening
called the manhole for the yeast and one or more tubes, called organ pipes,
that extend to near the bottom of the lower chamber to carry beer down.
Often there is a pump to recirculate beer from the lower chamber to the upper
chamber to rouse (stir) the yeast. Temperature control is maintained by a cool-
ing jacket or by coolant pipes in the lower chamber. The vessel is filled until
the lower chamber is full, and the upper chamber has a few centimeters (1 in)
of beer. During fermentation, ale yeast rises through the manhole and collects
in the upper chamber. Beer returns through the organ pipes. Near the end of
fermentation, the yeast in the upper chamber is collected. Yorkshire squares
are still used in the British Isles to make traditional ales, although some of
them are actually circular rather than square to facilitate cleaning.
286 FERMENTATION
yeast
manhole
jacket
organ pipe beer
Figure 9.17 Yorkshire square fermenter.
There are several disadvantages to open fermentation. Onerous precau-

tions, including special ventilation, are needed to minimize the risk of con-
tamination by unwanted microbes. Many systems are difficult to clean and
sanitize. The depth of the fermenter is limited to around 2 m (80 in.). Beer
losses are greater than in cylindroconical fermenters, especially in the solids
that sink to the bottom. Carbon dioxide from fermentation is vented directly
into the fermentation room with no provision for recovery or control.
Nonetheless, brewers who use open fermentation credit it with providing
unique flavors.
Fermentation Cooling Requirement

Alcoholic fermentation releases about 560 kJ of heat per kilogram of sugar
fermented (240 BTU/lb). This comes to about 5.6 kJ/°P/L. At a maximum ale
fermentation rate of 0.33 °P/h, the cooling output power would be about
50 W/hL. This is the rate at which heat must be transferred through the walls
of the fermenter to the cooling jacket and hence to the refrigeration system.
Lager beer ferments slower, so it requires less cooling power.
Some methods of brewing require that the beer be quickly chilled from the
final fermentation temperature to around 0 °C, a process called cold crashing.
Cold crashing causes yeast to flocculate and fall to the bottom of the fer-
menter. Although crashing is part of conditioning rather than fermentation,
TEMPERATURE MONITORING AND CONTROL 287
we consider its cooling needs here, because it affects the design of the fer-
mentation system. To crash 1 hL of beer from 18 to 0 °C in 12 hours requires
175 W of cooling power, not counting the cooling required for the fermenter
vessel, its jackets, the coolant, and the cooling lines. This dwarfs the cooling
requirement for fermentation temperature control; it must be considered in
the initial design.
9.6 TEMPERATURE MONITORING AND CONTROL
Temperature
Temperature is the most important fermentation variable. At warmer fermen-
tation temperatures, more fusel alcohols and esters are produced, affecting the
character of the beer. Low temperatures can make the yeast sediment prema-
turely, stalling fermentation before all sugar is consumed. Temperature is usu-
ally controlled with a cooling loop, shown in Figure 9.18. Chilled coolant is
pumped from a refrigeration unit, around a closed loop, through the cooling
jackets and other items to be cooled, before returning to the chiller. Solenoid
or air‐actuated valves direct coolant through the fermenter cooling jacket or
coil or block it if the temperature is low enough. The valves are opened and
closed by signals from a temperature controller connected to sensors in the
fermenters. A bypass valve opens when the pressure in the coolant inlet line
exceeds a preset value, giving a return path for coolant when the cooling
requirement is low and protecting the equipment from excessive pressure.
In most breweries, the coolant is a mixture of propylene glycol (PG) and
water informally called “glycol.” It is essential that the PG is food grade. The
PG concentration is adjusted to give a mixture whose freezing point is lower
SV SV SV
coolant
BV
coolant return
Figure 9.18 Cooling loop. SV, solenoid or air actuated valve. BV, bypass valve.
288 FERMENTATION
TABLE 9.4 Propylene Glycol Solution Freezing Points

Freezing Point
Specific
PG Mass % °C °F Gravity
0 0 32 1.000
10 −3 26 1.008
20 −8 18 1.017
30 −14 7 1.026
40 −22 −8 1.034
50 −34 −29 1.041
Source: Adapted from EngineeringToolbox.com
than any temperature encountered in the system. This is a good deal lower
than the lowest process set point; the coolant must be colder than the
fermenter temperature, and allowance must be made for some temperature
rise in the lines. Freezing points and specific gravities (useful for checking the
PG concentration) are given in Table 9.4. PG is not a refrigerant; it is a sec-
ondary coolant that must give up its heat to a refrigeration system. Efficiency
is lost in the exchange. PG is not as good a heat transfer medium as water, so
too high a concentration will detract from cooling performance. The PG
concentration should be high enough to give a freezing point well below the
lowest temperature encountered by the coolant to avoid formation of slush.
There are some common considerations when designing and installing
coolant lines:
• Place your chiller as close to the vessels as possible to minimize restric-

tion in the coolant piping.
• Ensure proper sizing of your coolant lines to avoid excessive flow resistance.
• Use the “first in/last out” method for connecting your CCVs. From your
coolant supply, the first tank to be supplied coolant should be the last
tank to enter the return line, as demonstrated in Figure 9.18.
• Place pressure and temperature gauges in coolant supply lines where
they can be easily read. This will allow you to better catch cooling system
or pressure problems.
• Each CCV should have a dedicated sensor to measure product tempera-
ture and a dedicated coolant valve to control the supply of coolant. A
manual control valve bypassing the solenoid or air‐actuated valve is highly
recommended to allow coolant to be supplied in case of solenoid failure.
• If you may be adding vessels to be cooled, like additional fermenters,
install an expandable coolant loop after the last CCV, as shown in
Figure 9.19. This simple solution allows more CCVs to be added in the
future without interrupting cooling to the existing units.
coolant
return
Figure 9.19 Expandable coolant loop.
Refrigeration
Breweries usually have a central refrigeration unit, also called a chiller or
primary coolant system that provides cooling to the wort chiller, fermenters,
conditioning tanks, and sometimes the beer storage and serving areas. The job
of the primary coolant system is to extract heat at low temperature and
release the heat to a higher temperature. Heat moves spontaneously from
high to low temperature, so the non‐spontaneous process must be coupled to
a spontaneous process, normally the burning of fuel at the electrical power
station.
Refrigerators in breweries almost always operate with a liquid–vapor
cycle, shown in Figure 9.20. The refrigerant is a working fluid that can exist
in the liquid and vapor state in the range of pressure and temperature
required by the unit. The fluid absorbs heat when it vaporizes and releases
heat when it condenses. Warm vapor at low pressure enters the compressor.
The compressor is driven by a motor, doing work on (putting energy into)
the fluid, increasing its pressure and temperature. The hot compressed fluid
passes through a heat exchanger called the condenser, where it releases heat
either to the atmosphere or to cooling water. The condenser coils get hot;
they are often placed outdoors. The cooled vapor, still at high pressure, con-
denses to liquid, releasing more heat. The high‐pressure liquid passes through
an expansion valve, where the pressure is lowered, causing some of liquid to
vaporize, absorbing heat, and going to lower temperature. The low‐pressure
liquid–vapor mixture passes through a heat exchanger called the evaporator.
The liquid–vapor mixture continues to vaporize and to absorb heat from
whatever is to be chilled. Then it enters the compressor to start the cycle
290 FERMENTATION
motor
vapor hot vapor

compressor
evaporator
condenser
heat in heat out
liq + vap liquid

expansion valve
Figure 9.20 Refrigerator.
again. The heat released by the system is equal to the heat absorbed by the
evaporator plus the energy provided by the compressor motor, plus any
waste heat, including the heat released by the motor. Because of the large
amount of heat released, it can be advantageous to locate the primary cool-
ant system outside the brewery. It is easy to forget about the refrigeration
unit. It often operates out of doors and out of sight. But when it breaks, the
brewery cannot make beer. Beer in process may even be ruined. Monthly
maintenance is recommended.
Smaller breweries usually use indirect cooling, provided by a secondary
coolant system. The primary coolant system cools a coolant, often water
and propylene glycol, that is pumped around to provide cooling to the
equipment in the brewery. This is convenient; the brewers do not have to
deal with refrigerant plumbing, but it is not efficient, as energy transfer
between the systems is not perfect. Some large breweries use direct refrig-
eration in which the refrigerant itself, rather than a coolant, flows through
the cooling lines.
Refrigerants are classed as CFCs (containing carbon, fluorine, and chlo-
rine), HCFCs (also including hydrogen), HFCs (hydrogen, fluorine, and
carbon), hydrocarbons, ammonia, carbon dioxide, and some others. The
CFCs are nontoxic, are essentially non‐flammable, and have good refrigera-
tion properties, but are now banned because they deplete the ozone layer
and have a high potential for global warming. Replacements vary in their
desirability as refrigerants. For example, ammonia has good refrigerant
properties, but it is toxic and flammable. It is used in large systems, includ-
ing some in breweries. Common refrigerants in primary coolant systems
include R‐404A (HFC blend), R‐134A (HFC), R‐401A (HCFC), and R‐717
(ammonia).
Temperature Control
Temperature is regulated by a system of temperature sensors, heaters, or, in
this case, coolers and a temperature controller to control the application of
heating or cooling in response to the measurement at the sensor. The simplest
control system is the on–off controller. When the temperature is too high,
cooling is applied. When the temperature is too low, cooling is turned off
(same concepts apply to heating, but in reverse). On–off control is not usually
very precise; the process temperature tends to overshoot on heat‐up and
undershoot on cool‐down. A more sophisticated control scheme is propor-
tional control. When the temperature is within a proportional band, the cool-
ing power increases with temperature. Because the cooling power is less as
the temperature reaches and goes below the set point (desired temperature),
undershoot and overshoot are less; control is better. The proportional integral
(PI) and proportional integral differential (PID) control add additional l ayers
of sophistication to the control scheme.
Adjusting cooling or heating power is usually a matter of cycling between
zero power and full power. For example, if 30% cooling power is needed, the
solenoid valve on the coolant line would be open 30% of the time and closed
70%. This is usually easier to manage than devising a system to open and
close the valves partway.
Temperature Sensors The resistance temperature detector (RTD) is a

metal, usually platinum, resister whose resistance increases as temperature
increases. The metal takes the form of a fine wire or a thin film. Platinum
RTDs are rugged and have a linear response (a graph of resistance against
temperature is a straight line) and a wide temperature range. They are
manufactured to recognized standards, making them interchangeable (for
units that follow the standard). The sensor element is relativity bulky, making
RTDs difficult to use for small samples, like well plates or Petri dishes.
Platinum RTDs can be used up to 960 °C (1760 °F).
The thermistor is a ceramic or polymer whose resistance (usually) decreases
as temperature increases. Thermistors can be made very small. In most parts of
the temperature range, they have a greater resistance change with tempera-
ture than an RTD. The biggest disadvantage is that the change in resistance is
not at all linear with temperature. Another disadvantage is that their construc-
tion is not fully standardized, complicating matching and interchange. The
thermistor material is fragile; it must be packaged for protection. The tem-
perature range for a thermistor is limited, typically up to 130 °C (266 °F).
A thermocouple is a junction of dissimilar metals, typically in the form of
two wires spot‐welded together. The thermocouple produces an electrical
potential in the range of tens of microvolts per degree celcius. Standardized
pairs of alloys are used in various temperature ranges. The thermocouple
292 FERMENTATION
j unction can be made quite small. The thermocouple pairs that are most often
used in breweries are iron/copper‐nickel (iron/constantan, Type J) and nickel‐
chromium/nickel‐aluminum‐manganese‐silicon (chromel/alumel, Type K).
Type J gives a larger output, but the iron wire is subject to corrosion. In the
brewery temperature range of −5 to 120 °C (23–248 °F), the copper/copper‐
nickel ( copper/constantan, Type T) gives the best measurement performance.
One complication of thermocouples is the reference junction. At some
point in the circuit, the thermocouple wires must be attached to ordinary con-
ductors. This is called the reference junction; the reference junction is actually
two junctions. In Figure 9.21 the two thermocouple alloys are A and B. They
join at the measuring junction, which is situated at the point where the tem-
perature is to be measured. The connections between the A wire and the B
wire to copper wires are the reference junctions. The voltage output is based
on the temperature difference between the measuring junction and the refer-
ence junction. Standard calibrations assume a reference junction at 0 °C.
Maintaining zero‐degree reference junctions is not usually convenient, so
correction circuits called reference junction compensators are usually used.
Although a thermocouple does not require power, the reference junction
compensator does. A type K thermocouple can measure to 1260 °C (2300 °F).
A silicon bandgap sensor is a semiconductor diode used as a temperature
sensor. When current flows in the forward direction, there is a voltage across the
diode that is directly proportional to the absolute (Kelvin) temperature. At
25 °C (298 K) the voltage is about 600–700 mV, so the sensitivity is about 2 mV/°C
with high linearity. Silicon bandgap sensors, also called p–n or diode sensors, are
not yet in regular temperature control use, but they have advantages for measur-
ing low to moderate temperatures that may soon become decisive.
copper to controller
A B
measuring reference
junction junction
Figure 9.21 Thermocouple circuit.

YEAST HANDLING AND REPITCHING 293
9.7 YEAST HANDLING AND REPITCHING
It can be highly cost effective to reuse yeast from one fermentation into
another. Repitching, historically called backslopping, is the process of adding
yeast collected after fermentation is complete to another fermenter filled
with fresh wort. As discussed previously, the standard pitching rate is 1 × 106
viable cells/mL/°P. Collecting yeast from a fermenter is called cropping.
Transferring Yeast for Reuse

There are several mechanisms for transferring yeast from one fermenter to
another depending on the capabilities of the brewery. Some brewers may
simply crop the yeast into a bucket from the racking arm or the drawoff port
on the bottom of the cone. The yeast is then poured into a second fermenter
through the manway. While this method allows easy access to the yeast for
sampling, it is never a recommended procedure because of the risk of con-
tamination. This method can be improved by using a yeast brink.
A simple yeast brink can be made from a modified half‐barrel keg with a
tri‐clamp port on the top and on the side near the bottom of the keg. A half‐
barrel brink can hold about 45 L (12 US gal) of slurry, which is typically
enough yeast to pitch 25–30 hL (20–25 US barrels) of wort. Each tri‐clamp
should be outfitted with valves for controlled transfer. Yeast is added or
removed through a transfer arm on the bottom port. Sanitary transfer from
brink to fermenter is controlled by applying pressure to the top of the brink.
It is essential that each brink be equipped with a pressure relief valve to pre-
vent hazardous pressure buildup. The use of a brink permits easy homogeni-
zation of the slurry, easy access for sampling, and easy transportation around
the brewery.
Yeast quality will quickly plummet after storage in a brink. For this reason,
harvested yeast should always be stored cold and for no more than 72 hours
before use. While good viability may persist longer than 72 hours, glycogen
storage reserves quickly decline, leading to long‐term vitality issues. A simple
quality check of stored yeast slurry is checking the pH of the barm beer. As
yeast quality declines, the pH increases. Yeast slurry with a pH greater than
4.9 should be discarded.
Another practice for yeast cropping is cone‐to‐cone transfer. Here the yeast
slurry is pushed from one fermenter cone to another through a transfer hose.
Movement may be facilitated by gravity, pumping, or pressure on the supplying
cone. This method is only recommended when precise volumes can be meas-
ured via an in‐line flow meter or by measurement of weight by load cells on the
fermenters.Accurate mass flow meters mounted on skids (ABER Instruments®)
are also suitable. Mass of slurry can be correlated with cell count in the lab to
more accurately estimate cell count. Integrating measurement with pump
294 FERMENTATION
c ontrol permits exclusion of yeast with solids content that is too high (trub) or
too low (end of slurry). The low‐solids slurry can be redirected to the next stage
of processing. The disadvantage of cone‐to‐cone transfer for small breweries is
the management of yeast strains and time; there must be a tight schedule
between the end of one fermentation and the start of another.
Not all yeast can be reused for all beers. As a significant amount of barm
beer will carry over into the subsequent fermentation, yeast should only be
reused for similar beer styles. For example, it is not advised to reuse an English
ale strain from a porter in a fresh batch of an English pale ale. The porter
barm beer will contribute flavor and color changes to the no‐longer pale ale.
As another example, it may not be possible to harvest yeast from an IPA with
significant hop additions in the fermenter because the yeast would be mixed
with copious amounts of hops. Yeast that has been exposed to high alcohol or
high specific gravity is in poor condition because of ethanol toxicity or
osmotic stress. Such yeast is not suitable for repitching.
When repitching, yeast should be transferred to the fermenter after a por-
tion of the wort is added. This process facilitates mixing. For example, 5 hL of
wort is transferred to a 30 hL fermenter, and then the yeast is pitched. The rest
of the wort is then added, resuspending and rousing the yeast.
After the yeast is pitched and after all the wort is added to the fermenter,
the yeast should be counted to ensure consistency in pitch rate. Total yeast in
suspension may be counted immediately after filling. Another approach is to
wait two to four hours before sampling to permit the trub, hop resins, and
dead yeast to settle before counting the yeast in suspension. Either approach
is sufficient, but the same method should be used consistently.
Cropping Yeast Heterogeneity

Not all yeast is created equal in the cone. Because large, more dense particles
will settle first, the first material to settle after filling a fermenter is the trub.
Trub is darker than yeast; a sight glass clamped in place between the fer-
menter’s transfer port and a T‐pipe fitting with valves at either downstream
port in the transfer line, as illustrated in Figure 9.22, allows the trub to be
dumped before the yeast is transferred. The valves can be used to direct beer
to a hose routed to a drain or collection tank for trub or to another hose to
the next process point for the yeast slurry. The sight glass provides manual
identification of the trub, which is a lumpy, dark brown material, as compared
with the yeast slurry, which is a creamy off‐white color. When pulling yeast
from the cone, flow rate is important. If the rate is too high, channeling will
occur, resulting in a loss of yield as a significant amount of slurry remains on
the fermenter cone walls. Any yeast left behind in unfiltered beer may lead to
flavors attributed to autolysis. In addition, high velocities create mechanical
stress on the yeast due to turbulence and shear forces. It is recommended that
to fermenter
tri-clamp sight glass valve
to brink
or waste
Figure 9.22 Transfer of yeast slurry from cone‐to‐cone is facilitated by a sight glass
and a T‐pipe fitting with valves.
the fluid velocity not exceed 1 m/s (3.3 ft/s) for yeast transfer. An even flow
rate to avoid channeling is also important to ensure consistency in the yeast
crop. There can be heterogeneity in yeast quality depending on the depth in
the cone. Not surprisingly, slurry density and yeast cell number are highest at
the bottom of the cone. It is interesting that alcohol percentage has also been
found to be highest at the bottom. Heterogeneity in the fermenter cone sug-
gests that yeast cropping practices should be standardized within the brewery
to get yeast from the same level each time yeast is cropped.
What is the best time to crop yeast during fermentation? Yeast cropping
after cold crashing is a common method for yeast harvesting, because cold
conditioning increases flocculation and settling of yeast in suspension.
Cropping at this step maximizes yeast yield, but it has the potential drawback
of lower viability. Cold conditioning introduces thermal stress on the yeast
and has been shown to reduce viability by about 8%. For this reason, if
enough yeast for subsequent brews can be cropped after terminal gravity and
before cold crashing, this is an ideal time. Yeast held in the fermenter cone for
more than two days should be discarded rather than cropped to prevent off‐
flavors from autolysis.
Drauflassen or “Topping Up”

Drauflassen is a German brewing term for the process of “topping up” or
adding wort to an already fermenting tank. Brewers may not produce enough
yeast for a fermentation due to propagation or production limitations. This is
also a common practice in brewing operations where fermenter capacity is
larger than the brewhouse size. When topping up a fermenter, it is important
to initially fill the tank with cooled, oxygenated wort as normal. A standard
296 FERMENTATION
pitching rate should also be used. Then after approximately 24 hours or dur-
ing low krausen, an equal volume of cooled, oxygenated wort is added. Such
addition maintains the low krausen and will continue to promote cellular
growth as needed for the fermentation. It is essential that the second wort
addition be oxygenated to support yeast growth. It is also essential that the
wort temperature is the same as the fermentation temperature to prevent
temperature shock to the yeast.
Stratification
The practice of topping up a fermentation may lead to a condition called
stratification. Two layers of liquid, the low krausen fermenting beer and the
freshly added wort, do not mix; they form distinct separated zones, each with
its own temperature and composition. Separation occurs because of differ-
ences in density as a result of different sugar and ethanol concentrations in
the two zones. In this scenario, the dense, sugary freshly added wort enters at
the bottom, while the partly fermented low‐density beer is pushed to the top.
Stratification causes problems in flavor and consistency.
Stratification is noted as a sudden temperature drop measured in the lower
zone when the two zones mix. A model observation that might indicate strati-
fication is shown in Figure 9.23. The temperature drop was the result of the
top fermentation chilling beyond that of the bottom fermentation where the
temperature sensor was located. Addition of sampling ports and temperature
sensors at both the top and bottom of the fermenter shed light on the prob-
lem. How or precisely when coalescence occurs is less understood.
temp
16
sensors top temp
bottom 14
upper strength
layer
wort strength (ºP)
temperature (ºC)
bottom temp
12
lower 10
layer
8
top strength
6
time (hours)
Figure 9.23 Stratification after second filling of a fermenter. Solid line temperature
(scale on left). Dashed line wort strength (scale on right).
In summary, fermenter stratification may be caused by:
• Unequal temperatures between the low krausen beer and the freshly
added wort.
• Large deviation in density between the low krausen beer and the freshly
added wort as a result of permitting fermentation to persist too long
before the second addition of wort.
• Inadequate mixing of wort additions due to low velocity pumps or inlets.
Yeast Generation Number

In contrast to laboratory or wild yeast strains, brewer’s yeast is stuck in an
asexual life cycle of replicative budding. If there are sufficient nutrients and
space for cell division, yeast will continue in its life cycle. But given limita-
tions, yeast will exit into a vegetative state, called the stationary or G0 stage.
Once enough resources are available, the yeast cell will reenter the cellular
division cycle. The asexual yeast cell cycle is illustrated in Figure 9.24.
As yeast cells divide, the parent cell forms bud scar in the cell wall. In this
manner, the age or reproductive history of a yeast cell can be determined by
the number of bud scars on the cell surface. Each time the cell divides, the
original cell, called the mother cell, produces a new yeast termed the daughter
or virgin cell. Because of this cycle, every yeast culture or slurry contains 50%
daughter cells. This concept is modeled in Figure 9.25.
Because all yeast populations contain 50% new cells, then yeast can be
used ad inifinitum, or again and again forever, right? Not quite. Yeast are
repeatedly subjected to stress from the presence of alcohol and carbon
(E)
(A)
(D)
(B)
(C)
Figure 9.24 Yeast cell cycle. (A) Cell grows. (B) Bud emerges. (C) Genetic material
and organelles split. (D) Daughter cell separates. (E) If nutrients are insufficient the
cell enters dormancy. When conditions become favorable the cell returns to the cycle.
298 FERMENTATION
1st
2nd
3rd
4th
Figure 9.25 As a yeast population divides, it will contain 50% new, virgin cells. Four
generations shown.
Figure 9.26 Over time a small mutation in a subset of cells can overtake a population
due to exponential growth.
ioxide and from starvation and temperature changes. Stress has the poten-
d
tial to introduce genetic mutations that may affect yeast performance. While
a mutation may only occur in a subpopulation of yeast, over time the effects
can escalate and overtake the population (Figure 9.26).
For this reason, the common rule of thumb is to not exceed ten generations,
meaning a yeast slurry should not be repitched more than ten times. Monitoring
of yeast quality in the slurry can help reveal any potential problems because of
high generation number. Flavor may be impacted, but other qualities are often
affected first. Slower fermentation rates, reduced flocculation, declines in
YEAST PROPAGATION 299
v iability, and delayed diacetyl reduction are all metrics that may indicate poor
yeast performance as a result of age. While a maximum of 10 generation num-
bers is generally recommended, ultimately the brewer should keep careful
track of any such deviations in performance to help inform recommended
yeast generation number. In practice, generation number may be as low as 4 or
as high as 30. Generation number is strain dependent.
9.8 YEAST PROPAGATION
In the previous section, we discussed how yeast can be repitched from batch
to batch. But once the yeast reaches the recommended generation number,
how does a brewer get new yeast? Commercial yeast suppliers can provide
large slurry volumes from 0.5 to 100 hL. If purchasing yeast from a commer-
cial supplier, it is highly recommended to keep track of quality by verifying
cell count and viability, as yeast may be subject to unseen stresses during ship-
ment. Of course, with the convenience of obtaining a pitchable volume of
yeast slurry comes an increase in price. With sufficient resources and manage-
ment, in‐house yeast propagation is relatively straightforward, but breweries
that use many yeast strains may find that using commercial suppliers makes
good business sense. Commercial suppliers can handle private yeast strains
under exclusivity agreements.
Yeast propagation has a different goal than wort fermentation. The goal
of propagation is to make yeast; the goal of fermentation is to make good
beer. Stirring and aeration are good for making yeast, but bad for making
beer. The first pure yeast culture system was established by Emil Christian
Hansen in 1883 at the Carlsberg Laboratory. He was the first to culture indi-
vidual yeast cells, which he subsequently grew into a slurry in a sugar solution.
The concepts of his discovery remain today and are divided into three main
phases: cell culture, laboratory propagation, and commercial propagation.
In‐house propagation requires the utmost attention to aseptic technique and
sterile or sanitary conditions to prevent microbial contamination of the
yeast. It requires a laboratory isolated from the brewery. Positive pressure in
the laboratory space is ideal to prevent backdrafts into the lab from the
brewery floor.
Cell Culture
A pure culture of yeast is used to seed the propagation. Normally yeast colo-
nies can be obtained from an agar plate or slant. A slant is a test tube with agar
and a growth medium that has been allowed to gel at an angle, as shown in
Figure 9.27. When stored at 4 °C (34 °F), most colonies will be viable for up to
one month, at which point the cultures should be regenerated by re‐streaking
300 FERMENTATION
tube
yeast
colony
agar
medium
Figure 9.27 Yeast culture on slant.
on fresh medium. Yeast extract–peptone–dextrose (YPD) medium is the most

commonly used yeast medium for cell culture on agar.
Yeast cultures may be ordered directly from a national cell culture bank or
university, or they can be maintained in‐house, where the yeast is resuspended
in a 10–20% glycerol solution and frozen at −80 °C (−112 °F) in a special
freezer. Storage in liquid nitrogen is also possible but requires routine replace-
ment of the liquid nitrogen. Cultures stored at −80 °C can survive for three to
five years before the stocks should be regenerated. Common freezers that
hold at −20 °C (−4 °F) should not be used, because the refrigeration cycle can
cause temperature changes with a negative effect on long‐term viability.
Laboratory Propagation
A single colony is used to inoculate 10 mL of culture medium, which is incu-
bated for 24–48 hours at 25–30 °C (77–86 °F) with shaking at 180 rpm. YPD
broth is recommended for this first step. From this initial culture, the yeast is
propagated by an increase in volume by a factor of 10. The 10 mL culture is
used to inoculate 100 mL of 8–12 °P wort, which is again cultured with shak-
ing or stirring for 24–48 hours at 25–30 °C (77–86 °F). Once the culture reaches
maximum density, it is ready for transfer to the next step. During laboratory
propagations, it is important to use a low‐gravity wort to avoid excessive
stress on the yeast. If a shaker is not available, a stir plate can be used, but not
one that gets hot. All laboratory‐scale cultures should be incubated at
25–30 °C (77–86 °F) with shaking at 180 rpm. The 100 mL culture is then used
to inoculate 1 L of wort, incubated at the settings described above. Figure 9.28
illustrates the proper steps for laboratory propagation. Shaking or stirring is
recommended during all propagations because increased aeration promotes
cell growth and viability. Stirred cultures produce four times more yeast than
static cultures. All transfer steps should be conducted in a laminar flow hood
to prevent any contamination.
It is at this point that laboratory propagation reaches its limit. A 1–10 L
step is technically challenging due to limitations in space. Some breweries
25 °C−stirring or shaking−24 hours per step
Ale S17
Ale S17
pure culture 10 mL 100 mL 1L
1 L lab
culture
10 L
Carlsberg flask 1 hL 100 hL
fermentation temp−aeration−24 to 48 hours per step
Figure 9.28 Laboratory propagation of yeast.
employ a Carlsberg flask (Figure 9.29). The Carlsberg flask has a capacity of

20 L. Wort from the brewhouse can be sterilized and cooled in the flask. An
aeration port allows oxygenation of the cooled wort with sterile air or oxygen.
The laboratory culture is then injected into the flask through a sterile port.
When the cells reach maximum density, the culture can be transferred to a
commercial propagation system.
Commercial Propagation
If the brewery has no dedicated propagation equipment, a sanitized fer-
menter can be used. In this method, sterile, oxygenated wort is added to the
yeast slurry, increasing the volume by 10–25 times for each step. The yeast is
allowed to grow for 24–48 hours. It is often not necessary to cold crash the
propagation. Instead, the entire yeast culture can be transferred to the
fermenter. It is recommended that the volume of wort in the fermenter be no
more than 20 times that of the culture. This method can produce 80–100
million cells/mL.
A commercial propagation system can produce up to 200 million cells/mL,
yielding enough yeast to pitch into 40 times the volume of wort. For example,
yeast produced in a 10 hL propagation system may generate enough yeast to
302 FERMENTATION
fitting for tubing 3-way valve handle

sterile
filter sterilization
valve
inoculation fitting
tri-clamp
Figure 9.29 Carlsberg flask.
pitch into a 400 hL fermenter but should always be verified with cell counting.
As discussed with laboratory propagation, wort aeration and resuspension
through shaking or stirring is recommended to increase biomass or cell num-
ber. For this reason, many commercial propagation systems include ports for
aeration and an agitator plate for gentle stirring.
Single‐vessel, double‐vessel, or continuous fed‐batch systems may be used
in commercial propagation plants. All systems should have excellent CIP
capabilities and internal sterilization by steam. For single‐vessel systems
(Figure 9.30), a 5 hL tank permits sterilization of wort, cooling, aeration, and
sterile transfer of yeast into the system from the Carlsberg flask. Once the
fermentation reaches high krausen, the entire contents are used to pitch a
25–30 hL (20–25 US bbl) fermenter. This method requires a laboratory propa-
gation for each new batch of yeast.
A double‐vessel system includes one 5 hL vessel and one 30 hL vessel.
Here, a 5 hL propagation can be performed in tank 1, as described above,
while 25 hL of wort is prepared in tank 2 (Figure 9.31). When the first tank
reaches high krausen, its contents are transferred to the sterile wort in tank 2,
the larger tank. Meanwhile, the first tank is cleaned and sterilized. When the
1) Vessel is cleaned and

steam sterilized
2) 5 hL wort transferred
from brewhouse,
sterilized, and cooled
3) Wort is oxygenated,
then inoculated from a
Carlsberg flask
4) Yeast propagated 2–3

days. Transferred to
25–30 hL fermenter
to fermenter
Figure 9.30 Single vessel commercial yeast propagation in the brewery.
second tank reaches high krausen, 25 hL of yeast is available for fermenters,
while 5 hL is transferred back to the first tank. Now the 5 hL tank is used to
hold the yeast until another 25 hL of wort can be prepared in tank 2. This
method permits continual reuse of the yeast in the propagation system and
only requires a laboratory propagation for the first pitch. A continuous fed‐
batch system also includes two tanks, but one is used to sterilize and store
wort, while the other is used solely for propagation. Using a pump, sensors to
monitor fermentation, and a programmable logic controller (PLC) system,
wort is dosed into the propagation system with continuous aeration. As the
yeast cell number increases, so does the wort volume. Once the culture
reaches a critical mass, some of the yeast is transferred out of the tank for
fermentation and the continual culture loop continues.
Active Dry Yeast

Active dry yeast represents a convenient solution for brewers with no propa-
gation systems. Under proper conditions, active dry yeast can be stored for up
304 FERMENTATION
5) 5 hL yeast is propagated in
tank 1 as for 1-tank propaga-
2
tion steps 1–4. Tank 2 (30 hL)
1 cleaned and sterilized
6) While tank 1 is propagating,

2 25 hL of wort is sterilized,
cooled, and oxygenated in
1 tank 2
7) The 5 hL in tank 1 is added to

2 tank 2. Yeast is propagated for
2–3 days in tank 2. Tank 1 is
1 cleaned and sterilized
8) 25 hL of yeast is moved to a
2 fermenter. The remaining 5 hL
is returned to tank 1. Tank 2 is
1 cleaned and sterilized. Steps
5–8 are repeated
Figure 9.31 Double vessel commercial yeast propagation in the brewery.
to three years with minimal effects on fermentation performance or beer

flavor. Because the active dry yeast can be stored for extended periods, differ-
ent strains are more easily employed in the brewery, as they are available on
demand with cell counts necessary for healthy fermentations. The availability
and speed with which a new yeast strain can be used in the brewery over-
comes the time and resource management necessary for yeast propagation
systems. Active dry yeast can also be used for secondary fermentation in
bottles or kegs.
Typical cell counts for dry yeast are 5 billion cells/g, typically at 93–95%
dry matter. Specific numbers are strain and supplier specific. Dry yeast is usu-
ally vacuum packed in 500 g containers. Oxygen and humidity negatively
affect the viability of dry yeast, so once the packet is opened, all yeast should
be used as quickly as possible. Storage of sealed packets is best at 4 °C (34 °F).
Another factor required to promote active dry yeast viability is rehydra-
tion methods. Improper yeast rehydration may lead to a reduction in viability,
ultimately leading to performance problems such as longer diacetyl rests,
stuck fermentations, longer lag phases, longer time to final gravity, and poor
utilization of maltotriose. For best rehydration, yeast should be sprinkled

onto the surface of 10 times its weight in sterilized brewing water in a sani-
tized vessel with the water at a temperature of 30–35 °C (86–95 °F). The active
dry yeast should be left undisturbed for 15 minutes and then gently stirred to
resuspend the yeast completely. Best practice is to then bring the yeast to the
same temperature as the target wort to reduce thermal stress. A common
misconception is that active dry yeast can be simply sprinkled onto wort.
Brewing liquor, rather than wort, distilled water, or reverse osmosis water,
should be used to resuspend active dry yeast to avoid loss of viability as a
result of osmotic stress.
1. Why do yeast cells carry out fermentation?

2. Draw a standard microbiological growth curve and label the lag, log,
stationary, and decline phases. On the graph, overlay the trends observed
when measuring yeast cells in suspension of a typical ale fermentation.
Describe the differences between a traditional microbiological growth
curve and yeast during fermentation.
3. What is the distinction between viability and vitality? How can they be
distinguished in practice?
4. Why are cell counting and cell viability measurements important in
brewing operations?
5. Discuss the importance of pitch rates in brewing a consistent, high‐quality
beer.
6. How many cells do you need to ferment 20 barrels of a 12 °P wort?
7. You have 225 billion yeast cells in 1 L of culture at 97% viability. How
much slurry do you need if your fermentation requires 200 billion cells?
8. You prepared a sample for counting by diluting 1:10 in a methylene blue
solution. You then counted the five chambers as described above and
measured 20, 18, 22, 17, and 23 cells at 100% viability. How many cells per
milliliter do you have?
9. In the question above, if you have a 2 L slurry, how many total cells do
you have available?
10. You prepared a sample for counting by diluting 1:10 in a 0.5 M EDTA
solution and then 1:10 in a methylene blue solution. You then counted
the five chambers as described above and measured 12, 14, 22, 13, and 17
cells at 96% viability.
306 FERMENTATION
a. How many cells per milliliter do you have?

b. If you have a 1 bbl slurry, how many cells total do you have?
c. If you are going to ferment 10 bbls of a 10 °P wort, how many cells do
you need?
d. Determine how much slurry is needed for this fermentation. How
might underpitching affect fermentation performance?
11. In Figure 9.2, why does the temperature decline abruptly at six days?
12. Describe the temperatures changes that must occur during a fermenta-
tion. What is the purpose of each step?
13. State two advantages of using an antifoaming agent during fermentation?
14. Why does the barley plant provide the seed with starch instead of ATP?
15. What do yeast cells require from wort other than sugar for a healthy
fermentation?
16. Describe the best practices for ensuring optimal yeast cell counts. Which
steps are prone to creating errors in accuracy?
17. Describe the process of topping up. How can this lead to problems in the
brewing process?
18. How would you determine how many times a yeast could be repitched
before replacing it from a supplier?
19. You met a brewer who bragged that the brewery was on their 324th gen-
eration of a yeast strain. First, explain how this could be possible. Second,
explain the drawbacks of this approach.
20. You have been asked by your Director of Operations to investigate the
cost of implementing an in‐house yeast propagation system. Start by
explaining the equipment needs and process flow for yeast propagation
in a brewery with 20 bbl fermenters.
21. Discuss the best practices of maintaining yeast in a brink before reuse.
CASE STUDY
Case Study 1
Your sensory team has noticed higher amounts of fusel alcohols in one of the
brewery’s flagship beers. Create a plan to identify potential areas of concern
in the brewing process which could be responsible. Propose a plan to evaluate
and solve the issue.
BIBLIOGRAPHY 307
Case Study 2
Your brewery makes a dry‐hopped pale ale with an OG of 15 °P and a FG of
2.0 °P. Recently your FG has been stopping at 5.0 °P. Troubleshoot this
problem. Suggest potential reasons for this stall and how you will identify,
evaluate, and solve the problem.
BIBLIOGRAPHY
American Society of Brewing Chemists. Methods of Analysis. Table 1: Extract in Wort

or Beer. doi: 10.1094/ASBCMOA‐TableWortBeerBrewingSugars.
Barth R. 2015. The Role of Alcoholic Fermentation in the Rise of Biochemistry. In
Barth R, Benvenuto MA (editors). Ethanol and Education. Oxford. ISBN
978‐0‐8412‐3059‐0.
Boulton C, Quain D. 2006. Brewing Yeast and Fermentation. Blackwell Science. ISBN
978‐1‐4051‐5268‐6.
Carey D, Grossman K. 2014. Fermentation and Cellar Operations. In Ockert K
(editor). MBAA Practical Handbook for the Specialty Brewer, Vol. 2. Master
Brewers Association of the Americas. ISBN 0‐9770519‐2‐7.
Casey GP, Ingledew WM. 1983. High‐gravity brewing: influence of pitching rate and
wort on early yeast viability. J. Am. Soc. Brew. Chem. 41: 148–152.
Cutaia AJ, Reid AJ, Speers RA. 2009. Examination of the relationships between origi-
nal, real and apparent extracts, and alcohol in pilot plant and commercially
produced beers. J. Inst. Brew. 115:318–327.
Fix G. 1999. Principles of Brewing Science. Brewers Publications. ISBN 0‐937‐
381‐74‐8.
Gosselin Y, Van Nedervelde L, Boeykens A, Janssens P. 2017. Shelf life and consistency
of active dry yeast for breweries. Proceedings ASBC Annual Meeting. Tech Session
4, paper 11.
Jones M, Pierce JS. 1964. Absorption of amino acids from wort by yeasts. J. Inst. Brew.
Dist. 70(4):307–315.
Kapral D. 2008. Stratified fermentation: causes and corrective actions. MBAA TQ
45(2):115–120.
Kunze W. 2014. Technology Brewing & Malting. 5th ed. VLB Berlin. ISBN 978‐3‐
921690‐77‐2.
Layfield JB, Sheppard JD. 2015. What brewers should know about viability, vitality,
and overall brewing fitness: a mini‐review. MBAA TQ 52(3):132–140.
O’Conner‐Cox E, Mochaba FM, Lodolo EJ, Axcell B. 1997. Methylene blue staining:
use at your own risk. MBAA TQ 34(1):306–312.
Pasteur L. 1876. Studies on Fermentation. Translation by Faulkner F, Robb DC.
Reprinted 2005. BeerBooks.com. ISBN 0‐9662084‐2‐0.
Powell CD, Quain DE, Smart KA. 2004. The impact of sedimentation on cone yeast
heterogeneity. J. Am. Soc. Brew. Chem. 62(1): 8–17.
308 FERMENTATION
Stokes C. 1999. In‐line Analytical Instrumentation. In McCabe JT (editor). The

Practical Brewer, 3rd ed. Master Brewers Association.
Troester K. 2013. Step Up Your Starters. Presentation at the National Homebrewers
Conference. Philadelphia, PA.
Van den Berg S, Van Landeschoot A. 2003. Practical use of dried yeast in the brewery
industry. Cerevisia 28(3):25–30.
Van Zandycke SM, Fischborn T, Peterson D, Oliver G, Powell CD. 2011. The use of dry
yeast for bottle conditioning. MBAA TQ 48(1):32–37.
White C, Zainasheff J. 2010. Yeast: The Practical Guide to Beer Fermentation. Brewers
Chapter 10
CONDITIONING
In ancient times, beer was often consumed during active fermentation. Today,
several operations are typically performed before the beer is ready for
packaging or serving. These operations are collectively called conditioning,
otherwise known as beer stabilization. Before conditioning, the beer is called
ruh beer or green beer. When green beer reaches final attenuation in the fer-
menter, the beer will be cold conditioned in the same tank for further flavor
maturation and stability. This is called secondary fermentation. A small
brewpub might then transfer the beer into a bright beer tank for carbonation
and serving. Packaging breweries may subject the beer to centrifugation and
filtration to prolong flavor and colloidal and microbiological stability.
Beer conditioning increases the shelf life of the beer. Shelf life is the period
of time a beer remains salable, defined primarily by the brewer’s acceptable
flavor profile. Shelf life may range from weeks for certain hop‐forward beers
to months for most common ales. If steps are taken to reduce oxygen, ensure
sound brewing practice, and secure good raw materials; proper beer condi-
tioning will further promote shelf stability. Not all aspects of conditioning are
practiced by all breweries. Small brewers may only conduct warm and cold
maturation in the fermenter followed by carbonation in a bright beer tank.
More advanced conditioning steps are not always required unless beer is

309
310 CONDITIONING
packaged for sale outside the brewery. The longer the beer has to last after
production, the greater the need for elaborate conditioning protocols.
Specifically, beer conditioning serves the following purposes:
• Flavor maturation and stability.

• Reduction of haze forming compounds.
• Clarification of the beer before service or packaging.
• Stabilization of foam.
• Reduce risk of spoilage microorganisms.
• Ensure appropriate carbonation levels.
10.1 WARM CONDITIONING
Secondary fermentation often takes place in the same cylindroconical vessel

as fermentation, aptly named a unitank. Only if space permits, or if extensive
lagering is required, will green beer be transferred to another vessel for
conditioning. In Figure 9.2 we discussed some of the temperature changes
that occur during secondary fermentation. These include an increase in
temperature for warm conditioning. This step aids in flavor maturation

through the reduction of acetaldehyde and diacetyl, which are produced by
yeast during fermentation (Figure 9.4). The other temperature change is cold
conditioning, which facilitates yeast removal and colloidal stability. Once
these steps are complete, beer is sent to a bright beer tank for carbonation
and temporary storage before serving or packaging. Bright beer tanks are not
typically used for conditioning; they are holding tanks.
Diacetyl Reduction
The major off‐flavor compounds in ruh beer are diacetyl (chemical name:
2,3‐butanedione) and 2,3‐pentanedione, collectively called vicinal diketones
(VDKs), shown in Figure 10.1.
The VDKs have C═O groups on adjacent carbon atoms. They provide a
buttery flavor characteristic of artificially flavored popcorn. The aroma
threshold of diacetyl is 0.15 ppm; that of pentanedione is 1 ppm. One of the
major objectives of ruh beer processing is to minimize the VDK off‐flavor. It
can be difficult to analytically distinguish diacetyl and pentanedione, so they
are collectively discussed as VDKs, often used interchangeably with the term
diacetyl. Here when we mention diacetyl, we specifically refer to 2,3‐butane-
dione, which is the focus of our discussion.
Diacetyl arises during fermentation as a by‐product of a pathway used by
yeast to produce the amino acids valine and leucine; pentanedione arises
WARM CONDITIONING 311
diacetyl 2,3-pentanedione
Figure 10.1 Vicinal diketones.
(A) (B)
Figure 10.2 VDK precursors. (A) Alpha‐acetolactic acid. (B) Alpha‐acetohydroxybutyric
acid.
from a pathway to isoleucine (Figure 3.16). When the yeast produces these

amino acids, intermediates are produced that cannot be quickly processed to
the next step in the pathway, so they are secreted from the yeast cell and into
the beer. During fermentation, diacetyl is made from alpha‐acetolactic acid,
and 2,3‐pentanedione is made from alpha‐acetohydroxybuteric acid (AHBA),
shown in Figure 10.2, by nonbiological oxidation reactions. The process for
diacetyl is shown in Figure 10.3. Acetaldehyde and pyruvic acid, both prod-
ucts of glycolysis, form alpha‐acetolactic acid (officially (S)‐2‐hydroxy‐2‐
methyl‐3‐oxobutanoic acid). This intermediate transfers two hydrogen atoms
to an oxidizing agent (Q in Figure 10.3) and releases carbon dioxide to give
diacetyl. The yeast quickly hydrogenates the C═O groups to ─OH groups,
yielding low flavor alcohols, as shown in Figure 10.4. The 2H shown over the
arrow represents addition of hydrogen atoms from NADH. The flavor
problem arises when the beer is separated from the yeast while the alpha‐ace-
tolactic acid precursor is still present. Diacetyl is still produced, but it is not
removed because the reaction shown in Figure 10.4 requires live yeast. When
the yeast is removed, the precursor compounds remaining in the beer continue
to be oxidized, but there is no yeast to hydrogenate the resulting VDK.
Diacetyl is more of a concern in lager beer, which is fermented below
15 °C, than in ale. The higher ale fermentation temperature gives more rapid
conversion of precursors to VDK during fermentation and conditioning, so
the sources of VDK are generally depleted within a few days. By contrast, the
312 CONDITIONING
acetaldehyde pyruvic acid α-acetolactic acid
+Q + CO2 + QH2
diacetyl
Figure 10.3 Diacetyl formation.
diacetyl acetoin butanediol
Figure 10.4 Diacetyl reduction.
lower lager fermentation temperature gives much slower depletion of VDK

precursors, which can give rise to VDK above the flavor threshold after
fermentation. To fully deplete VDK precursors in lager beer, the beer is held
for a prolonged period in contact with yeast at low temperature. This pro-
longed conditioning gives lager beer its name [lager: Ger. warehouse]. Three
to four weeks of lagering is standard. Some brewers raise the temperature of
the beer at the end of primary fermentation to increase the rate of VDK pre-
cursor conversion. This is called a diacetyl rest. The diacetyl rest can enhance
the effectiveness of lagering, but the higher temperature after sugar is
depleted can stress the yeast and decrease its viability.
The lager process can be bypassed altogether by treating the beer with
immobilized yeast, which is yeast cells attached to beads. The process starts
with removal of the fermentation yeast by centrifugation. The clear beer is
heated briefly to 60–90 °C to convert all precursor to VDK. The beer is chilled
and run through a bed of immobilized yeast. Removal of VDK can take as
little as 20 hours. The use of immobilized yeast is not a common practice.
Other Sources of Diacetyl in Beer Diacetyl can increase as a result of hop

creep. After dry hopping, the reactivation of fermentation may lead to a
second wave of diacetyl production. Enough time is needed after dry hopping
CLARIFICATION 313
α-acetolactic acid acetoin
Figure 10.5 Enzymatic treatment for VDK control.
for diacetyl reduction. Diacetyl can also be produced as a result of bacterial

infection. Spoilage bacteria do not produce 2,3‐pentanedione. The typical
ratio of diacetyl to 2,3‐pentanedione is 3:1 to 5:1. A higher ratio suggests
bacterial contamination.
The production and reduction of diacetyl is yeast strain dependent.
Production also depends on the amount of valine present in the wort. As
valine is assimilated, diacetyl production decreases, but if wort is deficient in
or depleted of valine, then diacetyl production increases. All‐malt wort usu-
ally has enough valine, but extensive use of adjuncts may warrant caution.
Enzymatic VDK Control Recently, a bacterial enzyme, alpha‐acetolactate

decarboxylase (α‐ALDC), has become available. This enzyme is added at the
beginning of fermentation at a rate of 1–1.5 g/hL of wort. It directly catalyzes
the conversion of alpha‐acetolactic acid, the precursor for diacetyl, to acetoin
and carbon dioxide according to the reaction shown in Figure 10.5. Use of α‐
ALDC bypasses the spontaneous production of diacetyl and the need for
yeast as the means for reduction.
10.2 CLARIFICATION
A current trend is to produce hazy or unfiltered beer that requires minimal

processing. But most styles of beer are expected to be served clear and bright.
Yeast and other solid particles are removed. Materials that can react to give
haze particles during the expected shelf life of the beer must be excluded.
Clarification will promote the long‐term flavor and colloidal stability of beer
in packaging.
Beer is eventually clarified by gravity, but during production, clarity is
typically induced by the addition of fining agents and/or by mechanical
means. Clarification is governed by Stokes’ law where the velocity of a particle
settling in liquid is determined by the equation
2r 2 p b a
v
9
314 CONDITIONING
where a is the acceleration provided by gravity or by a centrifuge (in m/s2),

r is the radius of the particle (in m), ρp is the density of the particle, ρb is the
density of the beer (kg/m3), and η is the viscosity of the beer (Pa∙s). For gravi-
tational settling, a is fixed at 9.8 m/s. The settling rate can be increased by
encouraging the particles to combine, increasing the particle radius. As the
particle radius increases (r2), the settling velocity increases. This is accom-
plished during the brewing process by the addition of finings. The accelera-
tion can be increased with a centrifuge. The centrifugal acceleration is given
by a = 4π2f 2R, where R is the distance from the center of rotation and f is the
spinning rate in rotations per second (RPM/60). The use of a centrifuge
increases the settling rate and clarifies the beer faster. Higher beer viscosity
(η) or density (ρb) makes settling slower.
Yeast Removal
Yeast can be removed by sedimentation, centrifugation, or filtration, all of
which are enhanced by addition of finings. After fermentation, the beer is
chilled, sometimes to near the freezing point. At the low temperature, most
strains of yeast clump together and sink to the bottom of the vessel, a process
called sedimentation. If the vessel has a cylindricoconical form, the yeast can
be harvested for use in another fermentation. Sedimentation tends to be slow
and, for some strains of yeast, incomplete.
Sedimentation is highly dependent upon the ability of the yeast to floccu-
late. The tendency of a yeast to flocculate is a defining feature of yeast strains.
This information is typically provided by the yeast supplier. Flocculation typi-
cally occurs during the stationary phase of fermentation as cell division
ceases. As the cells stick together, their sedimentation rate increases, and they
sink to the bottom of the CCV. Highly flocculant yeast improves downstream
clarification processes, since there is less material that needs to be removed.
Changes in flocculation character may be caused by:
• Yeast health – Genetic drift or mutation may reduce the ability of yeast

to flocculate.
• Calcium ions in wort – Flocculation is calcium dependent.
• Premature yeast flocculation (PYF) – PYF may be caused by fungal
contamination of barley used for malting.
• Contamination by non‐flocculant yeasts or bacteria.
Centrifugation
Sedimentation is usually followed by additional clarification steps. The mod-
ern method of choice for secondary yeast removal is the centrifuge. Beer is
CLARIFICATION 315
fed in at the center where it enters a system of rapidly spinning (>5000 RPM)

bowls. The bowls accelerate the beer, greatly increasing the settling velocity.
The yeast cells are ejected at the edges, and the clarified beer emerges at the
center. The yeast is not contaminated with any filtration material and can be
added to the brewer’s grains for use as cattle feed. Centrifugation uses high‐
speed moving parts operating at close tolerance. Good maintenance is essen-
tial. The unit is noisy, and it may cause an increase in beer temperature. Poorly
adjusted units may also increase the amount of dissolved oxygen in the fin-
ished beer. If the centrifuge were to be operated at the very high velocity that
would be needed to completely remove haze particles from the beer, the
mechanical forces could damage the yeast cells, increasing haze. For this rea-
son, centrifuged beer usually requires additional filtration to achieve the
desired brightness.
Finings
The sedimentation of yeast is greatly enhanced by the addition of a fining
called isinglass. Isinglass is a protein‐containing material derived from the
swim bladders of certain tropical river fish. Isinglass molecules take a positive
charge at beer pH. This allows them to trap yeast cells, which are negatively
charged, causing them to coagulate. Isinglass is frequently used for cask con-
ditioning. Isinglass may not be acceptable to vegan consumers and those who
observe kosher laws.
The main source of haze in properly brewed beer, that is, free of
microbes, starch particles, and processing aids, is the particles formed
from the interaction of polyphenols and certain protein fractions. If either
of these can be removed, the tendency of the beer to become hazy can be
greatly reduced. Both polyphenols and proteins have some benefits, so
their removal can have side effects. Excessive protein removal can reduce
head retention (foam stability); excessive polyphenol removal can affect
flavor stability.
The family of polyphenols most implicated in haze formation are proan-
thocyanidins. An example called procyanidin B3 is shown in Figure 10.6. The
molecule is a dimer, the two parts of which are color‐coded in the figure.
Proteins that are haze active generally have a high content of the amino acid
proline, shown in Figure 10.7. Proline is unique among amino acids in having
the amino group as part of a ring. The presence of proline in a protein intro-
duces a kink in the chain.
Most of the finings used in beer production are targeted to polyphenols or
to haze‐active proteins. The finings are added after yeast removal. The finings
and the molecules they bind are usually removed by a filtration process.
Specific finings and enzymes to assist in clarification are discussed in detail in
Section 13.4.
316 CONDITIONING
Figure 10.6 Polyphenol: procyanidin B3.
Figure 10.7 Proline.
Filtration
Filtration involves driving the beer through a porous material called the
filtration medium. The medium traps particles that are larger than its
pores. Filtration is used to remove particles at many stages of the brewing
process, including processing of water, processing of syrup adjuncts, separa-
tion of wort, removal of yeast, removal of finings, clarification before packag-
ing, and removal of microbes. The filtration process can be depth filtration,
used in most brewery processes, or membrane filtration, used mostly for
removal of microbes as an alternative to pasteurization. In depth filtration,
the thickness of the filtration layer is much greater than the diameter of the
particles targeted for removal. The particles thread their way through filter
medium following a complex path with many opportunities to get trapped.
One depth filtration method is to use a porous powder supported on a screen
or cloth. The supported powder is called the precoat. Sometimes a precoat of
finer particles is laid down first, followed by a top layer of coarser particles.
This arrangement increases filtration capacity. Sometimes additional filtra-
tion medium powder, called admix or body feed, is added to the beer before
it arrives at the filter. This increases filtration efficiency and capacity. Pressure
drop in a filter is governed by Darcy’s law, discussed in Section 7.2.
Membrane filters are thin sheets or tubes with pores of a specific size. Each
trapped particle blocks a pore, so filtering heavy sediment with a fine‐pore
filter will lead to clogged filters and hazardous pressure buildup. Pressure
gauges should be present upstream and downstream of all filter systems. The
CLARIFICATION 317
filtered
plate beer
frame
filter cloths
unfiltered
beer
Figure 10.8 Plate and frame filter exploded view.
pressure upstream of the filter is called back pressure. The back pressure
should be monitored throughout the filtration process. Any excessive increase
in pressure indicates potential blockage of the filter. For this reason, filter
size should be matched to the required filtration capacity. Membrane filters
are usually used for final filtration when the concentration of particles to be
removed is low. Microbial filtration is often performed with a series of filters,
the last of which is a membrane filter with 0.45 μm or smaller pores.
Plate and Frame Filter/Sheet Filter The plate and frame filter (Figure 10.8)
is a less specialized version of the mash filter, shown in Figure 7.2. Filtration
occurs on filter cloths attached and supported by plates. Each plate (except
the ones on the ends) is a box with filter cloths on each side. Any beer that
enters the plate must go through a filter cloth. The plates are separated by
frames, which are spacers made of metal or plastic. The unfiltered beer enters
the frames and crosses into the plates through the filter cloths. Usually the
actual filtration occurs on filtration medium, typically diatomaceous earth
(DE) or perlite coated on the filter cloths. A special type of plate filter is used
with sheet filters. For sheet filtration, the frame is reduced to a spacer gasket.
The filter cloth is a composite material made from cellulose fibers, and
filtration media like DE or perlite with binders made of food‐grade resins.
Sometimes finings are included in the sheet filter composition.
Candle Filter A candle filter (Figure 10.9) is a pressure vessel with parallel

perforated tubes inside, called candles. The tubes serve as the support for the
filter medium. A slurry of medium is fed in at the bottom of the vessel and
318 CONDITIONING
filtered
beer
candle
unfiltered
beer
Figure 10.9 Candle filter. In practice there are many more candles.
through the candles. The perforations trap medium on the outside of the
candles, forming a precoat. The beer, which may be mixed with filtration
medium (admix), follows the same path. Clarified beer emerges from the
inside of the candles and flows out of the device.
Pressure‐Leaf Filter A pressure‐leaf filter (Figure 10.10) consists of an array

of plates, called leaves. Each leaf is covered on one or both sides by a fine
screen. The screens are supported by coarse mesh to provide stiffening. The leaf
is sealed at the edges. The inside of each leaf leads to a tube that is connected
to a manifold. If the leaves are mounted vertically, there is usually a bar across
the tops of the leaves to provide mechanical support. Horizontally mounted
leaves are supported at the center by the manifold pipe. Before each run, the
leaves are precoated with filter medium. Beer, possibly mixed with filtration
medium (body feed), is fed into the filtration vessel. The beer is driven under
pressure through the medium coating the leaves, through the screen, and into
the tube to the manifold. The filter cake (solid that stays on the filter) can be
removed by spraying or shaking. In some units with horizontally mounted
leaves, the manifold pipe can be rotated by a motor, spinning off the filter cake.
This system provides a fast cleanout cycle, but the rotating seals that allow the
shaft to turn must be maintained meticulously to avoid leaks. The terms
CARBONATION 319
screens
leaf
filtered
beer
unfiltered
beer
Figure 10.10 Pressure‐leaf filter.
“vertical” and “horizontal” are often loosely applied either to the mounting
direction of the filter leaves or to the configuration of the filtration vessel.
Filtration Media Diatomaceous earth (DE), also called kieselguhr, filtration

is very effective in removing particles from beer, including yeast and finings.
DE is a porous mineral derived from skeletons of marine algae. The material
is milled to give the correct particle size and sometimes acid‐washed to
remove undesired materials, like iron. DE can be used as a precoat and body
feed, or it can be included in the composition of sheet filters. The DE traps
particles in its pores. The major disadvantage of DE is that it is toxic and
cancer causing when inhaled. Its exposure limit is 0.05 mg/m3, so precautions
must be taken for safe handling. After yeast removal, the used DE–yeast
mixture has no value and must be disposed of safely. Nonetheless, DE is
generally recognized as a very effective filtration medium.
Perlite is hydrated volcanic glass that is expanded with heat and then
milled. It is safer than DE, having a recommended exposure limit of 5 mg/m3
(100 times that of DE). Perlite, lacking the complex pore structure of DE, is
less effective than DE at removing small particles from beer.
10.3 CARBONATION
Beer is usually served with dissolved carbon dioxide (CO2) at a level of about
0.5% by weight. The flavor threshold for carbon dioxide is 0.1%, so carbon
dioxide makes a major contribution to beer flavor. American brewers measure
320 CONDITIONING
the amount of CO2 in beer as volumes. One volume is 1 liter of CO2, measured
at 0 °C and 1 atmosphere (1.013 bar or 14.7 psia) per liter of beer. One volume
is equal to 1.96 g CO2 per liter of beer. As a general standard, open to stylistic
interpretation of the brewer, normal carbonation values are 1.5–2.6 volumes,
although highly carbonated beers may approach 4.0 volumes, requiring
special bottles with caged corks to accommodate the elevated pressures.
Forced Carbonation
Although it is possible to retain the carbonation from fermentation, most
brewers find it more convenient to add carbon dioxide after clarification, a
process called forced carbonation. Carbon dioxide is supplied in cylinders as
a liquid at a pressure of about 60 bar (870 psia). As CO2 gas is drawn off from
the headspace of the cylinder, liquid vaporizes. Vaporization absorbs heat, so
the temperature of the liquid in the cylinder and hence the pressure decrease
during delivery. A pressure regulator is used to deliver the gas at a controlled
pressure despite the change in tank pressure. Rapid or excessive release of
CO2 from a cylinder may cause the regulator to freeze, blocking release.
Carbonation Volume
The carbonation volume in beer increases with pressure and decreases with
temperature. For this reason, beer is always carbonated cold. The equation
below relates the pressure in absolute bar at the liquid surface (P) to the car-
bonation in volumes (V) and the temperature in °C (t) for “average beer.” To
convert to atmospheres, multiply by 0.9869. To convert to psia, multiply by 14.50:
6167V
P
2505
exp
t 273.15
If you are not coding this equation into a computer, you may find it
convenient to use Table 10.1. This table can be used to approximate the
headspace pressure required to reach a certain carbonation volume at a
specific temperature. Neither the equation nor the table should be consid-
ered exact. The solubility parameters of carbon dioxide in beer vary with the
composition of the beer.
Equipment and Procedures
Carbon dioxide can be introduced into the beer by driving it through a porous
“stone” made of particles of stainless steel or ceramic. The stone releases the
gas in the form of small bubbles that offer a large surface of contact with the
CARBONATION 321
TABLE 10.1 Pressures for Various Temperatures and Carbonation Volumes

Temperature (°C) −2 0 2 4 6 8 10 12
Volumes CO2 Absolute Pressure (bar)
1.0 0.60 0.64 0.69 0.73 0.78 0.83 0.89 0.94
1.2 0.72 0.77 0.82 0.88 0.94 1.00 1.06 1.13
1.4 0.84 0.90 0.96 1.03 1.09 1.17 1.24 1.32
1.6 0.96 1.03 1.10 1.17 1.25 1.33 1.42 1.51
1.8 1.08 1.15 1.23 1.32 1.41 1.50 1.60 1.70
2.0 1.20 1.28 1.37 1.46 1.56 1.67 1.77 1.89
2.2 1.32 1.41 1.51 1.61 1.72 1.83 1.95 2.08
2.4 1.44 1.54 1.65 1.76 1.88 2.00 2.13 2.27
2.6 1.56 1.67 1.78 1.90 2.03 2.17 2.31 2.45
2.8 1.68 1.80 1.92 2.05 2.19 2.33 2.48 2.64
3.0 1.80 1.92 2.06 2.20 2.34 2.50 2.66 2.83
3.2 1.92 2.05 2.19 2.34 2.50 2.67 2.84 3.02
3.4 2.04 2.18 2.33 2.49 2.66 2.83 3.02 3.21
3.6 2.16 2.31 2.47 2.64 2.81 3.00 3.19 3.40
3.8 2.28 2.44 2.61 2.78 2.97 3.16 3.37 3.59
4.0 2.40 2.57 2.74 2.93 3.13 3.33 3.55 3.78
4.2 2.52 2.69 2.88 3.08 3.28 3.50 3.73 3.96
4.4 2.64 2.82 3.02 3.22 3.44 3.66 3.90 4.15
4.6 2.76 2.95 3.15 3.37 3.59 3.83 4.08 4.34
liquid, making the dissolving process faster. Sometimes membranes in the

form of hollow tubes are used to introduce the CO2. The membrane avoids
some complications of two‐phase flow. CO2 can be introduced into a batch
in the bright beer tank, or it can be dosed into the beer as it flows to the
packaging unit.
Carbonation pressure in the bright beer tank is ideally measured in the
headspace at the top of the tank. In practice, many brewers are not equipped
for this, so they measure the pressure at the CO2 tank regulator. The regulator
pressure is always higher than the headspace pressure because of pressure
loss in the carbonation stone and in other restrictions. Flow through a
carbonation stone is influenced by capillary action. When the stone is in water
or beer, the liquid is drawn into the pores. Pressure is needed to drive the
liquid out. Smaller pores have a higher capillary pressure. If the pressure
driving the gas through the stone is less than the capillary pressure, beer will
be drawn into the stone and no gas will flow. To estimate the carbonation
pressure, the brewer will measure the capillary pressure by placing the stone
in a bucket of beer and adjusting the flow to give a curtain of small bubbles.
At the onset of the bubbles, the pressure on the gauge will be the capillary
pressure plus the variable resistance from friction in the stone and in any
other places like a control valve in the line.
322 CONDITIONING
The hydrostatic pressure (in bar) exerted by the beer in the tank is about
0.1486 times the height of the beer (in meters) measured from the CO2 inlet
to the beer surface. In psia, this comes to 0.6567 times the height difference in
feet. The pressure at the regulator is approximately the sum of the capillary
pressure, the hydrostatic pressure, and the carbonation pressure. Suppose the
target carbonation is 2.4 volumes and the temperature in the bright beer tank
is 4 °C. The capillary pressure at the stone is measured at 0.35 bar. The car-
bonation stone is 0.5 m from the bottom of the tank, and the tank is filled to
3.0 m from the bottom. The carbonation pressure from Table 10.1 is 1.90 bar.
The hydrostatic pressure is (3 m − 0.5 m) × 0.1486 bar/m = 0.37 bar. The
required delivery pressure is the sum of these three pressures: 1.90 bar + 0.35
bar + 0.37 bar = 2.62 bar. When the pressure at the surface of the bright tank is
1.90 bar, the pressure resisting flow will balance the applied pressure, and flow
will stop. This method cannot be relied upon to give highly consistent
carbonation.
It is ideal if the rate of introduction of gas is slow enough that the gas dis-
solves before the bubbles reach the surface. Excessive breakout of gas can
lead to removal of flavor compounds and foaming that makes the beer hard
to pump and package. Also, foam formation will use up foam‐positive pro-
teins that are needed for head retention. These proteins do not fully redis-
solve when the foam settles, so visible particles called bits can be left in the
beer. Nonetheless, the deliberate purging of beer with gas is sometimes
attempted to deal with issues like excessive oxygen or volatile off‐flavors. It is
a desperate measure, best avoided.
Nitrogen
In nitrogenated beer (also called nitrogenized beer), some of the carbon
dioxide is replaced with nitrogen (N2) to provide very stable foam with
smaller bubbles. The creamier head is preferred in some styles by some drink-
ers. The foam character arises because nitrogen is only 64% as dense as car-
bon dioxide, and it is much less soluble. The effects of nitrogenation on beer
foam are discussed in Chapter 13. On the negative side, nitrogen does not
provide the characteristic tartness and prickly sensation of carbonic acid.
Nitrogen is considered less appropriate for hop‐forward beers because it
does not seem to carry aroma as well as carbon dioxide. However, because
there is less carbonic acid bite, which can obscure flavors, it may be argued
that nitrogenated beer is more flavorful.
Nitrogen may be introduced in beer using the same techniques as for car-
bonation but using N2 or a N2/CO2 mixture instead of pure CO2. The standard
N2/CO2 mixture for nitrogenated beer is about 75% nitrogen by volume (3 : 1
ratio). Because nitrogen is less soluble than CO2, it requires greater head-
space pressure to get the gas into solution. Liquid nitrogen is sometimes
BEER AGING 323
added to cans and bottles just before closing. Beer with nitrogen requires
special techniques for draft delivery, discussed in Chapter 11.
10.4 BEER AGING
Aged Beer Categories

Aging is the extended storage of beer to allow characteristic flavors to
develop. Aging is often accomplished in wooden barrels or in glass bottles
after packaging. Few brewers have the resources to commit their perma-
nent vessels for the three months or more required for aging. There are
two general categories of aged beer. The first category is strong, conven-
tionally brewed beers. These are sometimes aged, often in their bottles, to
smooth out harsh flavors arising from ethanol and higher alcohols. Some
examples are barley wine and imperial stout. The second category is beer
that is exposed to or inoculated with microbes such as bacteria or wild
yeast. These beers require a prolonged, multi‐step aging process before
release. Sometimes they are blended to help overcome the uncertainty
inherent in microbial aging. Some examples are coolship ale, Flemish oud
ale, and lambic ale.
The fermentation and aging of beers of the second category tend to
occur in a sequence of phases in which different groups of fermentive
organisms dominate. The sequence depends on the details of the wort pro-
cessing, the nature of the microbes and how they get into the beer, fermen-
tation temperature, season of the year, and even the geographic location of
the brewery. In a typical case, the dominant organisms during aging and
fermentation could be:
• Enterobacteriaceae: Consume sugar and make lactic acid.

• Saccharomyces and Brettanomyces species: Perform the main fermenta-
tion, consume sugar, and make ethanol and carbon dioxide.
• Lactic acid bacteria: Consume sugar and make lactic acid.
• Acetic acid bacteria: Consume ethanol and oxygen and make acetic
acid.
These organisms are tolerant to oxygen; they can grow in casks and barrels
that allow oxygen to enter. Acetic acid bacteria require oxygen; they get
energy by reacting ethanol with oxygen. Apart from Saccharomyces cerevi-
siae (ale yeast), these yeasts and bacteria would be regarded as spoilage
organisms in conventional beer. Brewers who intend to brew microbially
aged beer in addition to conventional beer need to take precautions to avoid
cross‐contamination.
324 CONDITIONING
Barrels
Barrels are often used to hold beer during parts of the fermentation and
aging processes. Some breweries that specialize in aged beer have large
permanent wooden vessels called foeders [FOOD er]. Most aging barrels
are made of American or European white oak. The barrel is built of nar-
row planks called staves. A groove called the croze is cut near the ends of
the staves to accommodate the heads, which are the flat planks that make
up the barrel top and bottom. The staves are bent with heat to make the
barrel wider in the middle than at the ends. The staves are held with the
long edges in contact under compression provided by hoops (see
Figure 10.11). The inside of the barrel is usually subjected to a heat treat-
ment that can vary from a light toasting to charring in a gas flame. The
bung hole is drilled in one of the staves to let the product in and out.
Wood shrinks on drying and expends when it absorbs moisture. Barrels
that have become dry must be rehydrated or they will leak. Brewers often
use barrels that have been used for other beverages. In the United States,
barrels from Bourbon whiskey are most popular. United States standards
of identity require that Bourbon be aged in new charred oak barrels.
Because the barrel is new only once, it then becomes available for pur-
chase by brewers (and wine and spirits makers) at an estimated whole-
sale price of $60–70 for a standard 200 L barrel plus the cost of shipping,
which can be very significant.
The barrel exchanges material with the beer inside as well as with the sur-
roundings. Traces of the previous contents of the barrel can flavor the beer.
Oxygen leaks in slowly, affecting the beer directly by providing reactive oxy-
gen species and by supporting the growth of oxygen‐dependent microbes like
acetic acid bacteria. Growth of acetic acid bacteria can be limited by ensuring
the barrel is “topped up,” meaning the barrel is completely filled to the bung.
Over time, it may be necessary to top up with fresh beer due to loss from
evaporation.
bung hole
hoop
stave chime
head
croze
Figure 10.11 Barrel.

ANALYTICAL AND QUALITY CONTROL PROCEDURES FOR CONDITIONING 325
Figure 10.12 Vanillin.
During aging, volatile substances in the beer can escape, changing the flavor.
The pores in the wood give shelter to microbes that produce flavor‐active sub-
stances. The wood itself releases many flavor compounds such as vanillin
(Figure 10.12), which has a vanilla flavor. The type of wood, its growing conditions,
the seasoning of the wood, and the heat treatments to which it was exposed during
barrel construction all affect the types and quantities of flavor compounds.
Wood is not as easily maintained as stainless steel; it is subject to mold and
rot. If struck or dropped, it will crack rather than dent. A typical barrel has 50
or more joints that can spring leaks. The first step in barrel maintenance is to
plan a place for the barrels. Ideally, they should be stacked on racks allowing
individual access. The barrel cellar should be dry enough to discourage mold
but not so dry that the wood shrinks. Around 75% relative humidity is recom-
mended. Real installations usually deviate from ideality. One issue that
should not be subject to compromise is identification of the contents of the
barrel. The labels need to make the contents easily identifiable by the person
sent to get the barrel, who may not even have been around when the barrel
was filled months or years ago. Irrespective of what is on the label, it must
remain attached and readable for the entire duration of the aging process.
Barrels are typically cleaned with steam or hot water. Their hoops need
occasional adjustment to keep the staves tight. Small leaks through the wood
can sometimes be repaired by the application of wax. Larger leaks can be
repaired by driving in pegs. An installation with more than a few dozen barrels
should employ a trained person to supervise their handling and maintenance.
Samples can be taken from barrels with a sterile pipette through the bung.
When barrels are stacked, access may be difficult. Vinnie Cilurzo, brewer and
owner of Russian River Brewing, has standardized the sampling of beer
through a small port (2.8 mm = 7/64 in.) on the head stoppered with a stainless
steel nail. The nail can be easily removed and resealed as sampling is required.
10.5 ANALYTICAL AND QUALITY CONTROL PROCEDURES

FOR CONDITIONING
After conditioning, beer should be finished and ready for consumption. The
most informative and universally applied quality control procedure for
conditioned beer is tasting. This will be covered in more detail in Chapter 12.
326 CONDITIONING
Although carbonation is introduced during conditioning, it is normally tested

after packaging. Measuring CO2 content will be covered in Chapter 11.
Analysis of haze is covered in Section “Analysis and Quality Control of
Haze,” Chapter 13. At this point we will discuss procedures for evaluation of
ethanol and diacetyl content.
Beer contains varying amounts of carbon dioxide that can interfere with
most analytical results. Before any analysis is undertaken, the beer must be
effectively degassed. Many degassing methods involve agitation of the beer
using techniques ranging from pouring it back and forth between two beakers
to the use of ultrasound. Other methods involve filtration and the use of
membrane technology. Some methods are specifically recommended for cer-
tain analytical methods. In any case, the same degassing procedure should
always be used in your laboratory for a particular analysis to avoid the
introduction of uncontrolled variables.
Ethanol
The classical and very time‐consuming method for analysis of ethanol in beer
is distillation. A measured sample of degassed beer is diluted with water and
put into a laboratory still. The beer is distilled into an ice‐cold receiver (to sup-
press evaporation of the ethanol) until about two‐thirds of the beer–water
mixture has been distilled. The distillate (liquid condensed after distillation) is
essentially ethanol and water. Purified water is added to the distillate until the
mass or volume is equal to the original mass or volume of the beer sample. The
adjusted distillate should now have the same ethanol concentration as the
original beer, but the only other component should be water. The mixture is
then analyzed by measuring its specific gravity, refractive index, or some other
property that varies in a predictable way with ethanol–water composition.
A more modern method is gas chromatography (Figure 10.13). The beer is
degassed, an internal standard (typically 1‐propanol) is added, the sample is
quantitatively diluted, and then injected directly into the gas chromatograph. The
sample mixture is vaporized at the injection port. A carrier gas (usually helium or
nitrogen) carries the sample through a tube, called the column, that contains or is
coated with a material that attracts and slows the flow of the components of the
sample to different extents. The components reach the end of the column at
different times depending on how strongly they stick to the column mate-
rial. A detector at the end of the column responds to the organic components,
including ethanol, as they arrive, providing an electrical signal to a data system.
One disadvantage of direct injection of beer is that upon drying in the
injector, solids from the beer will deposit, requiring frequent maintenance.
Instead of injecting beer directly, it is possible to put beer samples into sealed
vials fitted with septa (rubber disks that allow a needle to enter). The vials are
kept at a controlled temperature. An automatic system pulls a sample from
ANALYTICAL AND QUALITY CONTROL PROCEDURES FOR CONDITIONING 327
mixture
flow
data system
injector
He
flow
controller
detector
carrier gas column

oven
Figure 10.13 Gas chromatograph.
the headspace (air space over the liquid) in the vial and injects it into the
carrier stream. The system will perform with less maintenance because the
headspace sample does not contain the nonvolatile components of the beer;
they stay in the vial. Gas chromatography is reliable, but it requires expensive
equipment that takes a good deal of space, including space for potentially
three gas cylinders, one for carrier and one each for fuel and oxygen for the
detector. If hydrogen is used as the carrier (there is no reason that it should
not be), then only two cylinders are required.
Several commercial instruments measure ethanol, mostly by near infrared
(NIR) spectroscopy. NIR is light in the range of 780–2500 nm. Mathematical
methods are applied to the transmittance to compute the concentrations of
components of mixtures. Another instrument uses heat generated by catalytic
combustion of the ethanol in excess air. These units are costly, but they do not
take much space or consume expensive supplies.
Low ethanol levels (< 0.5 ABV) like those in “nonalcoholic beer” can be
determined by adding NAD+, a biological oxidizing agent, and ethanol dehy-
drogenase, an enzyme. The ethanol reacts with the NAD+ to give NADH and
acetaldehyde according to the reaction CH3CH2OH + NAD+ → CH3CHO +
NADH + H+. The absorbance at 340 nm is a measure of the amount of NADH,
hence the amount of ethanol in the original sample.
Diacetyl
Rapid, non‐quantitative methods for detecting diacetyl rely on sensory per-
ception. The method is typically conducted for a relatively quick go/no‐go
decision. Two 200 mL samples should be collected in flasks that can be lightly
covered (but not sealed). One sample is left undisturbed at room temperature.
One sample is heated at 60 °C (140 °F) for 20 minutes and is then returned to
328 CONDITIONING
room temperature. The samples are then sniffed for the presence of diacetyl.
Heating causes the conversion of all remaining alpha‐acetolactic acid into
diacetyl. The detection of diacetyl in the heated sample indicates that more
conditioning is needed.
For quantitative measurement, the brewer needs to know the sum of
VDKs and their precursors. There are two colorimetric methods: one involves
distillation, and one is a purge and trap (bubbling gas through sample and
condensation of the VDK in a cold trap). Neither of these methods have
generated much traction in the brewing community, as they require extensive
time for preparation. In addition, they only measure VDK and do not distinguish
between diacetyl and 2,3‐pentanedione.
The preferred method involves headspace gas chromatography. The sample,
a solution of copper(II) sulfate (CuSO4), and a measured dose of 2,3‐hexanedi-
one (a VDK that does not occur in beer) as an internal standard are put into a
sealed vial capped with a septum (rubber disk that can accept a sampling nee-
dle). The sample is held at 60 °C long enough for the copper ion to oxidize VDK
precursors to VDK. An autosampler inserts a needle into the septum of each
vial, takes a sample from the vapor at the top of the vial (the headspace), and
injects it into the gas chromatograph. This method is amenable to automation,
and it can distinguish between diacetyl and 2,3‐pentanedione. It has the disad-
vantages mentioned for gas chromatography under ethanol analysis, plus the
additional issue of requiring an electron capture detector, which contains a
radioactive electron source. In the Unites States, electron capture detectors
operate under licensing requirements from the Nuclear Regulatory Commission
(NRC). For most breweries, the equipment supplier provides the license, but
the user is restricted in how the unit is serviced and disposed of.
1. Identify three objectives of beer conditioning.

2. Why is beer heated before testing for diacetyl?
3. Name five finings and discuss how they are used.
4. What types of compounds are responsible for haze? How can they be
removed?
5. Give brief descriptions of three types of filters.
6. What are the roles of precoat and body feed in filtration?
7. Ten hectoliters of beer at 4 °C is to be force‐carbonated to 2.6 volumes.
The beer already contains 1.2 volumes from fermentation. What will be
the final pressure? What mass of CO2 will need to be added?
BIBLIOGRAPHY 329
8. What are the three sources of pressure in a bright beer tank?

9. Explain the two categories of aged beer.
10. What are some compounds that would be expected in barrel‐aged beer?
11. Make a diagram of a gas chromatograph.
CASE STUDY
You work at a 25 hL (20 bbl) brewery. Standard conditioning processes

involve cold conditioning in the fermenter, centrifugation, plate and frame
filtration, and carbonation in a bright beer tank. During the last filter run, you
noticed an increase in the back pressure on the plate and frame filter. It
was managed, but then the lab results indicated higher turbidity outside of
the acceptable limits. Explain how you will identify, isolate, and resolve the
problem.
BIBLIOGRAPHY
Barth R. 2013. The science of carbonation. Zymurgy 36(6):65–69.

Barth R. 2018. Beer Conditioning, Aging and Spoilage. In Bordiga M (editor). Post‐
Fermentation and ‐Distillation Technology. CRC Press. ISBN 978‐1‐4987‐7869‐5. Chap. 6.
Cantwell D, Bouckaert P. 2016. Wood and Beer: A Brewer’s Guide. Brewers Publications.
ISBN 978‐1‐938469‐21‐3.
Constant MD, Collier JE. 1991. Alternative techniques for beer decarbonation. J. Am.
Soc. Brew. Chem. 51(1):29–35.
Lewis MJ, Young TW. 2001. Brewing, 2nd ed. Springer. ISBN 978‐0‐306‐47274‐9.
Lindemann B. 2009. Filtration and Stabilization. In Eßlinger HM (editor). Handbook
of Brewing. Wiley‐VCH. ISBN 978‐3‐527‐31674‐8.
Patino H. 1999. Overview of Cellar Operations. In McCabe JT (editor). The Practical
Brewer, 3rd ed. MBAA.
Siebert KJ. 1999. Effects of protein‐polyphenol interactions on beverage haze, stabili-
zation, and analysis. J. Agric. Food Chem. 47(2):353–362.
Speers RA, MacIntosh AJ. 2013. Carbon dioxide solubility in beer. J. Am. Soc. Brew.
Chem. 71(4):242–247.
Verachtert H, Derdelinckx G. 2014. Belgian acidic beers: daily reminiscences of the
past. Cerevisia 38:121–128.
Work H. 2014. Wood, Whiskey, and Wine: A History of Barrels. Reaktion. ISBN
978‐178023‐356‐7.
Chapter 11
PACKAGING AND SERVING
The days when a customer took beer home in a galvanized steel bucket are
long gone. Modern beer is served through an elaborate dispensing system or
sold in secure and attractive packages. After conditioning, beer is stored in
the bright beer tank. It is cold, carbonated, and ready to drink. Small breweries
may have several bright beer tanks located close to the bar to which the draft
system is directly connected. Alternatively, the beer is sent from the bright
beer tanks to a large pack system or a small pack system. Large pack refers to
large serving containers like kegs, while small pack refers to single‐serving
containers like bottles or cans.
Packaging permits storage and transport of high‐quality beer, ensuring
consistent carbonation and protection from light, while providing an access
point for dispense. Quality packaging is immensely important; once the beer
leaves the brewery, it is beyond the brewer’s control.

331
332 PACKAGING AND SERVING
11.1 KEGS AND CASKS
Kegs
The keg is the most common vessel for holding beer to be served by the glass.
It maintains quality and carbonation of the beer by protecting it from air and
light while also permitting quick and easy dispense. Modern kegs all use the
Sankey system described in the box “KEG DETAILS.” Older keg systems,
like Golden Gate and Hoff‐Stevens, have been largely abandoned. A Sankey
keg is a cylindrical pressure vessel with a single hole about 5 cm (2 in.) in
diameter at the center of the top. A short tube called the neck extends the
opening outside the keg. The neck accommodates a dip tube, called a spear,
extending to the bottom of the keg, as shown in Figure 11.1. The spear has
concentric valves to accommodate gas and liquid. Most kegs are made of
stainless steel. They can be made with aluminum with a protective coating
inside, but aluminum kegs are more susceptible to theft for the salvage value
of the metal. Table 11.1 gives dimensions and capacity for standard kegs.
A full US half‐barrel keg weighs 73 kg (160 lb).
The spear may be held secured to the neck by a threaded system or
a drop‐in system. The drop‐in system is more common in American kegs.
hand hold
neck retaining clip
groove
upper chime
spear
keg seal
ear channel
flange
rib neck section detail
lower chime
sump
Figure 11.1 Keg with neck detail.

KEGS AND CASKS 333
TABLE 11.1 Typical Keg Dimensions

United States Europe
Capacity 58 L (15.5 gal) 30 L (7.75 gal) 20 L (5.5 gal) 50 L
Name Half barrel Quarter barrel Sixth barrel
Height 594 mm (23 ⅜ in.) 594 mm (23 ⅜ in.) 594 mm (23 ⅜ in.) 532 mm
Diameter 410 mm (16 ⅛ in.) 283 mm (11 ⅛ in.) 235 mm (9 1/4 in.) 408 mm
(incl ribs)
A drop‐in spear is attached to the keg neck by lugs called “ears” on the
spear body that are held by channels in the neck with a press and twist
action. As a safety measure, in case the lugs work free of the channels, a
spring‐metal retaining ring, also called a circlip, fits into a groove in the keg
neck above the top of the spear, preventing the spear from being ejected by
pressure in the keg. Ejection of the spear is dangerous; it can cause injury to
anyone in its path. The usual reason for spear ejection is tampering with the
spear by customers, perhaps to perform an amateur refill of the keg, or
improper servicing of the keg by workers lacking proper training, tools, or
parts. Everyone who could be involved in filling or servicing kegs should be
trained in the proper procedures and precautions. When working with
returned kegs, extreme caution should be taken. The neck and top of the
spear should be examined for gouges indicating screwdriver damage. The
retaining ring should be examined for damage suggesting prying. Kegs
showing evidence of tampering or improper servicing should be depressur-
ized very carefully so that if the spear is ejected, it will cause no injury.
Workers should be instructed never to put their heads immediately over the
keg neck. Retaining clips are not to be reused. A new high‐quality clip must
be installed each time the spear is removed. The Internet features many
dangerous procedures for working with kegs. Get legitimate training from
an authoritative source.
The spear is attached to the beer dispense system with a keg coupling, a
device that provides gas (carbon dioxide, sometimes mixed with nitrogen)
to the headspace of the keg to drive the beer into the beer line, which is
connected to another fitting on the keg coupling. The coupling attaches to the
outside part of the spear, and a lever on it drives a probe into the spear that
opens the gas and beer valves. A similar fitting is used to fill the keg with
the connection reversed; one opening lets beer in and the other lets gas out of
the keg. When used for beer service, kegs must stand upright.
Kegs are cleaned upside down. Cleaning solutions and/or steam is supplied
from the dispense valve, flowing up the spear and spraying onto the “bottom”
and sides of the keg. During cleaning the CIP solution should be pulsed at
high and low velocities. This change in flow is also required to adequately
cover the spear itself with cleaning chemical. The CIP chemicals or condensate
is removed by the carbonation valve near the neck. After washing, the keg
can then be sterilized with steam and evacuated and pressurized with carbon
dioxide.
There are many types of keg couplings; they differ in the way the coupling
connects to the spear. Each type of coupling is compatible only with a match-
ing type of spear. The most popular coupling in the United States is the type
D although the type G is also employed; many European beers come in
type S kegs. It is most convenient if all the kegs used by a brewery have the
same type of coupling. Filling and cleaning equipment use fittings based on
the coupling configuration.
KEG DETAILS
The top of the Sankey keg has a hole about 50 mm in diameter. A short
tube called the neck is welded to the hole. The spear, which fits into the
neck, has the mating surfaces for the specific type of coupling for that
keg. The top of the spear tube is surmounted by the spear body, which
contains the concentric valves for beer and for gas. The spear body
bears, via the keg seal, against a flange at the bottom of the neck, and it
is secured at the top by threads or ears, so it cannot move up or down.
Figure 11.2A shows the spear assembly in the closed position. The ball
valve is pushed against the gas seal from below by a spring in the spear
tube. A powerful spring outside the tube bears against a locking disk
below pushing the entire spear tube, along with the gas seal, into a seat
in the spear body. As the figure shows, the beer valve and the gas valve
share the same polymer seal, but different surfaces of it couple with the
seat of each valve.
When the keg is placed into service in a dispensing system, a keg
coupling is installed. As shown in Figure 11.2B, a probe in the coupling
pushes down on the beer valve ball, opening the beer valve. A seal on
the probe engages the gas seal and drives the spear tube down against
its spring, breaking the contact between the gas seal and the valve seat,
opening the gas valve. The probe seal separates the gas from the liquid.
Gas enters the coupling from the side, passes through the space created
by the movement of the spear tube, and enters the headspace of the keg
through openings in the spear body. The pressure of the gas drives the
beer up the spear and into the probe, which is connected to the beer
dispense lines. When the lever on the coupling is raised, the probe is
withdrawn, and the springs close the beer and gas valves.
KEGS AND CASKS 335
beer
beer valve ball probe
gas
gas seal probe seal
spear body gas valve spring
beer valve spring

keg seal
gas vent
locking disk
spear tube beer
(A) (B)
Figure 11.2 Keg spear. (A) Closed. (B) Open.
rib
chime
keystone
hole
shive hole
Figure 11.3 Cask.
Casks
Casks are modeled after the wooden barrels from which they originate; some
are still in use. Wooden barrels are discussed in Chapter 10. The most common
capacity for casks is the firkin (9 imperial gal = 40.91 L); a two‐firkin cask is
called a kilderkin; a half‐firkin is a pin. Casks have no internal plumbing; they
are just barrel‐shaped vessels with two openings, the shive and the keystone
holes, as shown in Figure 11.3. The ends of the cask are protected by rails, called
chimes. Casks are usually made of stainless steel or passivated and epoxy‐
coated aluminum, but plastic casks are beginning to appear. The o penings are
named after the fittings that they accommodate. The shive hole, or bung hole,
is on a curved side of the cask. The cask is filled and cleaned through the shive
hole. It is closed with a shive, which is a stopper that has a provision for driving
a hole, called the tut, through its center. The tut releases carbon dioxide and
admits air. It can be fully or partly blocked with a peg, called the spile. Another
opening on a flat surface of the cask is called the keystone hole. The keystone
hole is placed so that when the shive hole is at the top, the keystone hole is near
the bottom of the cask. The keystone hole is closed with a keystone, a fitting
with provision for driving in a tap or faucet to connect the cask to a dispense
system or to deliver beer directly to a glass. The shive and keystone are replaced
each time the cask is filled; they are often disposable. They can be made of
plastic, wood, or metal, sometimes with rubber parts.
Casks are used to prepare and serve cask‐conditioned ale. After fermenta-
tion, the ale settles until the yeast count is correct, usually between 0.25 and
3 million cells/mL. The ale is run into casks through the shive hole. Priming
sugar and a fining, traditionally isinglass or gelatin, are added to the beer either
just before or just after it is put into the cask. The beer is left to ferment for a
time at the brewery, then the shive is driven in, and the cask is delivered at once
to the pub. On arrival the cask is set up, ideally horizontally, with the shive up
and the keystone down on a rack called a stillage, or on wooden chocks. The
cask is left undisturbed to allow the finings to clarify the beer. At the suitable
time, a porous spile is driven through the shive, allowing carbon dioxide to vent
at a controlled rate. After a day or two, the cask is tapped; a spigot is driven
through a thin place in the keystone with a sharp rap of a mallet. Cask ale is not
supposed to be pushed to the serving point by gas pressure; it is either fed by
gravity or is pumped, traditionally by bar‐mounted hand pumps. As beer is
taken from the cask, air enters; thus the cask must be finished before the air
spoils the beer. For casks that are not expected to be emptied within a few days,
it is permissible to use a cask breather, which is a valve that admits carbon
dioxide instead of air. Cask ale is a British tradition requiring a high level of
cooperation between the pub and the brewery. Had it not been for a consumer
movement called the Campaign for Real Ale (CAMRA), cask ale would be a
shadow of its current status. In addition to CAMRA, there is a professional
organization called Cask Marque that provides inspection of and training
about cask ale and other aspects of beer production and service.
Preparing and Filling Kegs and Casks

Kegs are usually filled with beer that has been subjected to a brief high tem-
perature treatment called flash pasteurization, to be discussed in detail
in Chapter 14. Many craft brewers avoid pasteurization; they clarify the beer
by some combination of sedimentation, centrifugation, and filtration and
package it without pasteurization. Casks are filled with unpasteurized, unfil-
tered beer. Before a keg or cask is filled, it must be inspected and cleaned.
The cleaning process is invariably mechanized (although not necessarily
GAS LAWS 337
automated) in the case of kegs. There are mechanized systems for casks,
which can save time and supplies for breweries that have the cask volume to
justify them. The preparation process for kegs follows a series of steps:
1. The keg is inspected for visible damage. The spear body is checked for
tightness and evidence of tampering. The keg is tested to make sure it
can hold pressure. It is unsafe, as well as a waste of money, time, and
beer, to attempt to fill a keg whose condition is questionable.
2. Labels and marking on the outside of the keg are removed. The outside
is scrubbed with hot detergent, often recirculated. The detergent is
rinsed off with a spray of hot water.
3. The keg is mounted upside down on a keg racking machine. The machine
has a fitting that functions like a keg coupling, opening the gas and beer
valves in the spear.
4. The keg is emptied. This process is sometimes called de‐ullage.
Compressed air is driven into the beer port and up the spear. Any beer
remaining in the keg exits at the gas port.
5. A series of washings (caustic and acid) and rinsings are performed. The
cleaning solutions are driven into the beer port up the spear, so they
spray the bottom of the keg. Liquids are driven out the gas port by
compressed air.
6. The keg is sanitized with steam or a chemical sanitizer.
7. The keg is purged with carbon dioxide and then filled with CO2 under
pressure.
8. Beer is driven into the keg against the CO2 pressure.
9. The keg is dismounted and turned right side up. A plastic cover is put on
the spear opening. The keg is labeled with the type of beer, the best by
date, and other required information. A barcode is often used for iden-
tification. This helps with proper tracking of beer lots for consumer
complaints or potential recalls. The filled kegs are placed on pallets and
wrapped with plastic for shipment.
The process is similar for casks, but casks have two openings, so liquids can
go in one and out the other. Also, casks are not usually pressure‐tested, so
sterilization with steam is not possible.
11.2 GAS LAWS
Beer is dispensed under gas pressure. To understand the issues involved in

dispensing beer, we need to look at the universal behavior of gases. Many of
the same issues that apply to packaging beer also apply to beer foam, covered
in Chapter 13.
Ideal Gas Law

The molecules of a gas are so far apart that they barely interact, except for
collisions. In many ways they behave like featureless balls flying about the
container; one molecule acts much like another. Under moderate conditions
of pressure and temperature, a gas follows a universal equation, called the
ideal gas law (IGL) that relates pressure, volume, amount (moles), and tem-
perature. Some consequences of the IGL are that in a fixed‐volume system,
like a closed fermenter or a steam jacket, if the temperature goes up or down,
the pressure follows. If the amount of material in the gas phase goes up or
down, the pressure follows. As an example, if the steam to the heating jacket
of a vessel is cut with no provision for letting air in or out, when the steam
condenses (less gas), the pressure will drop, and the resulting vacuum could
damage the vessel.
The mathematical formula of the IGL is pV = nRT. The temperature, T,
must be the Kelvin (absolute) temperature, which is the temperature in
degrees Celsius plus 273.15 K. R is the gas constant, whose value depends on
the units. The pressure must be absolute pressure (see Section “Direct Draw
Systems” for an explanation of gauge and absolute pressure). If the pressure
is given in atmospheres and the volume in liters, the value of the gas constant
is 0.082 06 L atm K−1 mol−1. If the pressure is in bar and the volume in hectolit-
ers, R = 8.3145 × 10−4 hL bar K−1 mol−1. If the pressure is in pascals and the
volume in cubic meters (pure SI units), R = 8.3145 J K−1 mol−1. The IGL has
limitations that must not be overlooked. It works for gases only. It will not
work for liquids or solids in the presence of their vapors or gases in the pres-
ence of liquids in which they dissolve. Carbon dioxide is delivered as a liquid.
The cylinder pressure does not follow the IGL at all.
IGL EXAMPLE
200 mg of liquid nitrogen (molar mass = 28 g/mol) is vaporized at 25 °C

in a sealed can whose headspace volume is 20 mL. Calculate the pres-
sure, assuming the solubility of nitrogen in the liquid is practically zero.
nRT
p
V
n = (0.200 g)/(28 g/mol) = 0.0071 mol; T = 25 + 273 K = 298 K
p = (0.0071 mol)(0.082 06 L atm K−1 mol−1)(298 K)/(0.015 L)
p = 11.6 atm. Of course, the can will fail before all the nitrogen
vaporizes.
GAS LAWS 339
IGL EXAMPLE
Carbonation is specified by “volumes,” that is, liters of CO2 (measured

at 0 °C and 1 atm) per liter of beer. Calculate the mass of CO2 (molar
mass = 44 g/mol) in 355 mL (12 oz) of beer that is carbonated to 2.7
volumes.
Solution:
V = (2.7 L CO2/L beer) ∙ 0.355 L beer = 0.96 L CO2
PV
n
RT
n = (1 atm)(0.96 L)/(0.082 06 L atm K−1 mol−1∙ 273.15 K)
n = 0.043 mol; mass = 44 g/mol ∙ 0.043 mol = 1.9 g
Dalton’s Law
In a gas mixture, each component of the mixture acts independently of the
others, unless they react. We can use the IGL to calculate a partial pressure
for each gas as though it alone occupied the entire volume. The total pres-
sure of the mixture, which is what the pressure gauge shows, is the sum of the
partial pressures. This is Dalton’s law. An important consequence of Dalton’s
law is that in a gas mixture, the volume fraction is equal to the mole fraction.
For example, 100 total moles of a mixture of 75% nitrogen and 25% carbon
dioxide (by volume) will have 75 mol of nitrogen and 25 mol of carbon
dioxide. For many purposes, a gas at a certain partial pressure in a mixture
exhibits the same behavior as if it were unmixed at the partial pressure.
DALTON’S LAW EXAMPLE
Calculate the mass percent of nitrogen in “beer gas” that is 75% N2 and
25% CO2 by volume.
Solution:
Take 100 mol total, which comes to 75 mol N2 and 25 mol CO2.
Mass N2 = (75 mol) ∙ (28 g/mol) = 2100 g
(continued)
Mass CO2 = (25 mol) ∙ (44 g/mol) = 1100 g
Total mass = 2100 + 1100 g = 3200 g
Mass % N2 = (2100 g/3200 g) ∙ 100% = 66%
Mass % CO2 = (1100 g/3200 g) ∙ 100% = 34%
KH (mg·L–1·atm–1)
Temperature (°C)
Figure 11.4 Henry’s law constant for oxygen.
Henry’s Law
Henry’s law states that the solubility of a gas in a liquid is in direct propor-
tion to the partial pressure of the gas. Mathematically, c = kp, where c is the
concentration, p is the absolute pressure, and k depends on the gas, the liquid,
and the temperature. The solubility of a gas in a liquid always decreases as
the temperature increases. The numerical value of k depends on the units
chosen for concentration and pressure. If the concentration is known, Henry’s
law can be used to determine the pressure. Figure 11.4 shows the Henry’s
law constant for oxygen in water, where the partial pressure of oxygen is meas-
ured in atmospheres and the concentration comes out in mg/L. Table 10.1 pro-
vides carbon dioxide pressures for different carbonation levels at different
temperatures.
HENRY’S LAW EXAMPLE
See package oxygen example in Section “Measurement of Beer

Packaging Quality.”
KEG DISPENSE SYSTEM 341
11.3 KEG DISPENSE SYSTEM
The dispense system is the apparatus that gets the beer from the keg to the
customer’s glass. The beer must arrive with the correct carbonation, at the
correct temperature, with the correct amount of head (foam), and with no
deterioration of its flavor. Even the most skillfully brewed beer can lose its
appeal if the dispense system is not doing its job. The essential parts of a dis-
pense system are the chilling system, compressed CO2, the keg coupling, the
beer line, and the beer faucet. Dispense systems are divided into temporary,
direct draw, and long draw draft systems.
Temporary Draft Systems

Temporary draft systems are used at events like parties, beer festivals, and the
like. Hand pumps permit draft dispense direct from a keg. From a coupler,
the beer is transferred through a vinyl hose to a plastic picnic faucet. Gas pres-
sure for transfer is generated through a hand pump that drives air into the
keg. The major disadvantage to hand pumps is that the air causes the quality
of the beer to deteriorate quickly; hands pumps are only recommended when
the beer will be consumed in a day. An improvement on this design is the
integration of a small, single‐use CO2 cartridge that primes the keg.
Another temporary system, superior to the hand pump, is the jockey box,
commonly used at festivals and other temporary locations. A standard cou-
pler is attached to the keg and to a small, portable CO2 tank. The beer line is
directed through a cooler in which a plate chiller or copper coil is placed in
ice. Faucets for dispense are attached to the cooler wall. The large surface
area of the chiller allows the beer to be cooled in the line during hot summer
months or long events. The cooling capacity of a cold plate is limited; it
should be used for beer that comes from the keg at less than 13 °C (55 °F).
Pressure is controlled with a regulator on the CO2 cylinder. Due to the flow
resistance of the chiller, higher pressure (1.3–2 bar, gauge = 20–30 psig) is
often necessary for satisfactory dispense. For this reason, jockey boxes are
not permanent fixtures, as elevated carbonation levels in the keg would
result. It is recommended that the beer line be set up before ice is added to
the jockey box to prevent excessive chilling, hence excessive carbonation of
the beer.
Direct Draw Systems

In a direct draw system (Figure 11.5), the beer is driven by carbon dioxide at
the pressure that corresponds to the partial pressure of carbon dioxide at the
keg temperature at the correct degree of carbonation. Direct draw is used
only when short draft line distances are possible. A common example of
cooler bar
fan
regulator
beer line
beer faucet
keg coupler
keg
CO2
restraint
Shark Ale
Figure 11.5 Direct draw system for a tap room.
short draw systems in craft breweries or taprooms is the placement of a

walk‐in cooler behind the bar. The faucets are then installed with their
shanks through the wall of the cooler to be easily accessible by the bartender.
In direct draw systems, only 1–1.5 m (4–5 ft) of 5 mm (3/16 in) line can be used
for a balanced system. Longer lines will suffer from pressure loss and slow
dispense rates.
Because of the short distance from the keg to the faucet, the pressure
drop driving the flow is minimal, so the pressure at the faucet will be essen-
tially the same as the pressure at the keg. If this condition is not satisfied,
carbon dioxide will escape from the beer into the line, causing foaming
and undercarbonation. Table 10.1 has carbonation pressures at various
temperatures and degrees of carbonation. The complication is that gas
pressure gauges nearly always read in gauge pressure, which is the pres-
sure difference between the local pressure of the atmosphere and that of
the gas. At sea level, the atmospheric pressure is usually close to 1.01 bar
(14.6 psi). The pressure falls off with elevation at a rate of 0.113 bar per
1000 m (1 psi/2000 ft). The local pressure must be subtracted from the
absolute pressure to get the gauge pressure.
In direct draw systems the service pressure may be too high, causing the
beer to flow too quickly. This can be corrected by attaching a length of nar-
row bore tubing, called a choker, to restrict the flow rate. Unless the faucet
is installed on an outer wall of the refrigerator, the beer line will need to be
kept cool. A flow of air from the refrigerator may be adequate, depending
on the layout. Otherwise a python line will be needed, as described below
under long draw systems.
ELEVATION EFFECT ON GAUGE PRESSURE
Suppose beer is to be served at 2 °C (36 °F) with a carbonation level of

2.5 volumes in Boulder, Colorado (elevation 1655 m = 5430 ft). At sea level,
the gauge pressure would be 1.71 − 1.01 = 0.70 bar (10.2 psig). At 1655 m,
the gauge pressure would be 0.70 + 0.113 bar/km × 1.655 km = 0.89 bar
(12.9 psig).
Long Draw Systems

If the distance or elevation change from the keg to the faucet introduces a
significant pressure change, the dispense system must be designed as long
draw. Figure 11.6 shows a simplified long draw dispense system with gas
mixing. In this system, the primary regulator feeds a manifold with secondary
tank press
cylinder valve
MIXO
manifold secondary
regulator beer line
line press
N2
FOB
gas
CO2 mixer beer faucets
python
gas line
primary
regulator
keg FARBER BARTH
coupler cooling
tank Robust Wee
B Porter Heavy
restraint
safe
kegs
gas
monitor
Figure 11.6 Long draw dispense system.

regulators, allowing different pressures for different kegs. The beers lines
are connected to foam‐on‐beer detectors (FOB detectors) to shut off the
connection to the beer lines when the keg runs out. The FOB detectors keep
the lines from filling with foam, saving beer. The FOB is a float ball valve that
seals when empty. The beer lines, from the cooler to the tap, are kept cool by
a python arrangement, described below.
In a long draw system, extra pressure is needed to drive the beer. If all
the pressure were provided by carbon dioxide, the beer would become
o vercarbonated, so a gas mixture is used. To avoid overcarbonating the
beer, nitrogen, an inert gas, is mixed with the carbon dioxide. The carbon
dioxide maintains the correct level of carbonation, and the nitrogen pro-
vides pressure but does not carbonate the beer. Suppose, for example,
that the required carbonation pressure is 1.71 bar absolute, but we need
2.44 bar absolute to drive the beer through the system at the correct
flow rate (u sually 60 mL/s = 2 fl oz/s). The extra pressure, 0.71 bar, would
be made up with nitrogen. Dalton’s law holds that the pressure fraction
is equal to the volume fraction, so the mixture would be
1.71/2.44 = 0.70 = 70% CO 2. This is not the same as the mixtures typically
used to deliver nitrogenated beer. The mixtures may be provided in a
single cylinder but are often mixed from two cylinders with a gas blender
mounted in‐line.
Because of limitations mentioned below about compressed gases, it may
be convenient to mix pure carbon dioxide and nitrogen on‐site to produce the
appropriate composition. Some facilities use a nitrogen generator to separate
nitrogen from the air for this purpose, rather than purchase it in cylinders.
Each of these options requires additional equipment.
Instead of using blended gas, some systems drive the beer with pumps.
Pumps should be placed between the keg coupler and the FOB detector to
prevent the pump from running dry. For safety, beer pumps are often
powered by a compressed air motor rather than with an electric motor. If
driven by compressed carbon dioxide, the gas must be vented outside.
Designing a dispense system for more than a few nearby faucets is work
for professionals.
Another long draw issue is that the beer spends a long time in the beer
lines. The tubing must be impermeable to oxygen and carbon dioxide. The
main part of a long draw beer line is made of barrier tubing, smoothbore tub-
ing lined with polyethylene terephthalate. Barrier tubing runs the length
from the cooler to the point of dispense. Also, the entire length of each beer
line must be kept cold. This is usually accomplished by running the beer lines
in insulated bundles, each of which has a line carrying chilled coolant (propyl-
ene glycol solution) and a coolant return line. These bundles are called
pythons or trunk lines. The python should be surrounded by a vapor barrier,
especially at any open ends, to avoid condensation.
ABOUT FAUCETS
Beer faucets are the final part of the dispense system. The two major
types are rear sealing, shown in Figure 11.7, and front sealing. In all
faucets, the beer flows when the dispense lever is pulled forward (to the
left in Figure 11.7). The dispense lever rotates around a ball that is posi-
tioned with the ball washer. Above the ball washer is a friction washer
that tightens the dispense lever to keep it from flopping about. Pressure
is maintained on the washers by a nut called the bonnet (not shown).
In the rear‐sealing valve, the dispense lever engages the valve shaft,
which has the valve seal washer at its back end (on the right in the figure).
When the bartender pulls the dispense lever forward, the valve shaft is
pushed back, pushing the washer off the valve seat and admitting beer, as
dispense lever
threads for valve seal

bonnet washer
vent coupling
valve shaft washer
(A)
friction washer
ball washer
shaft nut
threads for
shank coupling
(B)
Figure 11.7 Beer faucet. (A) Closed. (B) Open.
(continued)
shown in Figure 11.7B. Front‐sealing faucets have no valve shaft. The dis-

pense lever has a sealing element that covers the faucet opening when
the lever is pushed back.
The faucet mates with a stout threaded fitting called a shank (not
shown) that seals with the coupling washer. The shank is usually firmly
attached to a panel or tower and enables a connection between the
faucet and the beer line. Shanks come in different lengths; a shank
should be matched to the width of the wall through which it will pass.
A coupling nut (not shown) screws to outside threads on the faucet,
sealing the faucet to the shank. The shank and the faucet have a key
arrangement to keep the faucet from rotating when it is attached. The
back end of the shank has a hose fitting or other means to connect it to
the beer line. Faucets should be removed and cleaned regularly to
prevent loss of beer quality from bacteria and mold.
ABOUT COMPRESSED GASES
Compressed or liquefied gases come in pressure vessels called cylin-

ders or tanks. The gas is packed at a dangerously high pressure. A pres-
sure reduction and control valve, called a regulator, must be attached
to the cylinder to connect it to the brewery’s equipment. Cylinder out-
lets are different for different families of gases; they take different
regulators. This is a safety measure to avoid mixing incompatible gases.
The cylinder outlet configurations in different parts of the world are
different. In the United States, connections conform to the Compressed
Gas Association (CGA). Typical CGA designations are CGA 320
(carbon dioxide), CGA 540 (oxygen), CGA 580 (nitrogen), and CGA
510/346/590 (air). In Germany and some other European countries, the
DIN 477 standard is followed. A US regulator will not fit on a European
gas tank. All compressed gas handling systems should include a pres-
sure relief valve downstream of the regulator to vent the gas safely in
case the regulator fails.
The usual size of gas cylinder used in breweries has a nominal inter-
nal volume of 44 L. Carbon dioxide comes as a pressurized liquid at
about 60 bar (about 850 psi). The cylinder pressure depends only on the
temperature. If any liquid remains in the cylinder, the pressure will still
be 60 bar. The usual size of a carbon dioxide cylinder for a permanent
dispense system holds 23 kg (50 lb). The cylinder pressure gauge will
show the full pressure until the tank is nearly empty. By contrast, a
nitrogen cylinder contains only gas; nitrogen will not liquefy at ordi-
nary temperatures. A full nitrogen cylinder contains about 7.6 kg (17 lb)
at a pressure of about 150 bar (2200 psi). The internal pressure is

proportional to the amount of gas remaining in the cylinder.
Gas mixtures of carbon dioxide and nitrogen are restricted to p
ressures
low enough to prevent the carbon dioxide from becoming a liquid. If
liquid forms in the cylinder, the release of gas becomes a distillation
process. Nitrogen will be enriched in the gas phase and the gas composi-
tion will change as gas is withdrawn. To avoid this, the CO2 partial pres-
sure should not exceed 60 bar. For a mixture of 70% carbon dioxide and
30% nitrogen by volume, the total pressure must be kept below 78 bar.
This is about half the pressure of a pure nitrogen cylinder, hence half the
gas by volume.
Compressed Gas Safety

Safety considerations for gas cylinders are essential for the workplace.
Gas cylinders contain a large amount of energy that can cause per-
sonal injury and property damage if improperly released. In addition,
carbon dioxide is toxic at concentrations above 1%, and nitrogen can
displace air, leading to an oxygen‐deficient atmosphere. The following
guidelines are recommendations for safe handling practices regarding
compressed gas.
Gas cylinders should always be secured with restraints, like straps or
chains. Falling cylinders have caused personal injury by landing on an
employee. Also, if the valve strikes something and breaks off, the cylin-
ders can rocket across a room, causing major damage. To prevent dam-
age when not in use, cylinders should be secured with the supplied
metal cap called a valve protector. The valve protector should always be
in place when the tank is stored or moved and whenever it is not in
service and attached to a regulator. A cylinder is most vulnerable when
a regulator is in place. A fall could damage the regulator and abruptly
release the gas with potentially deadly consequences. When the c ylinder
is to be moved, the regulator must be removed and the valve protector
installed. A specialized hand truck with provision for securing the
cylinder must be used. Rolling the tank for more than a few centimeters
is an unsafe practice.
Brewery and taproom carbon dioxide sources should always be food
grade. “Food‐grade” designation is not about the purity of the gas but
rather the cleanliness of the tank. A new tank of food‐grade gas should
have a shrink‐wrap plastic cover on the tank outlet to prevent contami-
nation. This must be removed before the regulator is installed. All cylin-
ders are to be used with regulators. Although the pressure provided by
the tank may change with contents and temperature, the regulator will
(continued)
maintain a constant pressure at the regulator outlet. The cylinder valve

must never be opened without a regulator in place. The regulator
attaches to threads (outside or inside, depending on the type of gas) on
the tank outlet. The threads drive the mating surfaces of the regulator
and the tank outlet together, but they do not make the seal. Some regu-
lators seal by direct metal‐to‐metal contact of a convex gland with a
concave cup. Some have flat mating surfaces and use a plastic washer to
make the seal. The threads on the cylinder outlet and the regulator inlet
are never part of the seal. Thread compound and thread tape (Teflon®)
must never be used on cylinder threads; they can get into the regulator
mechanism. Because a regulator is a mechanical device, it is subject to
failure. There must be a pressure relief valve not far downstream to vent
the gas safely should this happen.
Gas monitors must be in place in enclosed spaces in which com-
pressed gas is used. For toxic gases, like carbon dioxide, the monitor
should measure the concentration of the gas and should activate an
alarm when the concentration exceeds the limit. For inert gases, the
hazard is displacement of oxygen. Oxygen must be monitored to ensure
a viable atmosphere. The alarm should be activated when the concen-
tration of oxygen is below the acceptable limit. The monitors must be
regularly calibrated with known mixtures to ensure that they are prop-
erly working. In‐line gas monitors are also available. When placed in an
easily visible place between the primary regulator and the secondary
regulator(s), they can be useful to check for leaks or open gas valves.
ABOUT NITROGEN GENERATORS
Nitrogen generators for beer bars operate on either of two principles. In

a pressure swing adsorption (PSA) system, clean, oil‐free, dry com-
pressed air passes at 4–8 bar over particles of carbon molecular sieve
(CMS). CMS is prepared by heating polymers under conditions that give
carbon with a network of well‐controlled pores. The pore size is chosen
so the smaller molecules, including oxygen, can enter the pores and stick
to the internal surface. The larger nitrogen molecules stay outside and
pass through the bed of particles. Selectivity is not perfect, but after mul-
tiple encounters with the CMS, good nitrogen purity can be attained. In
time, the pores fill with oxygen and the efficiency diminishes. The CMS
is regenerated by lowering the gas pressure, allowing the gas inside the
pores to be released. During regeneration, the gas is discarded through a
noise suppressor. Meanwhile, a second vessel is brought up to high

pressure to provide a continuous stream of purified nitrogen. Each ves-
sel is on stream for a few seconds to several minutes, and then it is regen-
erated. Most systems have a buffer tank to hold compressed nitrogen to
level out flow variations. The other type of nitrogen generator relies on
membranes that are selectivity permeable to oxygen. The membrane
takes the form of a bundle of tubes. Clean, dry, oil‐free air enters the
tube under pressure. The oxygen escapes through the wall of the tube
and the nitrogen is retained to exit at the end.
Either type of generator requires a robust, oil‐free compressor and a
manifold to clean and dry the inlet air. Some units are integrated with a
compressor and gas mixing manifold that can be connected to a carbon
dioxide tank. The output of the unit is the appropriate mixture of carbon
dioxide and nitrogen. Nitrogen generators can routinely generate nitro-
gen of 99.7% purity, which is suitable when the nitrogen is to be used only
to maintain dispense pressure. For nitrogenated beer dispense, where
nitrogen dissolves in the beer, a higher purity may be desirable to mini-
mize oxygen pickup. Generators with enhanced purity are available.
Nitrogen generated in‐house is less expensive than nitrogen delivered
in cylinders. Less handling of heavy, bulky nitrogen tanks saves labor
and improves worker safety. About half of the gas cylinders used for
beer dispense can be eliminated if nitrogen is generated on‐site, even
more if the gas had been supplied premixed or if nitrogenated beer is
served. Nitrogen generators can be purchased or leased.
Nitrogenated Beer Nitrogenated beer can provide a long‐lasting head of

very tiny bubbles that is suitable for some styles, primarily stout. The beer has
low carbonation, 1.1–1.7 vol, and a tiny amount of dissolved nitrogen, typically
around 60 mg/L, which comes to 0.05 vol. Nitrogenated beer is driven from
the keg at about 2.5 bar gauge pressure (35 psig) with 25% CO2 and 75%
nitrogen. The faucet for nitrogenated beer has an insert that forces the beer
through holes that provide about 1.4 bar (20 psi) of pressure drop and
introduce turbulence that makes the beer foam. For reasons that we will
discuss in Chapter 13, the resulting foam is composed of very small bubbles
enriched in nitrogen.
Nitrogenated beer gas should never be used to dispense standard beer.
Looking back at the example for the long draw system operating at 2.44 bar
absolute with 70% CO2, if 25% CO2 were used instead, the CO2 partial pres-
sure would be 0.61 bar. This is less than half of the 1.71 bar required to keep
the beer carbonated. If the total pressure were increased to give a CO2 partial
pressure of 1.71 bar, it would come to 6.84 bar absolute, or 5.83 bar gauge
(85 psig). This is enough pressure to blow off the hoses or to knock the glass
out of the bartender’s hand if the hoses stay on.
Canned or bottled nitrogenated beers use a widget to raise foam. The widget
is typically a small plastic hollow ball with a small opening (0.6 mm). When a
beer is bottled or canned, the gas builds up pressure inside of the package. Gas
and beer will enter the widget until pressure equilibrium is reached. When the
package is opened, the pressure in the container quickly drops, but the pressure
in the widget is forced through the small opening. This turbulent jet of gas and
beer from the small widget opening creates a thick head of foam.
11.4 BOTTLES
Glass bottles are viewed as prestigious packaging by consumers. They are

mechanically stiff, making them easy to handle without damage. On the other
hand, they are brittle and shatter into sharp shards that represent a safety
concern. Several product recalls have been required because of potential
glass inclusion from breakage on the packing line. Like other ceramics, glass
is stronger under compression than tension. Unfortunately, the pressure
inside a beer bottle keeps it under tension, so the walls must be thick. Bottles
are heavy, and they take a lot of space to ship, store, and stock. Labels or plas-
tic sleeves are often applied, adding a step to the packaging process.
The most common size for a beer bottle in the United States is 355 mL
(12 oz). European bottles are often 330 mL (11.2 oz). Large format bottles,
called “bombers,” are also routine at 651 mL (22 oz) in the United States or
500 mL (16.9 oz) in Europe. The usual 12 oz long‐neck bottle, shown in
Figure 11.8, is 229 mm (9.02 in.) high and 61.3 mm in diameter and weighs
170 g (6.0 oz). The bottom of the bottle has an indentation called the punt that
strengthens the bottle against the internal pressure. The bottles are sealed
with a crown cap that crimps around a raised bead called the finish at the top
of the bottle. The standard cap has 21 puckers called teeth. The inner surface
that contacts the beer has a polymer liner. The seal is made with a plastic
(PVC) washer in the cap, as shown in Figure 11.9. The cap is applied by bend-
ing down the rim to grip the bottle. The seals on bottle caps are slowly perme-
ated by oxygen, which can cause the beer to go stale. There are caps whose
linings absorb oxygen, potentially prolonging beer stability.
Plastic has been the material of choice for carbonated soft drink bottles but
is uncommon for beer. Polyethylene terephthlate (PET) bottles are used in
some European markets but have yet to take root in the United States. There are
technical issues including the ability of plastic to retain carbonation, to exclude
oxygen, and to withstand pasteurization. Improvements in plastic technology
are ongoing. Some major brands are introducing plastic bottles, especially in
large sizes. It is likely that the market share of plastic will grow as technical issues
are resolved and consumers become accustomed to the new material.
CANS 351
bore
finish
bead
punt
Figure 11.8 Bottle.
liner
seal
tooth
Figure 11.9 Crown cap.
11.5 CANS
About 60% of beer is packed in aluminum cans and 30% in bottles, and 10%
is served on draft. The market share of cans has been increasing at the expense
of bottles. Craft beer has been following this trend more slowly; about 20% of
craft beer is packaged in cans, 50% in bottles, and 30% on draft with the can
segment rising. It is interesting that newer, smaller breweries are packaging in
cans at a much higher rate than larger, established breweries. This is likely the
result of companies who manufacture canning lines with smaller footprints
and lower prices.
In addition, cans have several important advantages for beer packaging.

They are light, about 30 g (1 avoirdupois ounce); they admit no light or oxygen;
their large opening allows rapid filling; they have a shape that can be packed
and shipped efficiently; and, if enough are ordered, they can be decorated
with labeling specified by the brewer, obviating the need for a labeling pro-
cess (Figure 11.10). Alternatively, a sticker or shrink‐wrap label can be applied
to blank cans. Because a can is smaller and lighter than a bottle, more cans can
be shipped and stored in the same space as bottles, reducing freight costs and
maximizing warehouse storage. The disadvantages of cans include a negative
(but fading) consumer perception compared with other packaging options,
concern among some consumers about the epoxy lining material, and the sus-
ceptibility of empty cans to damage in the packaging process. Small breweries
may find it difficult to buy and store enough cans to satisfy a minimum order.
Modern cans are made of an alloy containing about 1% each of magne-
sium and manganese in aluminum. The inside of the can has an epoxy coating
Figure 11.10 Can.

FILLING BOTTLES AND CANS 353
to keep the beer from making direct contact with the metal and corroding it.
The can comes in two parts: the body, which includes the sides and bottom of
the can, and the top, which has a scored opening with a riveted pull tab that
allows the consumer to open the can without a tool. Empty can bodies come
flared at the top to form a flange. The lid edge is bent down to form a hook.
Inside the hook is a thin coating of a latex‐based sealing compound.
11.6 FILLING BOTTLES AND CANS
The bottle and can filling operation in a brewery is easily the most mechani-
cally complex, breakdown‐prone, and exasperating activity in the brewery. It
represents yet another site for beer loss and an essential area for quality
control to ensure the best product possible will enter the market. Before the
bottles or cans arrive at the filling machine, they must be removed from their
pallets; bottles must be unpacked from their boxes; and the bottles or cans
must be rinsed and drained. The filling operation must be carried out at high
speed and precision and in a way that prevents entry of oxygen. Packaged
beer should have no more than 0.2 mg of oxygen per liter (200 parts per
billion). Most brewers try for about half of this. If the beer is flash pasteurized
or sterile filtered, the filling operation must prevent the entry of microbes.
Bottle and can packaging follows similar concepts with slightly different
technical processes due to differences in the package.
The following are the typical steps of a packaging system in order:
1. Depalletize
2. Rinse
3. Fill
4. Pasteurize
5. Label
6. Pack
7. Palletize.
Depalletizing/Uncrating
Bottles arrive at the brewery on pallets that are moved about with fork lifts.
Most countries have regulations requiring that all employees who will oper-
ate fork lifts be trained by an accredited organization to operate them safely.
New, non‐returnable bottles arrive at the brewery in cardboard trays stacked
on pallets. The pallets are loaded onto a conveyor and carried to the depalletiz-
ing machine. The machine grips an entire layer of trays and places them on a
conveyor to the uncrating machine. Alternatively, the entire row of bottles is
pushed forward onto a conveyor, and the entire pallet is then raised into posi-
tion to transfer the next row. The cardboard trays are often removed by an
automated suction cup device to be saved and returned to the glass supplier.
Cans are arranged on pallets in layers separated by sheets of cardboard.
Some facilities receive bottles prepacked in branded boxes. This requires
an uncrating machine to remove the bottles from the box. The uncrating
machine has an array of grippers that pick up all the bottles in a tray. The grip-
per lifts the bottles clear of the trays and moves them from a conveyor to the
bottle sprayer.
Rinsing
After depalletizing, the package must be rinsed free from any dust or debris.
Can bodies from the depalletizer are herded along the conveyor between
rails until they travel single file. At this point, the conveyor takes the form of
a wire cage constraining the can. The cage twists to turn the cans upside down.
The insides of the cans are rinsed with a spray of water. Another twist of the
cage brings the washed cans to the upright positions for filling.
Bottles from the uncrating machine are herded into lanes and conveyed to
a row of devices that grip each bottle and invert it. For new bottles, a jet of
clean water, possibly containing a sanitizer, removes any dust. For returned
bottles, a much more elaborate cleaning procedure with dedicated equipment
is needed. The process includes label removal, soaking, hot chemical cleaning
using a high‐pressure jet, and several stages of rinsing. This practice is not
common in the United States.
Both returned and new empty bottles may be subjected to computerized
inspection to look for defects in or damage to the glass. The rejection rate for
returned bottles is typically around 2%. Potential defects in glass bottles
include:
• Split finishes with vertical cracks around the seam.

• Blisters caused by bubbles or air pockets in the glass.
• Inclusions of foreign material.
• “Bird swings” or glass webs, which are threads of glass across the interior.
• Variations in glass thickness caused by irregular glass distribution.
Filling
Fillers for bottles or cans can take the form of a rotating carousel with mul-
tiple fill heads, parallel in‐line units each with a single head, or manual units
in which the packages are mounted and removed by an operator. An over-
view of the filling operation is shown in Table 11.2. Bottles are usually lifted
TABLE 11.2 Filling Sequence

Bottles Cans
1 Center and seal bottle to filler head Center can at filler head
2 Evacuate air from bottle (some
systems)
3 Purge bottle with CO2 Purge can with CO2
4 Repeat steps 2 and 3 (some Seal can flange to filler head (pressure
systems) from above)
5 Fill bottle with CO2 to equalize Fill can with CO2 to equalize pressure
pressure
6 Fill bottle with beer; beer pushes Fill can with beer; beer pushes out CO2
out CO2
7 Any bubbles allowed to rise Any bubbles allowed to rise (settling)
(settling)
8 Lower CO2 pressure to Lower CO2 pressure to atmospheric
atmospheric (snifting) (snifting)
9 Jet with deaerated water to foam Blow CO2 across the top
10 Cap the bottle Cover the can and seam on the lid
11 Rinse any beer or foam from the Rinse any beer or foam from the
bottle, dry can, dry
into filling position, rather than the filler heads moving to the bottles. For
can filling, the head often comes down over the can to minimize movement
of the more fragile aluminum can. Most filling systems use counterpressure
for filling, whereby the container is first pressurized to the same pressure as
the beer to avoid foaming and loss of carbonation. Beer is then transferred
only by gravity with the headspace gas in the bottle transferred back to the
headspace in the filler.
Bottle fillers may deliver the beer through a tube that goes all the way to
the bottom of the bottle, called a long‐tube filler, or through a short tube with
a deflector that directs the beer down the walls of the bottle, called a short‐
tube filler. These devices are designed to regulate fill height. For long‐tube
fillers, the filling of the bottle stops once the bottle is filled completely.
Removal of the long tube then displaces a certain volume of beer in the
package. The displaced volume by the tube is exactly the headspace volume
in the bottle. A short‐tube filler stops filling when the beer reaches the vent
tube, blocking the transfer of CO2 back to the tank. Without the ability to
displace the gas, the beer stops filling. The vent tube is placed at the height
required for final fill height.
Cans are filled through multiple short tubes to take advantage of their
wider opening for rapid filling. Some can fillers include a simple ball float
valve to regulate the fill height. When the ball floats on the rising beer, it seals
the gas transfer valve, stopping the transfer of liquid. Mechanically raising or
CO2
gas
valve
beer
fill valve
inlet
snift
vacuum filling tube
bell
Figure 11.11 Filler head, simplified.
lowering the float valve regulates the fill height. Specified volume filling can
be by accomplished through direct volume control by delivering the beer
from a straight‐sided doser that has a constant inside area, so the level of the
beer is a true measure of the volume. A level sensor in the doser controls the
start and stop of the fill. Another method is to deliver beer at a defined flow
rate. The fill is then regulated by flow time. Figure 11.11 shows the functional
parts of a bottle filler head.
Bottles and cans must be accurately filled to avoid shorting the customer
and for accurate government reporting. In advanced fillers, a sensor is used to
scan the exact fill height of a package. Inappropriately filled containers are
rejected and pushed out of the line. In smaller or more manual fillers, fill
height is simply checked by weight through random sampling.
At the end of the fill step, the counterpressure is released, an operation
called snifting. Immediately after filling, the beer is at risk for entry of air
from the surrounding environment. To remove air from the neck and to
prevent oxygen pickup by the beer, a jet of deaerated water is shot into the
opening. Such agitation causes immediate CO2 nucleation and foaming. The
foam displaces the air with CO2. At this point the package is immediately
sealed before excessive beer is lost to foam.
The capper or seamer can either be part of the filling unit, or it can be
located very close, so the package is closed within a few seconds of filling.
Crown caps are supplied in bulk. The capper must organize them to face the
correct direction. The cap is placed on the bottle, and a cone‐shaped bell
crimps it against the finish of the bottle (see Figure 11.8). Can lids come in
stacks with the lids oriented in the same direction. The lid is usually dropped
onto the can as it leaves the filler. The full can with its lid then moves into a
seamer that seals the lid with two operations, one to wind the can body flange
and the lid hook around one another and the other to flatten and seal
the seam. Details of the seaming process are given in the box “SEAMING
A CAN.” Caps and lids are not ordinarily sanitized at the brewery. They must
be handled with precautions to prevent contamination. Cappers and seamers
require cleaning and sanitation.
SEAMING A CAN
After a can is filled, the lid is sealed in a two‐operation process called

seaming, shown in Figure 11.12. The lid is placed on the full can, which
is brought to a platform on the seaming machine. The platform raises
the can into the seaming head. A disk‐shaped tool, called the chuck,
first operation roller

chuck
flange
sealing compound
lid
(A) can body
(B)
second operation roller
(C)
Figure 11.12 Seaming a can. (A) Section view of sealing surfaces of can in
seaming head. (B) First seaming operation. (C) Second seaming operation.
(continued)
engages the lid and serves as the anvil for the seaming process. Another
disk‐shaped tool, called the first operation roller, approaches the clo-
sure from the side. The roller has a rounded groove that engages the
can body flange and lid hook, as shown in Figure 11.12A. In the first
seaming operation, the roller presses the flange and hook into a loose
spiral, as shown in Figure 11.12B. The can and the roller spin so
the entire circumference of the can is subjected to the first operation.
The first operation roller is withdrawn, and the second operation roller
approaches. This roller has a groove with a shallower profile than the
first roller. It presses the seam flat, completing the seal, as shown in
Figure 11.12C. The roller and chuck are withdrawn, and the platform
lowers to discharge the sealed can.
Labeling
After the beer is sealed in its primary packaging, the bottles or cans may be
subjected to a pasteurization tunnel. Pasteurization is covered in detail in
Chapter 14. After pasteurization, bottles will need labels. In addition, all
packaging needs batch identification and date (packaging or expiration date).
This is usually printed with an ink jet printer directly on the neck of the bottle
or the bottom of the can.
Labels must stand up to handling and condensation. They must be applied
accurately to give a professional appearance. Labelers are mechanical devices
that must repeatedly and accurately perform a complex sequence of actions.
The two main types of labelers are glue applied and pressure sensitive. Glue‐
applied labelers are more complex, because they must handle glue as well as
labels and bottles. The labeling process for glued labels is less expensive than
that for pressure‐sensitive labels. Also, there are more choices in the type of
adhesive to use. Glued labels can be applied to cold or wet bottles, with the
correct type of glue. In many operations, the bottles are dried quickly by air
knives before labeling to remove post‐filling rinse water. Pressure‐sensitive
labels can give refined effects, for example, the label can be printed on a trans-
parent background giving the impression of printing directly on the glass.
A typical rotary, glue‐applied labeler has two rotary tables: the machine
table and the container table. The machine table has the label magazine, the
glue roller, and several paddles called gluing pallets. When the motion of the
table brings a pallet to the glue roller, glue is applied. Usually the glue is
applied in a pattern of lines. The pallet with glue moves to the magazine,
which applies a label to it. The pallet with the label now applied continues to
travel until it reaches the gripper cylinder, which transfers the glued label
from the pallet to a bottle on the container table. The gripper cylinder has
fingers that pick up the label through indentations in the pallet. It then carries
the label to the bottle. The bottle moves to the next station where rollers or
brushes press it to the bottle. Some labelers use hot‐melt glue applied directly
to the bottle. In this case, the bottle itself acts as the pallet, accepting glue
from the glue roller and labels from the magazine. Some labelers have a pro-
vision to add batch information to each label. Label application should be
checked throughout the packing process to ensure consistency.
Cans are usually preprinted with labels by the bulk supplier. The major
drawback for small brewers is that the typical minimum order is about 200 000
cans, all with the same labeling. This comes to about 7000 hL of beer. For a
moderate‐size craft brewery, this can be more than 10% of annual output.
There are secondary suppliers that can provide shorter labeling runs, at a sig-
nificant increase in price. Smaller canning operations use unlabeled cans with
labels applied as described above or even potentially by hand. Unlabeled
packaging provides more flexibility to use the package across multiple brands.
Secondary/Tertiary Packaging
Packaged beer is shipped in boxes or cases. The cases are usually printed
with the design theme of the brewery and of the beer brand. Often the bot-
tles or cans are restrained in units of four or six within the case. Packaging
for the packages is secondary packaging. The standard case for bottles holds
24 units. Beer case blanks come flattened with only the side seam glued. They
are erected and glued at the bottom, usually with hot‐melt. A packer with
gripper heads picks up the bottles and places them in the open case.
Alternatively, a drop packer gently drops the bottles into the case with as
little mechanical agitation as possible. Another unit glues and closes the
case. Sometimes bottles are packed in cardboard multipacks, usually six
packs. The familiar cardboard bottle carriers are open at the top. They can be
set up in the case before the bottles are inserted. When multipacks are not
used, cardboard separators may be placed into the case to prevent the bot-
tles from rubbing against one another. Another way to prepare the case is to
first stage the cans or bottles and then to wrap the case blank around them.
This method provides tighter packaging, allowing bottles to be packaged
without multipacks or separators.
Cans do not come in carrier packs, and cardboard separators are not
used. Often cans are restrained in a plastic web called a six‐ or four‐pack
ring. The rings are stretched onto the cans over cones that allow the rings to
clear the seam and grip the neck of the can. The cans, with or without rings,
are packed into cardboard boxes. Alternatively, the cans can be placed on
open cardboard trays.
Tertiary packaging refers to assembling consumer‐sized cases into larger
units for shipping. This is also referred to as palletizing. The cases are usually
stacked on pallets to a maximum of about 1000 kg (2200 lb). The cases must

be secured to one another and to the pallet with strapping tape or shrink
wrap. This prevents dangerous and expensive accidents resulting from inevi-
table shifts in the load. Beer packaged in kegs or casks also needs secondary
packaging. Kegs and casks should be stacked on the pallet no higher than two
layers. As with cases, they must be secured to the pallet and to one another.
Packaging Line Design

Bottles and cans are carried by a conveyor system through each of the key
steps of the packing process. Stainless tabletop conveyors are used in many
industries but are not commonly used for beer, because they require lubrica-
tion to reduce bottle‐to‐conveyor friction and drag. Plastic tabletop or mat‐
top conveyors are more common because they do not require lubrication.
Belted or roller conveyors may be used for transportation of secondary pack-
aging. Package conveyor systems should include accumulation tables.
Accumulation before or after a certain process is needed to allow continued
operation of other machines. To stop the entire bottling line in the event of
one malfunction would be very costly and hard on the machines.
Each packaging operation should be capable of slight increases or
decreases in speed through a variable frequency drive. The primary machine
in any packing operation is typically the filler. The speed of the filler is the
metric upon which the rest of the line is designed. Typically, the further from
the filler, the faster the equipment should be running. This “v‐curve” design
allows the line to continue operation in the event of a small stoppage. For
example, the machines upstream of the filler can speed up after a stop in
order to catch up to the filler and to ensure the filler always has bottles to fill.
The machine downstream of the filler can speed up to ensure the filler always
has space for bottle discharge. In a hypothetical scenario to further illustrate
the v‐curve, suppose the depalletizer runs at 400 bpm (bottles per minute),
the rinser at 300 bpm, the filler at 100 bpm, the labeler at 200 bpm, and the
packer at 300 bpm. If one operation fails, slight adjustment to speed of the
others will ensure the filler maintains operation. Here the use of accumula-
tion tables in between each operation is critical. Efficient operation of a pack-
aging line will minimize downtime and maximize efficiency.
11.7 BEER SERVICE AND PACKAGING QUALITY
Beer Dispense Quality

Hygiene The key issue in beer dispense quality is hygiene. All parts of the
system that contact beer must be cleaned and sanitized on a regular schedule,
generally every two weeks. Long, elaborate draft systems are more difficult
BEER SERVICE AND PACKAGING QUALITY 361
and expensive to clean. The system should be designed for minimum length.
This will save time, chemicals, and beer. Cleaning solutions are necessarily
corrosive. Worker training and equipment must be in place to minimize the
frequency and severity of accidents. Perhaps the most important safety
precautions are procedures that eliminate any possibility of inadvertently
delivering cleaning chemicals to a customer’s glass. Many bars use outside
vendors to clean their beer dispense systems.
Microbial contamination can jeopardize the quality of beer at the point of
dispense. Beer dispense lines are a common source of off‐flavors, as certain
bacteria can take up residence in the line by forming biofilms. Routine clean-
ing every two weeks as described above should prevent unwanted bacterial
growth; otherwise the lines will need to be replaced. ATP luminometer
testing, as discussed in Chapter 14, can also reveal the presence of microbes
at various points in the system. Another issue in draft lines is transfer of beer
flavors especially after changing from one style to another. For example, a
cinnamon‐spiced winter warmer is followed by a pilsner. The pilsner will
likely suffer from cinnamon contamination. If flavors from strongly flavored
beer are turning up in mildly flavored beer, the beer lines should be replaced.
The Draught Beer Quality Manual, cited below, has detailed recommenda-
tions for beer line cleaning and maintenance.
Gas Leaks
WARNING: A carbon dioxide or nitrogen gas leak can be a deadly hazard in
a poorly ventilated space, like a keg cold room. When a leak in an enclosed
space is suspected, the atmosphere should be checked for breathability with a
gas monitor. The maximum allowable carbon dioxide concentration is 1% by
volume; the minimum required oxygen concentration is 19.5%.
Gas leaks can injure workers, waste gas, cause unexpected interruptions in
service (always at busy times), and cause the pressure in parts of the dispense
system to be lower than intended. Low pressure can lead to slow, foamy
dispense, beer loss, and a bad customer experience. The main challenge in
repairing leaks is to find them. This is done in a step‐by‐step methodical pro-
cedure using the regulator gauges.
Close all keg couplers (pick their handles up). Open the valves from the
regulator to the manifold. If the system has secondary regulators, set them to
deliver their normal pressure. Open the gas supply valve. Set the main regula-
tor to deliver its normal pressure. Close the gas supply valve. The entire gas
system is now pressurized, but there is no new source of gas. If gas is leaking,
the reading on the upstream pressure gauge will decrease slowly as gas
escapes through the leak. If the upstream pressure is steady for at least five
minutes, there is no leak in the line. This does not account for leaks in the
couplers or kegs, once they are engaged.
If a leak is discovered, the exact source can be determined by applying

soapy water to fittings that may be leaking. Bubbling will reveal the source of
the leak. The usual problem is the high‐pressure fitting connecting the regula-
tor to the supply. Check the washer (for a CO2 regulator) or the gland (for a
nitrogen regulator). This check should be performed whenever a tank is
changed or other actions are performed on the high‐pressure side of the
regulator.
Measurement of Beer Packaging Quality

Packaging affords many opportunities to ruin good beer. The filling equip-
ment must be designed to be easily cleaned and sanitized. The staff must be
well trained and committed to quality. There are several tests that can help
maintain and check consistency in packaging quality. Not included here is
microbiological testing, which is covered in Chapter 14.
Measuring Carbon Dioxide Carbon dioxide is a primary flavor component.

Many brewers measure CO2 in every batch, either at the bright beer tank, in
the package, or both. In either case, a sample must be obtained with no loss of
pressure, and the CO2 levels must be consistent for the style. Samples for
measurement of carbonation in packaged beer are obtained by piercing the
package. Bottles are pierced through the cap; cans are pierced through the
bottom. The usual method for CO2 analysis is to fill a pressure cylinder with
the beer, shake it to establish gas–liquid equilibrium, and measure the pressure
and temperature. The carbonation level, in volumes, can be read from a table
like Table 10.1. Oxygen at 200 ppb will give 0.16 mL of gas per liter of beer at
room temperature. Nitrogenated beer at 30 ppm will give 27 mL of nitrogen
gas. The normal carbonation level for beer is over 2000 mL gas per liter.
Several proprietary methods are available that claim to be more selective
for carbon dioxide in the presence of other gases. One method is to increase
the volume of a pressure/vacuum vessel containing a fixed sample of beer
(volume expansion method), and another is to collect gas through a mem-
brane and measure the thermal conductivity.
Measuring Package Oxygen The usual limit for total package oxygen
(TPO) is 200 μg/L (200 ppb w/v). Less is better. A major problem with
measuring package oxygen is that inadvertent exposure to the atmosphere
will cause erroneous results. Air contains about 270 000 μg/L of oxygen.
Sampling for oxygen should be conducted with a piercing device, as discussed
above, to avoid introduction of oxygen during sampling.
Another sample collection problem is that oxygen in packaged beer has
two phases: a solution phase (in liquid beer) called dissolved oxygen and a gas
phase (in the headspace) called headspace oxygen. If the sample is mixed well
by shaking, the concentrations of oxygen in the two phases will be related by

Henry’s law. In a newly filled bottle, the phases have not yet come to equilib-
rium, so the concentrations of the gaseous headspace and the dissolved gas in
beer are independent. It is important to take these measurements immedi-
ately after filling; otherwise the concentrations will approach equilibrium.
The sum of the headspace oxygen and the dissolved oxygen is the total pack-
age oxygen (TPO). A comparison of TPO and the individual measurements
for the headspace and dissolved oxygen at packaging can be helpful to isolate
sources of oxygen pickup. Excessive headspace oxygen suggests issues in the
filling operation. Dissolved oxygen implicates processing after the fermenter
up to the bright beer tank, including filtration and centrifugation.
Oxygen meters usually measure dissolved oxygen; they operate on
one of two principles. The electrochemical oxygen sensor has a membrane
that is selective to oxygen. Electrical pulses are sent to contacts that can
interact with any oxygen. The oxygen drives the electrochemical reaction
O2 + 2H2O + 4e− → 4OH−, where e− represents an electron. The electric cur-
rent is a measure of the oxygen present. A major advantage of the electro-
chemical sensor is that a single sensor can measure dissolved oxygen in the
range from 0 to 200 ppm, easily covering the dissolved oxygen expected in
pitching wort (8–15 ppm) and in packaged beer (20–200 ppb). A disadvan-
tage of the electrochemical sensor is that it consumes the oxygen, so the
measurement drifts down with time. The electrochemical sensor requires a
good deal of maintenance.
The fluorescence quenching detector has a fluorescent polymer, one side
of which is in contact with the fluid being measured. Blue light shines on the
other side of polymer. When no oxygen is present, the polymer absorbs
the blue light and releases red light. When oxygen is present, it suppresses the
production of red light, a process called quenching. Less red light means more
oxygen. The optical sensor is fast and resistant to interference and drift; it
requires minimal maintenance. The major disadvantage is that different
probes are needed for the different ranges of oxygen concentration in wort
and packaged beer.
CALCULATING DISSOLVED AND HEADSPACE OXYGEN
To calculate dissolved oxygen (DO), headspace oxygen (HSO), and

total package oxygen (TPO), the dissolved oxygen must be meas-
ured before shaking (DOstill) and after shaking for five minutes
(DOshake). The sample temperature must also be measured. The mass
of dissolved oxygen in mg, before or after shaking, is the dissolved
oxygen concentration in mg/L multiplied by the liquid volume in
(continued)
L. DO after shaking is related to the headspace oxygen by Henry’s

law: DOshake = KH × pressure (atm), so the partial pressure of oxygen
in the headspace will be pressure = DOshake/KH. The mass of oxygen
in the headspace is determined by combining this with the ideal
gas law:
pV
n
RT
The moles are multiplied by 32 000 mg/mol, the molar mass of O2; the
volume is divided by 1000 to change milliliters to liters; and
R = 0.082 06 L atm K−1 mol−1, the gas constant, leading to
390 DOshake VmL

massmg ,
K H tC 273.15
where DOshake is the measured oxygen concentration in milligrams per

liter after shaking, Vml is the headspace volume in milliliters, KH is
Henry’s law constant from Figure 11.4, and tC is the sample temperature
in °C. The total package oxygen mass is the sum of the masses (not
concentrations) of dissolved and headspace oxygen. The total package
oxygen mass is the same before and after shaking, so the before‐shaking
headspace oxygen is the difference between the total package oxygen
mass determined after shaking and mass of dissolved oxygen before
shaking. TPO concentration is the total package oxygen mass divided
by the volume of beer.
Example: A can with 355 mL (=0.355 L) of beer and 20 mL of headspace

has 185 ppb dissolved oxygen at 5 °C before shaking and 155 ppb after
shaking. Calculate the total package oxygen and the headspace oxygen
before shaking.
Solution:
Set up a table to organize the calculation.
Before Shaking After Shaking

Dissolved A measured conc × volume B measured conc × volume
Headspace C total – dissolved D equation
Total E same as after shaking F sum dissolved + headspace
A: Dissolved oxygen before shaking is the concentration times the volume

(185 ppb = 0.185 mg/L): 0.355 L × 0.185 mg = 0.066 mg.
B: Dissolved oxygen after shaking is the concentration times the volume:
0.355 L × 0.155 mg/L = 0.055 mg.
D: Headspace oxygen after shaking is determined from the equation
above, where KH at 5 °C is 64 mg/L/atm, from Figure 11.4. The
equation gives 0.068 mg oxygen in the headspace.
F: TPO is the sum of B and D: 0.055 mg + 0.068 mg = 0.123 mg. On a
per liter basis, this comes to 0.123 mg/0.355 L = 0.346 mg/L = 346 ppb.
E: Same as F.
C: E − A: 0.123 mg − 0.066 mg = 0.057 mg.
The results are summarized in the table below.
Before Shaking After Shaking

Dissolved A 0.066 mg B 0.055 mg
Headspace C 0.057 mg D 0.068 mg
Total E 0.123 mg F 0.123 mg
TPO conc 346 ppb 346 ppb
Closure Testing For crown caps, the diameter of the crimped cap is
measured as an indication that the correct crowning force was applied. The
crimp tester is simply a plate with several holes that differ in diameter by
0.1–0.2 mm. Some gauges are go/no‐go gauges. These have a series of holes
that span the crimp size specification range. If the small no‐go holes will
accept the cap (too tight), or the large no‐go holes will not accept the cap (too
loose), the crimp is out of specification. Small crimps may be excessively tight,
leading to damage to the glass upon opening. Large crimps are too loose and
may leak or admit oxygen.
Can seams are made in two operations. The accuracy of each of the seam-
ing operations should be regularly evaluated. The seam dimensions may drift
because of wear on the parts or adjustment issues. If not corrected, seam
failure may result. The thickness of the seam after the first and second opera-
tions is specified by the can manufacturer. To measure a first operation seam
thickness, the seaming machine must be operated manually, and a can must
be taken out after the first operation only. Any can from production may be
used to measure the second operation seam thickness. Figure 11.13 shows the
seam thickness dimension on a filled can. It is possible to measure seam
Figure 11.13 Seam thickness.
thickness with an ordinary micrometer or Vernier caliper, but the measure-

ment is faster and more accurate with a special type of micrometer caliper
with a narrow gap and a short measuring screw that can easily grip the seam.
The dimensions of internal parts of the seam can be measured by disas-
sembling the seam. This is manually performed with a metal snipper. The lid
is cut off and torn away, leaving the lid hook still engaged to the body flange.
A cut is made through the seam, so the lid hook can be removed. Manual
teardown is tedious and potentially dangerous because of the sharp metal
edges. Care should be taken to avoid distorting the seam. There are devices
that attach to a drill press to tear down a can in seconds. Another method is
to use a very sharp saw to make slots in the wall of the can through the seam.
This provides access to a side view of the seam. Measurements can be made
with image analysis optics and software.
1. What are kegs and casks? How are they used?

2. What are the distinctions among the various Sankey coupling types?
3. Calculate the mass of oxygen and nitrogen in a 355 mL sample of air
(21% oxygen, 79% nitrogen) at 1.01 bar and 22 °C.
4. What is the function of FOB valves? How can they save money?
5. What is the role of nitrogen in dispensing beer that is not nitrogenated?
6. Describe the various temporary draft systems. What sort of events are
each type most suitable?
7. What are primary, secondary, and tertiary packaging?
8. Describe tests to evaluate the quality of the seals on bottles and cans.
CASE STUDY 367
9. How is a sample obtained for package oxygen measurement?

10. A partially used keg is returned to the brewery. Describe how the ullage
is removed and the keg is refilled.
11. List in correct order and describe the function of each step in a small
pack packaging line.
12. Regarding packaging line design, what is meant by the “v‐curve?” Why
is this design optimal?
13. What is the typical TPO threshold for packaged beer?
14. Dissolved oxygen concentration is measured at 9.0 °C after shaking in
bottles with 355 mL of liquid and a headspace volume of 18 mL. DO
after shaking is 125 ppb. Henry’s law constant is 59 mg/L/atm. Calculate
TPO in ppb.
CASE STUDY
Case Study 1
You work in the quality assurance lab for a packaging brewery with an annual
production of 50 000 bbl. During a bottling run on Monday, you sampled sev-
eral bottles off the line, from start to finish. The TPO was around 800 ppb for
all of them. On Tuesday, you repeated the tests on a second bottling run, and
again, all beers measured a TPO of 800 ppb. Explain how you will evaluate,
identify, and solve the problem.
Case Study 2
eral bottles off the line, from start to finish. The TPO increased slowly during
the run, starting out below 100 ppb at the start but approaching 1 ppm by the
end. On Tuesday, the same trend was observed. Explain how you will evalu-
ate, identify, and solve the problem.
Case Study 3
eral bottles off the line, from start to finish. The TPO in the first bottles was
1 ppm, but shortly after, the remaining bottles were 200 ppb. Explain how you
will evaluate, identify, and solve the problem.
BIBLIOGRAPHY
Barth R. 2013. The science of carbonation. Zymurgy 36(6):65–69.

Bates S. 2006. Bottle Shop Operations. In Ockert K (editor). Fermentation, Cellaring,
and Packaging Operations. Master Brewers Association. ISBN 0‐9770519‐2‐7.
Brewers Association Technical Committee. 2017. Draught Beer Quality Manual, 3rd ed.
http://www.draughtquality.org.
Bückle J. 2009. Labeling. In Eßlinger HM (editor). Handbook of Brewing. Wiley‐
VCH. ISBN 978‐3‐527‐31674‐8.
Hornsey IS. 1999. Brewing. Royal Society of Chemistry. ISBN 0‐85404‐568‐6.
Seaman R. 2015. How Can We Improve Our Packing Line Efficiency? Presentation at
the Master Brewers Association of the Americas Eastern Technical Conference,
October 23. Philadelphia, PA.
Chapter 12
FLAVOR
Beauty is in the eye of the beer holder. This phrase captures the subjective
nature of enjoying a beer. Brewing is largely about flavor, getting the desired
flavor, protecting the flavor, and verifying the flavor. But flavor can vary
between individuals. Different people may have different thresholds for
perception of certain molecules. Flavor sensations are extremely prone to
bias or external influence.
There are three components to flavor, taste, aroma, and mouth feel. These
components are often processed together in the brain to generate a single
composite flavor sensation. There are hundreds of distinct molecules that
contribute to beer flavor. The purpose of this chapter is to understand the
perception of flavor and to identify the most prominent molecules responsi-
ble. Though sensory training is necessary to fully master the ability to isolate
and detect flavor flaws in a product, this chapter explains the derivation of
the most common beer flavors.

369
370 FLAVOR
12.1 FLAVOR ANATOMY AND CHEMISTRY
Taste
Taste is a chemical sense that responds to dissolved substances in the mouth.
Gases can only be tasted if they dissolve. Taste is sensed by taste receptor
cells in structures called taste buds (Figure 12.1). There is a pore in each taste
bud to give the receptor cells access to the liquid in the mouth. The receptor
cells are connected to neurons (nerve cells) that are connected indirectly (via
cranial nerves) to the brain. Each type of taste has its own receptor cells.
There are five currently recognized tastes: sweet, sour, salty, bitter, and umami
(meaty or brothy taste like monosodium glutamate).
The sweet taste is evoked by sugars. Most sweet sugars normally present in
beer wort are removed by fermentation. The most concentrated sugar in fin-
ished beer is maltotetraose (four‐glucose units) followed by maltotriose (three‐
glucose units) typically present at the level of about 5 g/L (ppm) in lager beer
and 10 g/L in ale. These sugars are not very sweet. The concentration of sucrose
(table sugar) that would give the same sweetness would be 1–1.5 ppm. Evidently
the sugars present in beer do not account for significant perceived sweetness. It
is likely that most beer characterized as sweet has aromas associated with sweet-
ness, rather than a true sugary taste. Lactose, which is 16% as sweet as sucrose,
has found favor as an adjunct to sweeten the beer. Lactose is unfermented by
yeast so it is retained in the finished beer. Because some people are lactose
intolerant, any lactose additions should be clearly noted on the beer label.
The sour taste is evoked by acids, which are compounds that release the
hydrogen ion (H+). The situation is complicated; the rank ordering of various
Figure 12.1 Taste bud. Source: From Barth (2013). Used with permission.
FLAVOR ANATOMY AND CHEMISTRY 371
O
H
H3C
C
C
OH
HO
Figure 12.2 Lactic acid.
acids does not follow pH or amount of acid. Standard finished beer typically
has a pH in the range of 3.9–4.3. Most consumers would not consider it to be
sour. Sour (“tart”) beer styles have pH in the range of 3.3 (very sour: new
lambic) to 3.6 (Berliner Weisse). Sourness in these styles comes mostly from
lactic acid (Figure 12.2), traditionally introduced by bacterial fermentation.
For safety, beer must have a pH of 4.6 or lower.
The bitter taste is evoked by many natural compounds with no evident
chemical similarity. There are at least 40 different bitter receptors. For over a
thousand years, bitterness has been a primary flavor in standard beer. The
most important bitter compounds in beer are the iso‐alpha acids derived
from hops, shown in Figure 8.11.
The salty taste is stimulated by sodium ions. Other alkali metal ions may
taste salty, but the further away on the periodic table they are from sodium,
the less they are perceived as salty. The concentrations of salt in brewing
liquor should not be high enough to elicit a flavor, except that pronounced
salt additions are common in gose‐style beer. Human perception of sodium
occurs around 250 ppm. Levels approaching this salinity can create a slick
minerality perception on the palette. Levels at or exceeding 250 ppm will taste
salty. Excessive sodium has a negative effect on yeast growth and viability.
Umami (glutamate) tastes are seldom important in beer.
Aroma
Aroma, or the olfactory sense, is a chemical sense that responds to molecules
in the gas phase. The olfactory receptors in humans are located at the top of
the nasal airway, just below the brain case. Aroma compounds (“odorants”)
can arrive through the nostrils (orthonasal), or they can drift up from the
mouth and throat (retronasal). Retronasal aroma is a key component of fla-
vor. Consider what happens with a cold and severe nasal congestion. The abil-
ity to taste food is lost. The next time you sip a beer, pinch your nose closed to
illustrate the effect. Blocking the nasal cavity blocks flavor perception from
aroma. However, it does not block the taste receptors, the perception of salty,
sweet, sour, bitter, or umami. To take advantage of retronasal aroma, it is
highly recommended that after a first swallow of beer, the taster exhales
through the nose while forcing air into the nasal cavity with the tongue.
372 FLAVOR
bound
odorant
binding site
transmembrane
helix
Figure 12.3 Olfactory receptor protein.
The olfactory receptors are neurons; they are directly stimulated by

olecules, unlike the taste receptors, in which neurons are activated by spe-
m
cific receptor cells in the taste buds. Olfactory receptor neurons (ORNs) for
different aromas are very similar to one another and have the same mecha-
nism of action. The ORNs have cilia (hairlike projections) that extend into
the nasal cavity. The other end of the ORN is a fiber called the axon that
connects to a part of the brain called the olfactory bulb. On the ORN cells
are olfactory receptor proteins. These proteins belong to a family of receptors
called G protein‐coupled receptors (GPCRs). All GCPRs are transmem-
brane proteins with seven alpha helices (refer to Section “Proteins,”
Chapter 3). The coils cluster in a circle forming the structure of the receptor.
Figure 12.3 shows the protein as a string of beads, with the transmembrane
helices wrapped around imaginary cylinders for illustration. On the extracel-
lular side of the receptor is a pocket called the binding site, shown binding a
molecule of 4‐vinylguaiacol, which gives a phenolic flavor to some styles of
wheat beer. Olfactory receptor proteins for different families of compounds
differ at the binding site. Just like the active site on an enzyme, the active site
for a receptor is shaped by the protein structure and the identity of the amino
acids. When these amino acids in the active site bind to the target molecule,
the receptor changes its shape, causing the release of a signal molecule inside
the ORN. The signal molecule switches on an enzyme that produces many
molecules of a second messenger, amplifying the response. This is an example
of outside‐in signaling first discussed in Section “Regulation of Gene
Expression” in Chapter 3 with transcription factors.
In the case of ORNs, the signal molecule turns on an enzyme that
hydrolyzes ATP to cyclic adenosine monophosphate (cAMP), the second
messenger. The second messenger opens the gates to a calcium channel,
FLAVOR COMPOUNDS 373
allowing calcium to flow into the cell, depolarizing it, that is, making it less
negatively charged. When the cell voltage reaches a threshold, voltage‐gated
sodium channels open, bringing a flood of positive charge that causes more
sodium channels to open. This sends a wave of depolarization throughout the
neuron, along the axon, and to the brain where it is interpreted as a flavor.
GPCRs are found in cells of all eukaryotes, including humans, barley,
hops, and yeast. In humans they are involved in vision; in the sensation of
sweet, bitter, and umami tastes; and in many other functions. The mecha-
nisms of sour and salty taste processing are less understood, but there are
indications that they may involve the binding of ions to receptors. Humans
have about 800 genes for olfactory receptor GPCRs, much fewer than the
number of different aromas that can be sensed. This suggests that multiple
olfactory receptors participate in producing an aroma. Each receptor
responds with a different intensity to a variety of different odorants. The
brain interprets the pattern of responses of different ONR giving a sensation
characteristic of the odorant.
Mouth Feel
The mouth is well supplied with nerve fibers that sense touch, pressure, vibra-
tion, temperature, and pain, all derived from the trigeminal nerve. These sensa-
tions are processed to give sensations of carbonation, astringency, hot or cold,
viscosity, texture, fullness, and thinness. The importance of these sensations is
highlighted by the typical customer’s reaction to warm, flat beer. Mouth feel is
largely, but not entirely, a set of physical sensations. The physical properties of
beer are, of course, related in complex ways to its chemical composition. Some
of the key players in mouth feel are carbon dioxide, which gives beer its lively
carbonated feel, and tannins, which provide astringency, a drying, puckering
sensation. Sulfate ion enhances astringency. Astringency is believed to result
from non‐specific binding of compounds to proteins in the sensory system.
Dextrins, which are dissolved unfermentable carbohydrates, are said to pro-
vide a sensation of fullness. The role of dextrins in mouth feel is not fully
understood. Metallic sensations evoked by iron ions are another chemically
related mouth feel. Brewer’s yeast can also produce glycerol during fermenta-
tion, with concentration varying by strain. Glycerol is an odorless, sweet‐tast-
ing molecule that enhances fullness on the palette.
12.2 FLAVOR COMPOUNDS
There are hundreds of flavor‐active compounds in beer. For many of them,

there is no consensus on their flavor contribution. The situation is further
complicated by changes that occur in beer composition and flavor as it ages.
374 FLAVOR
More complex still is the ability of yeast to biotransform flavors of other

ingredients like hops. Some compounds that are present in very small traces
are highly flavor active and make an outsize contribution, for better or worse,
to the quality of the beer. Isolating these compounds and associating them
with the flavor of the beer can be very challenging. Here we focus on the most
pronounced flavors.
Flavor Threshold and Flavor Units

The intensity of the flavors evoked by the flavor compounds that sometimes
show up in beer varies by huge factors. The smallest concentration of ethanol,
a mildly flavored compound, that can be detected reliably by the average
taster is 14 g/L (1.4% w/v). This concentration is described as the flavor
threshold for ethanol. The corresponding flavor threshold for 3‐methylbut‐2‐
ene‐1‐thiol (MBT), the compound responsible for the skunky aroma of
lightstruck beer, is 7 ng/L (7 × 10−9 g/L). Based on these thresholds, MBT is 2
billion times (14 g/L ÷ 7 × 10−9 g/L) as strongly flavored as ethanol. Most flavor
thresholds are reported in mg/L or ppm.
Flavor scientists may also use the flavor unit. The number of flavor units
for a compound is the concentration of the compound divided by its thresh-
old. For example, beer with 40 g/L ethanol (5.1% ABV) provides
40 g/L ÷ 14 g/L = 2.9 flavor units. The concentration of MBT required to also
yield 2.9 flavor units is 2.9 × 7 ng/L = 20 ng/L (20 ppt). For compounds that
have not been isolated or identified, it is possible to estimate their flavor units
by dilution. Suppose we take 100 mL of beer and add 200 mL of water. This is
a 3 : 1 dilution. If the flavor can still be discerned, it is present at 3 flavor units
or more in the undiluted beer. If we cannot discern it in a 4 : 1 dilution, then
it is present at less than 4 flavor units.
Flavor compounds in beer can be characterized as primary, secondary,
tertiary, or background. Primary flavor compounds are those present at 2 fla-
vor units or more. They are easily discerned; their absence is instantly noticed.
Secondary flavor compounds are present at 0.5–2 flavor units. They distin-
guish different styles and brands from one another. Tertiary flavor compounds
are those present at 0.1–0.5 flavor units. They are less obvious, but they can
work together to influence the perception of beer. Compounds present at less
than 0.1 flavor units are part of the background. Table 12.1 lists compounds
often present in beer and their contributions to the flavor.
Flavor Categories
Beer styles can be placed into general categories of ale or lager and of bitter,
hoppy, or malty. An additional category is needed for styles with unusual fla-
vors (smoked, sour, chili peppers, chocolate, etc.). Most of the commercial
TABLE 12.1 Beer Flavor Compounds

Compound Official Name Flavor Units Character
Carbon dioxide Carbon dioxide 3.0–5.5 Carbonation
Hop acids Beer bitter substances 2–12 Bitter
Ethyl alcohol Ethanol 1.4–6.4 Alcohol
Myrcene 3‐Methylene‐1,6‐octadiene 0–2.2 Resinous
Ethyl acetate Ethyl ethanoate 0.3–1.0 Fruit/solvent
Ethyl caproate Ethyl hexanoate 0.2–1.3 Apple
Ethyl caprylate Ethyl octanoate 0.1–0.6 Apple
Isoamyl acetate 3‐Methylbutyl ethanoate 0.1–0.8 Banana
Ethyl isobutyrate Ethyl 2‐methylpropanoate Fruit/aromatic
Primary flavor compounds highlighted.
beer in the world can be classified in a bitter lager style sometimes called
international lager. There are substantial sources on specific beer style guide-
lines from the Brewers Association and the Beer Judge Certification Program,
among others. Depending on the viewpoint of the brewer, styles may be
embraced or rejected as constraining. Either way, when submitting a beer for
a competition based on styles, make sure the beer aligns with the guidelines.
Flavors are derived from malt, hops, yeast, and water – with type, quality,
and process variables controlling intensity. For an illustration of which flavor
categories are produced by yeast over time, refer to Figure 9.4. To re‐examine
the influence of water on flavor, consult Table 4.5. Here we discuss bitter,
malty, esters, and hop aroma.
Bitter Bitterness in beer is derived from isomerized alpha acids from hops,
shown in Figure 8.10. The bitterness is often reported as international
bitterness units (IBU). One IBU is roughly equivalent to 1 mg of isohumulone
per liter. Four IBU is about 1 flavor unit. The IBU method is challenged by
significant dry hopping. Humulinones, hulupones, and other structurally
similar molecules are detected with this method, but they are less bitter. This
often leads to higher IBU measurements but lower perception of bitterness.
Perceived bitterness is also influenced by pH.
Standard international pilsner typically has a bitterness level of 8–12 IBU
(2–3 flavor units). Many European pilsners are a good deal more bitter, up to
about 30 IBU. Some craft ales are said to have 100 or more IBU, but these
measurements are based on calculations only. Scientific evidence argues that
the limited solubility of iso‐alpha acids in beer restricts beer to no more than
70 IBU.
Astringent bitterness is described as harsh, unpleasant, and mouth coating.
This type of bitterness may be derived from inappropriate milling, lautering,
or sparging techniques due to extraction of tannins from the barley hull.
376 FLAVOR
It can also be indicative of autolyzed yeast. Yeast will self‐destruct, or lyse,

given prolonged or extreme stress. The most common sources of autolyzed
yeast are keeping the beer on the yeast too long, excessive temperatures, and
extreme mechanical agitation.
Malty Aptly named, malty flavor is derived from malt. Several manufacturers
of malt have developed malt flavor wheels to provide better descriptive
analysis of this characteristic. Such descriptions include roasted flavors like
coffee, cacao, dark chocolate, and toast; nutty flavors like almond, hazelnut,
raisin, and vanilla; malty flavors like honey, biscuit, cracker, and marmalade;
and variations of caramel.
Maltiness comes from Schiff base products as shown in Figures 4.11 and
4.12. Malty compounds usually arise from heat treatment, especially during
drying and roasting of malt. Bock is a familiar malty lager style. Its maltiness
arises mostly from Munich malt.
Esters Fruity flavors in beer arise from esters, compounds that arise from
condensation of an alcohol and a carboxyl group, commonly produced by
yeast. Figure 12.4 shows the structures of some esters often found in beer.
Their flavors are given in Table 12.1. Most of the esters in beer are produced
by the yeast during fermentation. Ester concentrations are usually higher
with ale strains than lager strains. Esters can be increased by raising the
fermentation temperature, increasing the aeration of wort, decreasing the
pitch count, brewing at high gravity, and fermenter geometry (increases with
more hydrostatic pressure). Esters have also been shown to increase based on
the carbohydrate content of the wort, with an increase in glucose percentage
as compared with maltose. Hops are a secondary, but still a potentially
significant, source of esters. Ethyl isobutyrate (Figure 12.4E) is often provided
by hops.
Hop Aroma In addition to bitter taste, hops can serve as a source of aroma
compounds that can have a big influence on beer character. Many of these
are terpenes or their oxidation products.Terpenes are biological hydrocarbons,
the most important of which are structurally related to isoprene, shown in
Figure 12.5. They are members of a larger family called terpenoids, which
include terpenes modified by addition of atoms of oxygen, phosphorus, sulfur,
or others. Terpenes are classified by the number of isoprene units that they
include. A monoterpene has two isoprene units, sesquiterpene has three, and
diterpene has four.
Figure 12.6 shows four of the hundreds of terpenes found in hop lupulin.
The drawing of myrcene is highlighted to show the constituent isoprene units.
Terpenes are volatile; they escape from wort easily during boiling. When a
beer style calls for hop aroma, it is often necessary to add hops at the end of
(A) (B) (C) (D) (E)
Figure 12.4 Flavor esters. (A) Ethyl acetate. (B) Ethyl caproate. (C) Ethyl caprylate.
(D) isoamyl acetate. (E) Ethyl isobutyrate.
Figure 12.5 Isoprene.
myrcene beta-farnescene
caryophylline humulene
Figure 12.6 Hop terpenes.

378 FLAVOR
linalool geraniol
alpha-terpineol limonene
Figure 12.7 Terpenoids derived from myrcene.
boiling, or after boiling in the whirlpool or hop back, or after chilling (dry
hopping). Terpenes that do not escape can easily react, especially with oxy-
gen, to give a variety of flavored products. Figure 12.7 shows a few of the
many terpenoids that can occur in beer. These terpenoids are derived from
myrcene. The three alcohols, linalool, geraniol, and alpha‐terpineol, can all be
made by addition of water across one of the double bonds in myrcene, in
some cases also shifting double bonds. Limonene can be made by eliminating
water from alpha‐terpineol.
12.3 OFF‐FLAVORS
Off‐flavors include those that result from problems in brewery processing,

poor ingredients, or staling as a result of oxygenation and time. In practice, an
off‐flavor is anything that is not described as true to type for a specific brand.
The flavor categories described above could be off‐flavors in certain styles.
Processing Off‐Flavors
There is not always a clear distinction between an off‐flavor and a style char-
acteristic. Dr. Charles W. Bamforth tells of a lager brewery in the eastern
United States with an equipment problem that resulted in condensate from
the kettle running back into the wort. This issue resulted in an undesired
OFF‐FLAVORS 379
cooked vegetable flavor in the beer. The problem persisted for years until
wear and tear made it necessary to replace the boiler. The opportunity to cor-
rect the technical problem was seized, and the brewery started producing
beer without the off‐flavor. Customer reaction was intensely negative; they
liked the beer the way it was. Of course, the brewery immediately modified
the kettle plumbing to give the original flavor. There are two lessons to be
learned from this. A flavor that customers like, irrespective of what the beer
judges say, is not an off‐flavor; it is a style characteristic. Your customers are
the people who like your beer. If you change the flavor, you may find your
brewery looking for new customers. In this section we will cover what are
conventionally regarded as off‐flavors in roughly the order of the processes
that introduce (or fail to remove) them. Their true designation as an off‐flavor
depends on the intention of inclusion.
Medicinal Medicinal or adhesive tape aromas are often the result of

chlorophenols. There are many phenolic compounds in beer wort. If the beer
is made with chlorinated water or if chlorine‐containing sanitizers are left in
the vessels, phenolic compounds from grain or hops can react to give highly
flavor‐active compounds. Figure 12.8 shows 2‐chlorophenol, whose aroma
threshold is 0.1 μg/L (ppb).
Astringency Astringency is a mouth feel described as dry or puckering. It

can come from sulfate ion (SO42−) in the brewing water or from polyphenols
extracted from grain hulls during mashing and wort separation. High to
moderate astringency is characteristic of pale ale and related styles but is an
off‐flavor in most other styles. Polyphenols are slightly acidic; they are more
soluble at high pH and high temperature. Sparging should be carried out at
moderate temperature (<80 °C, 176 °F) and low pH (<6). Small hull particles
make better contact with the liquid phase, so compounds are more easily
extracted from them. Grain handling and milling processes should avoid
abrasion of the hull. Excessive agitation during mashing should also be
avoided. When hammer‐milled grain is used (usually in conjunction with
mash filtration), the small hull particles should be compensated by lowering
the sparging temperature and maintaining a low sparge pH. Some brewers
acidify the sparge water to minimize polyphenol pickup.
Figure 12.8 2‐Chlorophenol.

380 FLAVOR
Dimethyl Sulfide Dimethyl sulfide (DMS), shown in Figure 12.9, is a

volatile compound (boiling point 38 °C) that gives an undesired aroma of
boiled vegetable. DMS has a flavor threshold of about 30 μg/L; when present
at levels above 50 μg/L, it is considered objectionable. DMS is produced
during various stages of malting and brewing from precursor compounds S‐
methyl methionine (SMM) (Figure 12.9) and dimethyl sulfoxide (DMSO)
(Figure 12.10), which itself originates from SMM. Sometimes SMM and
DMSO are collectively called DMS precursors (DMS‐P). The DMSO route
to DMS occurs during fermentation.
S‐methyl methionine (SMM) is not present in unmalted barley, but it
forms during germination. Heat treatment including kilning causes some of
the SMM to be hydrolyzed to DMS and homoserine as shown in Figure 12.9.
DMS formed during malt kilning is mostly released as vapor. Some of it is
oxidized to DMSO, which is very soluble and not volatile (boiling point
189 °C) and is likely to end up in the fermenter. Malt that is cured at low tem-
perature like pale lager‐type malt can retain as much as half of its SMM.
Higher cured malt, like ale malt, loses much of its SMM but can retain a sig-
nificant amount of DMSO. SMM in the malt readily dissolves in the wort
during mashing.
Under typical infusion mashing conditions of 65–70 °C (149–158 °F), DMS
synthesis from SMM is barely significant, but the rate doubles for every 6 °C
temperature increase. Higher temperatures during sparging and decoction
can greatly increase the rate of conversion. During boiling, about one‐third
of the SMM in the kettle is converted to DMS for each hour at 100 °C. If the
boil is vigorous or if other measures are taken to enhance removal of volatile
substances, DMS is eliminated. The process of DMS synthesis continues until
the wort is chilled. This includes the time it takes to pump the wort into the
whirlpool or hop back, the time spent in the wort clarification process, and
+ H2O + + H+
SMM DMS homoserine
Figure 12.9 DMS synthesis. SMM, S‐methyl methionine. DMS, dimethyl sulfide.
Figure 12.10 DMSO.

OFF‐FLAVORS 381
the time it takes to pump the wort through the chiller. Once the wort is
chilled, additional conversion of SMM to DMS becomes insignificant.
Brewhouse practices that limit DMS in beer include:
• Use of more highly kilned malt.

• Prolonged and/or vigorous boiling.
• Wort stripping after clarification.
• Less time between the end of boiling and chilling.
• Rapid chilling.
DMSO is a nearly flavorless nonvolatile liquid that is formed from DMS

during malting. DMSO carried to the fermenter will be reduced to DMS by
yeast enzymes and by some bacteria. This activity is greater when FAN is
insufficient, when the initial gravity is high, and when the fermentation tem-
perature is low. Yeast converts only a fraction of the DMSO to DMS, but
spoilage bacteria make a greater contribution to DMS.
Sulfur Compounds Sulfur compounds are typically produced by yeast in

their use of sulfur‐containing amino acids and dissolved sulfate ions. Hydrogen
sulfide (H2S) has the aroma of rotten eggs. Sulfur dioxide (SO2) has the aroma
of burnt matches. These flavors may be appropriate in small amounts for
lagers. Sulfur aromas may be removed during vigorous fermentation. Their
formation is promoted by excessive FAN, carryover of trub into the fermenter,
insufficient aeration, poor yeast health, and bacterial contamination.
Solvent Solvent aromas arise from alcohols with three or more carbon
atoms (fusel alcohols) and from some esters, especially ethyl acetate
(Figure 12.4A). Figure 12.11 shows the biosynthesis of isoamyl alcohol (3‐
methyl‐1‐butanol), a common fusel alcohol. The process recovers the nitrogen
from a leucine molecule by transamination. The nitrogen‐free product is
decarboxylated, and the resulting aldehyde is hydrogenated to the alcohol.
Fusel alcohols are also called higher alcohols and are derived from yeast
during fermentation. Higher alcohols are acceptable in high‐gravity beers but
are generally considered off‐flavors, providing a hot alcohol sensation. Higher
alcohols must be controlled during primary fermentation as conditioning has
little effect on their removal. Higher alcohols are increased by high fermentation
temperatures, physical forces on brewing yeast, high gravity brewing, and
excessive aeration. Higher alcohols should not exceed 100 ppm. Fusel alcohols
are removed by condensation reactions that produce flavorful esters.
Phenolic The phenolic flavor is a characteristic of certain styles of ale,

notably Bavarian weizen and Belgian wheat ales. It is considered an off‐flavor
382 FLAVOR
+ +
leucine
CO2
2H
isoamyl alcohol
Figure 12.11 Isoamyl alcohol synthesis.
in other styles. The flavor has been described as the aroma of cloves, but not
everyone discerns cloves in phenolic beer. The phenolic flavor comes from
4‐vinylguaiacol (4VG), which certain strains of yeast produce by enzymatic
decarboxylation of ferulic acid (FA), shown in Figure 12.12. The flavor
threshold for 4VG is 0.3 mg/L (ppm). 4VG is the precursor to 4‐ethylguaiacol
(4EG), produced by certain Brettanomyces strains, creating notes of spiciness
or smokiness.
Ferulic acid (FA), the precursor to 4VG, is found in bound form in plant
cell walls, especially in those of the aleurone layer of wheat and barley. It is
released during mashing, the highest rate of release occurring at 45 °C (113 °F)
and in the first 30 minutes of mashing. FA is not converted to 4VG during
mashing, but a small amount of conversion can occur during wort boiling. The
phenolic flavor mostly comes about by conversion of FA by enzymes in yeast
during fermentation. Even if the FA concentration is high, unless the yeast
strain makes the enzyme that converts it to 4VG, the phenolic flavor will be
barely detectable. Some yeast strains make enough 4VG for it to be a primary
flavor compound, which is one present at more than 2 flavor units.
Cidery The cidery off‐flavor comes from acetaldehyde (Figure 12.13), an

intermediate in fermentation. It is secreted by yeast typically in the first three
days of fermentation and has a strong taste of green apple. Acetaldehyde will
be reduced by yeast over time. Initial amounts of acetaldehyde in beer are
OFF‐FLAVORS 383
+ CO2
ferulic acid 4-vinyl guaiacol
Figure 12.12 Production of 4‐vinyl guaiacol.
Figure 12.13 Acetaldehyde.
increased by rapid fermentation, warm temperature, high pitch rates, too little
aeration, and pressure. Another potential source of acetaldehyde is oxidation
of ethanol.
Buttery Buttery flavors are a significant concern, especially in lager beer

brewing. These flavors come from diacetyl (officially called butanedione) and
2,3‐pentanedione, collectively known as vicinal diketones (VDK), meaning
compounds with C═O groups on each of two adjacent carbon atoms. The
VDK compounds are shown in Figure 10.1. VDK is easily the costliest off‐
flavor issue that brewers address in terms of time and money. The VDK is
produced by yeast during fermentation from intermediates in the biological
synthesis of amino acids. Diacetyl comes from the synthesis of valine and
leucine; 2,3‐pentanedione comes from the synthesis of isoleucine. The origins
and removal of VDK are discussed in Section 10.1.
Stale Off‐Flavors
The flavor of beer changes, mostly for the worse, from the time it leaves
the brewery. Figure 12.14 gives a graphic representation of a typical staling
profile. There is considerable variation in the staling off‐flavors and their
development depending on the characteristic of the beer and the storage
and packaging conditions. For example, the ribes (catty) flavor does not
develop at all if the total package oxygen is very low. Some stale flavors
are listed in Table 12.2 along with the molecules with which they are
associated.
384 FLAVOR
ribes
cardboard
swe
et
bitter
time
Figure 12.14 Flavor changes in beer with time. Source: After Dalgliesh (1977).
Lightstruck Beer made with ordinary hop products is susceptible, upon

exposure to light, to an off‐flavor reminiscent of the skunk (Mephitis spp.).
The beer is said to be lightstruck or, informally, skunked. Light in the
wavelength range of 350–500 nm is most efficient at producing the lightstruck
flavor. The compound responsible for the lightstruck flavor is 3‐methylbut‐1‐
thiol (MBT). Figure 12.15 shows the sequence leading to MBT. In the first
step, energy from light breaks the C─C bond between the carbonyl group
(C═O) and the ring. The energy can be transferred directly if the light is of low
wavelength, but for ordinary visible light, the energy goes first to riboflavin,
which deposits the energy into the C─C bond. When a bond is broken directly
or indirectly by light, the electron pair is divided between the two fragments,
each of which gets one unpaired electron. An atom or molecule with an
unpaired electron is called a free radical. Free radicals are usually very reactive.
The second step shows a free radical ejecting carbon monoxide to make a
smaller free radical. In the third step, the new free radical abstracts (grabs) a
sulfur atom, probably from an amino acid. This gives MBT, the skunky thiol.
The most straightforward way to control the lightstruck flavor is to pre-
vent light in the 350–500 nm range from reaching the beer. Kegs, casks, and
cans admit no light. Brown bottles filter out nearly all the light in the problem
wavelength range but will still be affected over time. Green bottles and color-
less bottles are ineffective. Isomerized hop acids that have been treated with
hydrogen to eliminate some double bonds (Figure 4.31) do not form MBT.
These special hop products can be added, to the exclusion of natural hops, to
prevent lightstruck flavor.
Certain brands of beer have lightstruck as a flavor characteristic. One
brand actually adds a measured amount of a lightstruck‐flavored compound
to introduce a consistent level of skunkiness. These are beers best drunk with
a lime wedge. It bears repeating that it is the customer who decides what is an
off‐flavor and what is a style characteristic.
385
386
OFF‐FLAVORS 387
isohumulone
+ CO
+ + R
MBT
Figure 12.15 Lightstruck sequence.
+Q + QH2
amino acid imine
+ H2O + NH3 + CO2
Strecker aldehyde
Figure 12.16 Strecker degradation.
Oxidized Oxidation can produce compounds that give stale flavors to beer.
One example of an oxidation process is the Strecker degradation of amino
acids, shown in Figure 12.16. The first step is an oxidation, where Q is a generic
oxidizing agent. The oxidation number of the left carbon in the amino acid is
0, and that in the imine is +2. The second step is not an oxidation–reduction.
388 FLAVOR
The product is an a ldehyde in which ─R is the R‐group of the starting amino

acid. Many of these compounds have unpleasant aromas and low flavor
thresholds. For example, 3‐methylbutanal, the Strecker product from leucine,
has a threshold of 600 ppb with flavors characterized as “unripe banana” and
“cheese.”
12.4 ANALYSIS AND QUALITY CONTROL TO MONITOR

FLAVOR CONSISTENCY
There are two primary ways to test flavor, chemical analysis and sensory
panel (human tasters). Major contributors to flavor like carbon dioxide,
ethanol, and bitterness can be evaluated chemically. There is no practical
laboratory procedure to evaluate the hundreds of minor compounds that
contribute to beer flavor.
Chemical Analysis
The ideal analytical procedure is fast, cheap, highly accurate, and nondestruc-
tive (ruins little to no beer) and is executed automatically as the process
continues (process analysis). “Ideal” is scientific jargon for “unattainable in
practice.” The analysis must fit into the quality program in a meaningful way,
that is, it tells you something you need to know, and there are control limits
on the measurement and procedures for dealing with deviations. Advanced
methods for measuring the compounds that contribute flavor in beer include
high performance liquid chromatography (HPLC) and gas chromatography/
mass spectroscopy (GC/MS).
Carbon Dioxide The carbonation level is an important characteristic of beer.

Many brewers test every batch. Beer carbonation official methods are ASBC
Method Beer 13 and Analytica EBC 9.28. The most common method for carbon
dioxide testing involves shaking a sample of beer in a closed pressure vessel and
measuring the temperature and pressure. The carbon dioxide concentration is
determined from Henry’s law. To test packaged beer, the container is pierced
through the cap for bottles or through the bottom for cans. The bottle or can
serves as the pressure vessel. The apparatus includes a pressure gauge and a
thermometer. Carbon dioxide concentration in volumes is read from a table.
Table 10.1 contains this information. There are more accurate tables that take
the effects of final gravity and ethanol content into account, which can be
significant in high‐alcohol beer. A variation is to use a syringe to maintain a
constant pressure and measure the volume. The pressure–volume–temperature
methods all have the inherent limitation that they do not distinguish between
carbon dioxide and other dissolved gases potentially found in beer.
ANALYSIS AND QUALITY CONTROL TO MONITOR FLAVOR CONSISTENCY 389
A tedious but potentially accurate method is to make the gas from the
beer bubble through a solution of potassium hydroxide. Carbon dioxide is
acidic; it reacts according to 2KOH + CO2 → K2CO3 + H2O, neutralizing some
of the KOH. The amount of acid needed to neutralize the unreacted KOH is
determined. The amount of KOH determined in this way is compared with
the amount before reacting with carbon dioxide. The amount of carbon diox-
ide on the beer sample is then calculated.
There are proprietary methods used by dedicated instruments that exploit
properties of gases and gas mixtures containing carbon dioxide. For example,
one instrument uses the big difference in thermal conductivity between CO2
and other gases found in beer. Some of these methods claim to have good
selectivity for CO2 in the presence of other dissolved gases.
Ethanol Analysis of ethanol is covered in Section 10.4.
Hop Bitter Acids (IAA or IBU) The analysis of hop bitter acids is covered
in ASBC Methods of Analysis Beer 23 and in Analytica EBC 9.8. These
methods do not correlate exactly with the perceived bitterness, but they are
nonetheless useful. Many breweries measure international bitterness units
(IBU) of every batch as a quality check on the brewing process. In this
method, a sample of beer is acidified to neutralize the charge on the phenolic
─OH groups. The sample is then extracted 2,2,4‐trimethypentane (isooctane),
a nonpolar solvent that absorbs the iso‐alpha acids. The absorbance of the
organic layer is measured at 275 nm. The bitterness unit value is calculated
from IBU = 50 × A275. A similar extraction procedure followed by dilutions
with methanol and measurement of the absorbance at 255 nm can be used to
calculate the iso‐alpha acid (IAA) concentration.
WARNING: Isooctane is highly flammable. Its storage, handling, and
disposal must be under the supervision of qualified chemists.
There are also some methods that use HPLC, which involves injecting
samples into a solvent that flows through a tube (the column) packed with
coated silicon dioxide particles. As the solvent emerges from the column, it
enters a detector that measures a property that varies with the concentration
of the stuff being analyzed, ultraviolet light absorbance in this case and refrac-
tive index for other HPLC analyses. An advantage of HPLC is that it can
determine the individual concentrations of the different iso‐alpha acids.
A disadvantage is the high cost of the equipment and supplies.
Sensory Analysis
The most versatile piece of analytical equipment for beer is the human
flavor palate. All raw materials, wort, green beer, and finished beer should
be taste tested by the brewer for a quick, on‐the‐spot go/no‐go assessment.
390 FLAVOR
As operations scale larger, so does the need for a more formal sensory
training program, especially for sensory analysis of beer.
There are many resources available to assist in the development and
execution of a sensory program. This is only an introduction that describes
common biases in brewery sensory programs, design of sensory labs, and
useful tests for a sensory panel to conduct.
Sensory Bias Sensory results usually have a high degree of variability

(high standard deviation) and are prone to bias. Bias is nonrandom error
caused by a personal feeling or inclination toward an outcome. For example,
if the color of the sample is dark, scores for maltiness flavor will be increased
compared with the same samples for which the color was concealed. Variability
can be factored out by training tasters, with repetitive testing, and through
application of statistical methods. Bias can only be reduced by designing the
experiments to minimize the factors that introduce bias. The following sources
of bias should be avoided.
Adaptation is a change in sensitivity as a result of continuous exposure,
otherwise known as palate fatigue. An example of adaptation bias occurs in
the sampling order of beers from high bitterness to low bitterness. The analyst
becomes desensitized to the bitterness over time. To avoid this bias, the tast-
ers should test a limited the number of samples, and they should take regular
breaks from tasting.
Enhancement and suppression describes the phenomena where the pres-
ence of one substance will increase or decrease the taster’s sensitivity to
another. For example, sulfur off‐flavors are particularly pungent and may
cause perception of other attributes to be less. To avoid this bias, palate
cleansing and regular breaks should be included.
Expectation is when preconceived ideas influence responses. No sensory
participant should know the purpose of the sensory test. Panelists should be
given a blind tasting with clear, concise questions.
Habituation is the result of repeated exposure to the same product over sev-
eral days. Because of habituation, minor or gradual change may not be perceived.
Keep sensory panelists alert by occasionally spiking samples with off‐flavors.
Stimulus error is a major source of bias where irrelevant criteria influence
the response. The example above with dark beer color influencing perception
of malt flavors is an example. To avoid expectation, sampling should be blind.
The cups should be opaque.
The halo effect describes the association of two or more characteristics in
the minds of the taster. For example, hoppy beers may be assumed to be more
bitter. Overcoming the halo effects requires the use of a trained sensory panel
or carefully designed questions.
The order of presentation can also be a major source of bias. Patterns,
positions, and contrasts can influence perception. Samples should always be
ANALYSIS AND QUALITY CONTROL TO MONITOR FLAVOR CONSISTENCY 391
presented in a randomized order with randomized three‐digit codes such as

326, 298, and 172.
Mutual suggestion is common when verbal or facial expressions of others
influence a response. If one person in the room states that a beer is horrible,
others may follow the opinion. If someone grimaces, that person may inad-
vertently influence someone else. Sensory analysis should not be conducted
at a round table. At minimum it should be conducted with everyone sitting in
the same direction. At best, panelists should use isolated booths.
Design of the Sensory Laboratory For analytical tasting, the selection of

tasters is important. The tasters will need to go through a recruitment/
selection process and undergo training to discern and describe flavors
according to a standardized vocabulary. Standardized sample sets are available
for flavor training. Training tools like the beer flavor wheel and flavor maps
can be helpful in explaining flavor terminology.
The testing area should be located away from areas that have odors, like
lunch rooms, loading docks, and production areas. Tasters should be seated in
booths, so they do not see one another. The furniture should be comfortable
and the atmosphere pleasant. If color is potential distraction, the lighting and
the sample glasses can be adjusted to conceal the color. Sessions should not
be too long and should not include too many samples. Trained tasters are a
valuable resource that should be protected from burnout.
Sensory Tests There are many testing methods. In all cases, the order of
presentation and the coding must be randomized, and the tasters must be
given no indication of the expected outcome. In the paired comparison test,
samples are presented in pairs; the tasters are asked to compare them according
to a certain characteristic. In the triangular test, three samples are be presented,
two of which are identical. Tasters are asked to pick the one that is different.
In the duo–trio test, the tasters are first presented with a standard that is
identified to them as such. Then they taste two unknown samples, one of which
is identical to the standard. They must choose the one that is different from the
standard. In the ranking test, three to six samples are simultaneously presented.
The taster is asked to arrange them in order of a specified flavor characteristic.
Simple trueness‐to‐type tests may be designed to survey consistency of a brand.
1. What is the difference between taste and aroma?

2. What is retronasal sensory? How does one use the retronasal sensation
when tasting a beer?
392 FLAVOR
3. What is the most prominent mouth feel in beer?

4. What is a flavor threshold? How is it determined?
5. A certain compound has a flavor threshold of 50 ppm. A sample has
75 ppm of this compound. How may flavor units is this?
6. List the three compounds that are primary flavors in nearly all forms of
beer.
7. What would you change in your process to promote an increase in fruity
esters in a beer?
8. What are fusel alcohols and where do they come from?
9. Which off‐flavors will be removed as a result of conditioning?
10. What are some flavors that come from hops?
11. What is an off‐flavor? Are there compounds that are sometimes off‐
flavors and sometimes desirable flavors?
12. Describe the sensory changes in beer as it ages?
13. What are common sources of bias in a sensory program?
14. Money is not an issue; design a sensory lab.
15. Describe how you would design a sensory panel experiment to evaluate
potential differences in beer flavor after the addition of a new piece of
brewing equipment.
16. Describe two methods to determine alcohol by volume (ABV).
CASE STUDY
Case Study 1
You are the brewer at a small 7 bbl brewery with only three employees, the
owner/taproom manager, the assistant brewer, and you. You do not have
access to a trained sensory panel, so much of the quality control is done by
you and your assistant. In the last two brews, you noticed the presence of
astringency, a harsh, lingering bitterness that had not been there before.
Explain how you will identify, evaluate, and solve the problem.
Case Study 2
You are the brewer at a 10 bbl brewery. The brewery recently purchased a
small canning line to widen distribution of its best brands. Unfortunately, the
BIBLIOGRAPHY 393
shelf life of the IPAs is poor, losing substantial hop bitterness and flavor after
only a few weeks in storage and developing flavor notes of onion and garlic.
Explain how you will identify, evaluate, and solve the problem.
Case Study 3
Congratulations! You were hired as the new Director of Quality at Brewery
X, a 40 bbl brewery with about 20 employees. One of your first orders of busi-
ness is to develop a sensory program for the brewery that incorporates a
panel of trained panelists. Describe your equipment and space needs to build
a sensory laboratory. Explain how and with what you will train panelists.
Explain how you will manage the sensory program to ensure consistency
across all brands.
BIBLIOGRAPHY
ASBC Methods of Analysis Beer 4, 13, 23.

Bamforth CW. 2014. Flavor. American Society of Brewing Chemists. ISBN
978‐1‐881696‐23‐0.
Barth R. 2018. Beer Conditioning, Aging, and Spoilage. In Bordiga M (editor). Post‐
Fermentation and ‐Distillation Technology. CRC. ISBN 978‐1‐4987‐7869‐5.
p. 186–190.
Briggs DE, Boulton CA, Brookes PA, Stevens R. 2004. Brewing: Science and Practice.
CRC. ISBN 0‐8493‐2547‐1. Chap. 8.
Dalgliesh CE. 1977. Flavour Stability. Proc. Eur. Brew. Conv. Congr. Amsterdam. DSW.
p. 623–659.
Pelosi P. 2016. On the Scent. Oxford University Press. ISBN 978‐0‐19‐871905‐2.
Spedding G, Aiken T. 2015. Sensory Analysis as a Tool for Beer Quality Assessment
with an Emphasis on Its Use for Microbial Control in the Brewery. In Hill AE
(editor). Brewing Microbiology. Woodhead. ISBN 978‐1‐78242‐331‐7.
Thompson S. 2010. Sensory analysis: a matter of taste. ASBC Brewmedia Modules.
https://www.asbcnet.org/lab/webinars/webinars/BrewMedia/ThompsonSue/player.
aspx
Chapter 13
COLOR, FOAM, AND HAZE
The consumer’s first impression of beer is by sight. Beer is meant to be seen

and appreciated in appropriate glassware. Bottles and cans are simply the
means to get it there. From the subtleties of color to the consistency of clarity
and to the appealing qualities of stable foam, beer is beautiful. While consist-
ency in flavor is essential to reproducing quality beer, so too are the physical
attributes of color, foam, and haze. The appearance of the beer depends on
the interaction of light with the beer, its foam, and the glass. Everything starts
with light.
13.1 LIGHT
Light, for our purposes, is a traveling wave, like a wave on the ocean, as
opposed to a standing wave, like that on the string of a musical instrument.
Traveling waves have four characteristics, two of which are shown in
Figure 13.1. The distance between peaks (or other equivalent points) on two
successive waves is the wavelength, λ (lambda). The peak displacement of the
wave is the amplitude (A). The number of waves that pass a fixed point in one
second is the frequency, ν (nu). Frequency is measured in reciprocal time (s−1),

395
396 COLOR, FOAM, AND HAZE
Figure 13.1 Wave.
TABLE 13.1 Types of Light

Wavelength
Type Range Frequency Effect
Radio >1 m <3 × 10 Hz8
Induce signal in antenna
Microwave 1 m–0.001 3 × 108–3 × 10 11 Molecular rotation
Infrared 0.001–7 × 10−7 3 × 10 11–4.2 × 10 14 Molecular vibration
Visible 7 × 10−7–4 × 10−7 4.2 × 10 14–7.5 × 10 14 Color/chemical bonds
Ultraviolet 4 × 10−7–1 × 10−8 7.5 × 10 14–1 × 10 16 Valence electrons
X‐Ray/gamma ray <1 × 10−8 >1 × 10 16 Core electrons/nuclear
also called hertz (Hz). The speed of the wave is c. The speed, wavelength, and
frequency are related by the equation
Based on this equation, as the frequency (ν) becomes higher, the wave-
length (λ) becomes shorter. The speed of light in a vacuum is a constant of
nature with a value close to 3.00 × 108 m/s, so if the wavelength is known, the
frequency can be determined.
Ranges of wavelengths are named by detection methods and effects on
matter, as given in Table 13.1. Different wavelengths of visible light give rise
to the sensation of color (Table 13.2). The human eye has three types of color‐
sensing organs, called cones, each responsible for an overlapping set of wave-
lengths. The color perceived is determined by the relative response of the
three types of cones. Many colors that we see are combinations of the single‐
wavelength colors. Natural white light has a maximum intensity at a wave-
length of around 480 nm, dropping off rapidly at lower wavelengths and more
slowly at higher wavelengths. Light delivers energy in packets that depend on
the frequency or the reciprocal of the wavelength (1/λ). Green light at 500 nm
(6 × 10 14 Hz) delivers energy equivalent to 240 kJ/mol, enough to break a weak
chemical bond.
When light hits a glass of beer, three things can happen. The light can be
transmitted, reflected, or absorbed. Transmitted light goes through a material
and comes out the other side. Reflected light strikes a surface and bounces off.
LIGHT 397
TABLE 13.2 Colors of Visible Light

Color Wavelength Range (nm)
Red 700–620
Orange 620–590
Yellow 590–570
Green 570–495
Blue 495–450
Violet 450–400
Absorbed light does not emerge on the other side; it is converted to another
form of energy by the material. Light that is strongly absorbed by a material
does not reach the eye; thus the perceived color of an object results from
transmitted or reflected light.
Beer strongly absorbs wavelengths corresponding to blue and green, so its
color results from yellow and red light that it transmits or reflects. The amount
of light that a material transmits depends on the distance through which the
light travels in the object (the path length), the inherent intensity of color for the
molecules absorbing the light (the absorptivity), and the concentration of these
molecules. The transmittance of a sample is the ratio of light power emerging
from the sample (I) over that entering (Io). The transmittance is defined by
I
T
Io
where I is the light power emerging from the sample and Io is the light power
that enters the sample. The percent transmittance is the transmittance
expressed as a percentage: %T = T × 100%. The light power is usually meas-
ured at a specific wavelength. The absorbance is a measure of the amount of
light absorbed by the sample. It is calculated from
A log T or A 2 log %T
The relationship among the absorbance, the path length (distance the light
travels in the sample), and the concentration of the light‐absorbing material
is called Beer’s law:
A bc
where A is the absorbance, ε is called the absorptivity (a characteristic of the

light‐absorbing material and of the wavelength), b is the path length, and c is
the concentration of the colored material. Many analytical procedures use
Beer’s law to determine the concentration of a compound.
The principle of Beer’s law is manipulated by the bartender to influence the

appearance of beer. For example, when paleness is a desired style characteristic,
as with Pilsner beer, the beer is often served in a tall, narrow glass. The narrow
glass provides a short path length for light, providing less perceived color.
When light passes from one material to another, it may be transmitted or
reflected at the interface, usually both. The details of this behavior depend on
the speed of light moving through the material and the angle between the
direction of the light ray and the direction of the interface between the materials.
The speed of light in a material is usually expressed as the refractive index,
which is the ratio of the speed of light in a vacuum (close to that in air) to that
in the material. The more a material retards light, the greater its refractive
index. The refractive indices of some common materials are shown in Table 13.3.
Figure 13.2 shows a ray of light, the incident ray, moving from a high index
material, like water or beer, to a low index material, like air. At the interface
where the materials meet, some of the light is transmitted – it continues to
travel into the other material – while some is reflected. The imaginary line at a
right angle to the interface is the normal (N). The angle between the normal
and the incident ray (θi) is equal to that of the reflected ray (θr). The transmit-
ted ray changes direction, a process called refraction. When the ray is transmit-
ted from a high to a low index material, the light is bent away from the normal,
that is, down toward the interface. This behavior is captured in the mnemonic
“high to low, dive below.” When the incident angle is small, the bending is
small. The amount of bending increases as the ray moves closer to parallel with
the interface (higher θi). The fraction of the light that is transmitted from a high
to a low index material decreases, and the fraction that is reflected increases.
The application of this principle is that every time the light ray encounters
an interface, the light is scattered; the interface might be a haze particle or a
gas bubble, resulting in light that is both reflected and transmitted. When
there are many such interactions, the light follows a complicated path, break-
ing up any image. In this case, the material appears cloudy or opaque. This is
why we cannot see very far through foam or a New England IPA.
TABLE 13.3 Refractive Indices of

Some Materials
Material RI
Vacuum 1
Air 1.000
Carbon dioxide 1.001
Water 1.333
5% ethanol in water 1.336
10% sucrose in water 1.348
Ethanol 1.361
Glass 1.518
COLOR 399
ed
θt
m itt
ns
low index tra
high index
ref
nt
θi θr
le
i de
c te
inc
d
Figure 13.2 Transmission and reflection.
incident
transmitted
reflected
Figure 13.3 Reflection and refraction in a bubble.
Some of the paths that a ray might take in a single bubble are shown in
Figure 13.3. The liquid film around the bubble has two interfaces, one with air
on the outside and one with gas on the inside. Each time a ray encounters one
of these interfaces, it is subject to reflection and refraction, only a few instances
of which are shown in the figure.
13.2 COLOR
The most significant source of color in beer is a family of complex network

polymers called melanoidins. Riboflavin, a yellow compound also called vita-
min B2, is another source whose color is mostly evident in very pale styles of
beer. Using the properties of light and Beer’s law, the color of wort or beer is
measured to ensure consistency and trueness to type.
Melanoidins
Melanoidins are the same class of compounds that give a familiar brown
color to roasted and baked foods, including malted and roasted grain. Despite
a good deal of effort, there is little agreement about their molecular struc-
tures. One suggestion is that they are polymers with a backbone as shown in
Figure 13.4. The wavy lines are attachment points for additional units of the
structure. This suggestion is simpler, although no more plausible than several
other possibilities that differ in every significant detail. There is general agree-
ment that melanoidins have molar masses in the range of 10 000–60 000 g/mol
and that they carry a negative electrical charge.
The sequence leading to the formation of melanoidins is called the Maillard
(MAY‐yard) reaction. It is favored by high temperature, low water concentra-
tion, and high pH. In most beer, melanoidins formed during malting or roast-
ing of grain are the main source of color. Other hot processes, especially
boiling, make smaller contributions. The first step in the formation of mela-
noidins is the condensation of a sugar with an amino acid to form a Schiff
base. The Schiff base is unstable; it undergoes the Amadori rearrangement as
shown in Figure 13.5. The Amadori products can react by additional loss of
water and of nitrogen to form melanoidins as well as smaller molecules, many
of which are flavor active. Melanoidins do not have a flavor of their own, but
it is believed that they may break down to yield flavor‐active compounds.
Melanoidins can enhance foam stability by increasing the local viscosity at
the bubble, and they can be involved in oxidation processes that contribute to
beer staling.
Riboflavin
Barley malt contains about 3 μg of riboflavin (Figure 13.6) per gram, most of
which ends up in the beer. The intense yellow color of riboflavin is most
Figure 13.4 Melanoidin backbone (one possibility).

COLOR 401
Figure 13.5 Schiff base formation and Amadori rearrangement.
Figure 13.6 Riboflavin.
e vident in beer styles made from very pale malt, such as Mexican pale lager.
The color comes from the alternating single and double bonds in the three‐
ring portion of the molecule. Riboflavin can capture light energy and transfer
it to isomerized hop acids. Ultimately this gives rise to the skunky aroma of
lightstruck beer as discussed in Chapter 12.
Analysis and Quality Control of Color

There are two distinct approaches to measuring beer color (also appropriate
for wort color). The simplified approach is to assume that beer is essentially
beer colored but can be lighter or darker. The beer or wort sample is placed
in a glass container of known path length, and the absorbance of 430 nm light
is measured in a spectrophotometer. Accurate absorbance measurements are
only possible on samples that are free of haze, so it may be necessary to drive
the sample through a 0.45 μm syringe filter before taking the measurement.
Filters can strip some color from the sample, so it is best to discard the first
few milliliters that come through the filter. The ASBC color measurement is
10 times the absorbance (at 430 nm) of the sample with a ½ in. (12.7 mm)
path length. In practice, a 10 mm path length is used so the ASBC color is
12.7 × absorbance.
This measurement of beer color is called the standard reference method
(SRM). The typical range of beer SRM is displayed in Figure 13.7. ASBC
color is roughly equivalent to an earlier system called Lovibond color. The
European Brewing Convention (EBC) uses the same wavelength as the
ASBC with a 10 mm path length, but the EBC color is calculated from 25 × A.
To convert from SRM to EBC, multiply by 1.97. Suppose a sample of beer in
a 10 mm path length cell has transmittance at 430 nm of 32%. The absorbance
is 2 −
log(32) = 0.494. The beer color is 12.7 ×
0.494 = 6.3 SRM or
25 × 0.494 = 12.4 EBC. High values of absorbance are difficult to measure
accurately because the amount of light that gets through the sample becomes
too small. For dark samples, the beer can be diluted to bring the absorbance
into a measurable range; the absorbance of the undiluted sample is then cal-
culated. For example, suppose we take 25 mL of beer and add enough water
to give 100 mL total. We measure the absorbance of the diluted sample as
0.85. The absorbance of the original beer is 0.85 × (100 mL)/(25 mL) = 3.40.
The ASBC color is 12.7 × 3.40 = 43.2. The undiluted beer would have a trans-
mittance of 0.04%, which is barely measurable on many instruments.
The other approach to measuring color is to take into account the actual
differences in the hues of various types of beer. Beers can have the same
SRM but still differ in appearance, one being more red and another being
more yellow. A more detailed approach to beer color is to report the color
using the method of the Commission Internationale d’Eclairage, called CIE
LAB color. The CIE LAB method yields three numbers, L*, a*, and b*. L*
1 2 3 4 5 6 7 8 9 10
11 12 13 14 15 16 17 18 19 20
21 22 23 24 25 26 27 28 29 30
Figure 13.7 Beer color SRM chart.

FOAM 403
corresponds to the lightness, a* to position on the red‐green axis, and b* to

position on the yellow‐blue axis. To measure CIE LAB color, the transmit-
tance must be measured at many points across the entire visible range.
Software is available in many spectrophotometers to calculate and report
CIE LAB color from these measurements. CIE LAB color is a more compre-
hensive description of color, but most color specifications, for example, those
in style guidelines, go by ASBC or EBC color.
13.3 FOAM
Foam makes a major contribution to the visual impact of beer. The head of
foam on a glass of beer is instantly recognized as a characteristic distinguish-
ing beer from other sparkling beverages. Foam enhances the organoleptic
quality of the beer, that is, it improves character perceived by the senses.
Foam is visually appealing. It changes the texture of the beverage on the pal-
ate. It provides effervescence and aromatic scents because volatile flavors are
released as the foam bubbles break. In beer, a long‐lasting head of foam is
desirable, but the foam must not be so copious that the beer becomes difficult
to serve or drink.
By contrast, any foam during wort boiling, in most cleaning systems or in
utilities like boilers or chillers, interferes with their functions and must be
suppressed. Certain cleaning chemicals are specifically designed as foams to
achieve effective coverage of equipment exterior surfaces.
Surfaces
A surface is the place where a liquid or solid meets a gas. The general term for
the place where phases meet is an interface. Energy is needed to create or
extend a surface (but not necessarily an interface). This surface energy is
released when the surface is destroyed. The energy needed to make a unit
area of surface is the surface tension, symbolized γ (gamma).
Surface energy results in a spontaneous tendency for particles, including
bubbles of foam, to take forms that minimize their surface areas. Because of
this minimizing tendency, bubbles act in some ways like elastic balloons; they
squeeze the gas inside, raising its pressure. The smaller the bubble and the
higher the surface tension, the greater the excess pressure inside. A very small
bubble would have unrealistically high inside pressure. For example, a 1 μm
(0.001 mm) gas bubble in water (γ = 72 dyne/cm = 0.072 N/m) would have an
inside pressure nearly 3 bar (44 psi) higher than the outside pressure. This
makes it difficult for a new bubble to form in the middle of the liquid.
Under most circumstances, bubbles form at hydrophobic locations, called
nucleation sites that attract gas molecules (Figure 13.8). Once a bubble forms,
(A) (B) (C)

Figure 13.8 Foam formation. (A) Nucleation site in glass. (B) Bubble growth.
(C) Bubble breaks off.
it can easily absorb dissolved gas from the liquid, thus growing larger until big
enough to break free and float to the surface. Some beer glasses are etched on
the bottom to provide nucleation sites. One surprising source of nucleation
sites is tiny cellulose fibers that may adhere to the insides of glasses. In this
manner, a dirty glass is often revealed by excessive bubbles on the walls of a
recently filled glass of beer.
Foam Formation, Persistence, and Deterioration

A bubble on a nucleation site experiences a force attracting it to the site and
an opposing buoyant force pulling it upward. As the bubble grows, the buoy-
ant force increases until it tears most of the bubble off the site and into the
bulk liquid. A remnant remains to nucleate the next bubble (Figure 13.8). The
free bubble is pulled toward the liquid surface by buoyancy, growing as it
rises because of additional gas absorbed and because the pressure exerted by
the weight of the liquid becomes less near the surface. When the bubble
reaches the liquid surface, it is pushed up and out of the liquid by other bub-
bles arriving from below. It then joins other bubbles to form a foam layer. Up
to this point, the behavior of a beer bubble is the same as that of a bubble of
any other carbonated liquid, like soft drinks and sparkling wine. The differ-
ence is that beer foam persists for several minutes, in contrast to the foam of
other beverages, which collapses in seconds. To understand why beer foam
persists, we first need to evaluate what makes foam collapse.
The bubbles in foam are typically about 0.2 mm in diameter but can be as
large as 0.5–2 mm. The liquid content of fresh foam is about 0.2 mL/mL of foam.
There are about 170 000 bubbles in 1 mL of foam. The surface area, that is, the
area of contact with the gas inside the bubbles, comes to about 220 cm2/mL
FOAM 405
of foam. The surface area of the same amount of liquid if it were in a s ingle
spherical drop would be 1.65 cm2. Thus, in the form of foam, the surface of the
liquid increases by a factor of 133! This also means that a certain volume of
foam has 133 times the surface energy of the liquid it contains. When the
foam collapses, energy is released as heat, a highly spontaneous process. There
are two approaches that can control a spontaneous process. It can be made
less spontaneous, or it can be slowed. Both approaches contribute to foam
stability, known in brewing jargon as head retention.
To make foam collapse less spontaneous, we might lower the surface
energy. The surface energy is the surface area multiplied by surface tension.
Lowering the surface area is counterproductive, because it would mean less
foam. On the other hand, the surface tension can be lowered by substances
called surfactants. A surfactant molecule has a polar (hydrophilic) end that is
attracted to the water in the beer and a nonpolar (hydrophobic) end that can
extend into the gas in a bubble. Very small quantities of surfactant lower the
surface tension a good deal, which results in less energy release when the
foam collapses and thus a more stable foam. Surfactants in beer are mainly
protein fragments derived from the malt but may also be hop‐derived
polyphenols or modified alpha acids.
If we turn our attention back to natural foam collapse and a consideration
of how to slow the process, the four mechanisms for foam deterioration over
time are draining, disproportionation, diffusion, and coalescence.
Draining When first formed, foam can be as much as 40% liquid by volume.
The liquid drains down, through the foam and into the beer, under the
influence of gravity. After a few minutes, the foam typically drains to about
20% liquid. This amounts to a decrease in foam volume by 20% without any
change in gas content, bubble size, or number of bubbles. The foam continues
to drain more slowly, but other processes become more dominant. The local
viscosity of the liquid in the space between the bubbles has a big effect on
drainage. Higher viscosity yields slower drainage. Bubble size also affects
drainage. Smaller bubbles make the drainage path longer and more
convoluted, slowing drainage. Drainage shortens the distances between the
bubbles and from the inside to the outside of a bubble. These distances affect
the speed of other foam deterioration processes.
Disproportionation Disproportionation is the gain of material by larger

particles at the expense of smaller particles, giving a net increase in particle
size and loss of surface area. When the particles are bubbles, disproportion
occurs because the smaller bubbles have a higher internal pressure than the
larger bubbles. Higher pressure gives higher solubility, according to Henry’s
law. In the presence of small and large bubbles, the gas from the small bubbles
will dissolve and be absorbed by the large bubbles. Disproportionation makes
the foam coarser with larger but fewer bubbles; the foam volume is not directly
affected. Foam coarsening is slowed by lowering the surface tension. This
lowers the pressure difference between large and small bubbles. Wetter foam
yields thicker bubble walls, slowing down the movement of the dissolved gas
through the liquid. The inclusion of nitrogen, which has very low solubility in
beer, inhibits disproportionation. Lower temperature slows down the diffusion
of dissolved gas through the liquid. Materials that stick to the bubble surface
can physically block the migration of gas from a bubble. Disproportionation is
regarded as the most significant mechanism of foam deterioration.
Diffusion Diffusion is the movement of material from a region of high

concentration to a region of low concentration. The top layer of bubbles is in
contact with the atmosphere. The atmosphere consists of about 80% nitrogen
and 20% oxygen by volume. The interior of a bubble consists mostly of carbon
dioxide. Carbon dioxide from a bubble in contact with the atmosphere
diffuses across the bubble wall to the atmosphere. Air gases diffuse in, but
because oxygen and nitrogen are hardly soluble in the bubble wall, the exit of
carbon dioxide is much faster than the entrance of air. The bubble shrinks to
a small fraction of its original size. The shrinkage of the bubbles on top
exposes the next layer of bubbles to the atmosphere. Eventually a thin layer
of very small bubbles filled with air remains on top of the beer. Diffusion can
be slowed down by covering the beer, increasing the concentration of carbon
dioxide in the atmosphere in contact with the foam.
Coalescence Coalescence is the merging of smaller particles to form larger

particles. Coalescence of bubbles is manifested by the breaking of the wall
between two bubbles, so they merge to form a single bubble. Breaking a wall
between bubbles makes the foam coarser, that is, it has larger bubbles, but the
total volume of foam is not directly affected. If the walls between the
atmosphere and bubbles in the top layer break, those bubbles are lost and
the foam volume decreases.
Lacing
Lacing, shown in Figure 13.9, is foam that clings to the sides of a glass after the
beer has been consumed. Customers vary in their perception of lacing. Some
regard lacing as highly desirable; some dislike it; and some are ambivalent.
The authors consider lacing to be a beautiful quality that enhances e njoyment
of a beer and thus deserving of attention.
Lacing requires that the materials at the surface of bubbles be very stable,
virtually solid. The glass must be free of fats and detergents. The glass is said
to be “beer clean.” It is ironic that dislike of lacing is associated with a percep-
tion that a laced glass looks dirty.
FOAM 407
Figure 13.9 Lacing. Source: Photo: Naomi Hampson.
Foam‐Active Materials
There are three related aspects to foam activity: foamability, foam stabiliza-
tion, and foam quality enhancement. Foamability is the ability to form foam
without regard to its characteristics. Foam stabilization is the ability to make
the foam last. We can highlight the distinction between foamability and foam
stabilization by considering a beer with excessive foamability and insufficient
foam stabilization. The beer will be difficult to serve because foam will fill the
glass as it emerges from the tap. But the foam quickly collapses. The bar-
tender will have to fill the glass in several stages, allowing the foam to subside
each time. Because of the poor stabilization, the foam will subside shortly
after the customer starts drinking. Foam quality is the visual appeal of the
foam to the drinker and includes aspects like color, bubble size, and lacing
(foam clinging to the sides of the empty glass). Consumer perception of foam
quality varies geographically and culturally.
For a material to be foamable, it must travel rapidly to the bubble inter-
face, stick to it, and deform to match the contours of the bubble. Foamable
materials have small or flexible molecules with both hydrophobic and hydro-
phobic regions. They lower the surface energy, allowing the foam to form.
Short polypeptides and molecules like hop bitter compounds tend to be
foamable as they stabilize the surface tension of the bubbles. Foam stabilizers
need to form a tough network around the bubbles to inhibit migration of the
gas from the bubble. Their molecules stick together and pack well, covering
the bubble surface. Because of their ability to lower surface energy, foamable
molecules tend to drive foam stabilizers from the bubble surface. An illustra-
tion of the foam stabilizing ability of proteins and hop polyphenols is demon-
strated in Figure 13.10.
Proteins Hop bitter compounds and polyphenols are thought to form

foam‐positive associations with water‐soluble proteins and protein fragments
(polypeptides) derived from malt. The identity of these proteins is an area of
debate. On the one hand, it is believed that specific barley proteins contribute
to foam. LTP1 (lipid transfer protein) and protein Z have been shown to
contribute to foam stability and represent the most abundant proteins in
beer. On the other hand, it is argued that all proteins may contribute to beer
foam given the right biochemical properties. To support this idea, one group
demonstrated that certain foam‐active proteins are actually derived from the
surface of yeast cells.
Irrespective of the identity of the foam stabilizing proteins, their biochemi-
cal quality is key. To be soluble in beer, a polypeptide must be at least partly
hydrophilic, that is, it must have charged or polar groups or regions that are
attracted to water. To stabilize foam, the polypeptide must also have
gas hydrophobic
beer
hydrophilic
protein
hop alpha acid
Figure 13.10 Foam‐stabilizing proteins and hop acids. Hydrophobic regions on

proteins stick to gas. Hydrophilic regions stick to beer.
FOAM 409
ydrophobic (nonpolar) regions that are attracted to the gas in the bubble.
h
A model of this concept is demonstrated in Figure 13.10.
The most effective foam stabilizing polypeptides are those with the great-
est hydrophobicity, up to the limit that extremely hydrophobic polypeptides
will not dissolve in beer. When the polypeptide is in solution, the hydrophobic
regions tend to fold together to avoid the water. In contact with the bubble, a
foam stabilizing polypeptide must reorient itself to bring the hydrophobic
regions into contact with the bubble. The polypeptides make a coating on the
bubble that lowers surface tension and serves as a barrier to migration of
the gas from the bubble. This reorientation is not always reversible, so the
polypeptides are good for only one use. If foam is formed during the brewing
process, subsequently formed foam in finished beer is usually of inferior
quality.
Hop Bitter Acids Hop bitter acids, shown in Figure 8.10, help stabilize foam
and are particularly important for lacing. The iso‐alpha acids are believed to
bind to foam‐active polypeptide molecules and make links between them, as
shown in Figure 13.10. This cross‐linking stabilizes and stiffens the coating.
Iso‐alpha acids are amphiphilic, they have polar and hydrogen bonding
groups, and they have nonpolar side chains. Hydrogenated iso‐alpha acids
(Figure 4.30) tetrahydroisohumulone and especially hexahydroisohumulone
are more foam active than the natural hop acids. Hydrogenation of the double
bonds on the iso‐acid side chains increases their effective volume by an
unexpectedly large amount, increasing their hydrophobicity.
Melanoidins Melanoidins from dark malt can stabilize beer foam and give
rise to smaller bubbles. This may result from attraction between negative
charges on the melanoidins and positive charges on the foam stabilizing
polypeptides.
Ethanol “Beer” with no ethanol usually has very deficient foam. At low
concentration (<1% by volume), ethanol enhances foam stability, perhaps by
lowering the surface tension. As the ethanol concentration increases above
1%, foam stability decreases.
Foam Inhibitors Common foam inhibitors in beer are lipids from barley,
lipids from yeast, detergents, and other contamination from brewing equipment
or processes, like lubrication. Lipids from barley can be minimized by reducing
trub carryover. Lipids from yeast can be minimized by promoting yeast viability
and preventing autolysis. Lipids, especially fats and esters of fatty acids, are
strong foam inhibitors. They also have a negative effect on lacing. Detergents,
although foam enhancers on their own, inhibit foam and lacing in beer. It has
been suggested that the detergent molecules insert themselves into the bubble
surface and interfere with the linking between iso‐alpha acids and foam
polypeptides. Ethanol in high concentration inhibits foam.
Additives Some foam‐enhancing additives are believed to increase the

local viscosity of the beer in the bubble walls. The most commonly used
additive is propylene glycol alginate (PGA), a copolymer of mannuronic acid
and guluronic acid, with some of the carboxylic acid groups condensed with
propylene glycol (CH3─CHOH─CH2OH). The uronic acids are sugars whose
end carbon is a carboxyl (COOH) group instead of a hydroxyl (OH) group.
A fragment containing one mannuronic acid ester (left) and one guluronic
acid (right) is shown in Figure 13.11. In practice, there are usually blocks of
many of the same uronic acid, rather than a simple alternation. PGA is made
by reacting alginic acid, which is derived from seaweed, with propylene glycol.
It is usually dissolved in water and dosed at about 50 ppm before the final
filtration. PGA is incompatible with some finings, forming visible fluffy or
slimy precipitates in packaged beer after several months. It has been suggested
that the problem may be alleviated if the concentration of alginic acid, a
common impurity in PGA, is very low.
Metal ions with a +2 charge enhance foam stability. These ions may bind to
carbonyl (C═O) groups on the ring of iso‐alpha acids helping to link the acids
to one another, perhaps extending the range of linking of the acids to foam‐
active proteins. Cobalt sulfate was used as a foam‐enhancing additive in some
beers until the 1960s when its use was discontinued because of concerns
about the toxicity of cobalt.
Influence by Process Steps

Grist More protein in the grist gives more foam, possibly at the expense of
other aspects of beer quality, like haze formation. The use of less modified
malt enhances foam. Wheat malt, and even wheat flour, can increase foam.
Figure 13.11 Propylene glycol alginate.

FOAM 411
Dark malt adds foam‐enhancing melanoidins. Low‐protein adjuncts, including

sugars, rice, and maize, provide little or no protein and decrease foam.
Mashing/Wort Separation High temperature mash‐in is said to increase

foam. The use of a protein rest around 44–59 °C (113–138 °F) is thought to
reduce foam stability due to increased activity of protein‐hydrolyzing enzymes
at the lower temperature. Lipid pickup during mashing and wort separation
is also detrimental to foam.
Boiling/Hops Prolonged boiling slightly inhibits foam. Boiling has the

beneficial effect of extracting foam‐enhancing iso‐alpha acids from hops. The
use of hops products with reduced tannins enhances foam. Interestingly, dry
hopping can influence foam depending on the variety. When dry hopping at
0.4 kg/hL (1 lb/US bbl), some hop varieties were shown to enhance foam
stability, while others resulted in a reduction of foam.
Fermentation High‐gravity fermentation yields beer with reduced

concentrations of foam‐active polypeptides, significantly decreasing beer
foam. The formation of foam during fermentation depletes the activity of the
foam‐enhancing materials. Yeast releases a proteinase that can hydrolyze
foam‐active polypeptides. If this enzyme is not destroyed by pasteurization, it
will slowly degrade foam quality.
Conditioning/Packaging Any procedure that generates foam during

processing depletes foam stabilizing proteins in finished beer. Dissolved gas,
normally carbon dioxide, is essential for the formation and persistence of a
head. The inclusion of some nitrogen can greatly increase foam stability
quality. Details of this phenomenon are provided in the box below.
NITROGENATED BEER
Nitrogenated beer, also called nitrogenized beer or “beer on nitro,” is

beer that has been equilibrated with a relatively low pressure of carbon
dioxide and a high pressure of nitrogen (typically 25% CO2/75% N2).
Nitrogenated beer can be served with a creamy head with very fine
bubbles that last for a long time. Beer served in this way has a smoother
mouth feel than that served at ordinary levels of carbon dioxide and no
nitrogen. The unusual properties of the head derive from differences in
the chemistry of the two gases and from the physics of bubbles. At 4 °C,
carbon dioxide is about 70 times more soluble in water (on a vol-
ume basis) than nitrogen is under the same conditions of pressure.
(continued )
This property of nitrogen results in slower gas diffusion as compared

with CO2, leading to smaller bubbles and more stable foam. Nitrogen
bubbles release hop aroma less effectively than those of carbon dioxide;
for this reason nitrogenation is often considered less suitable for hoppy,
aromatic beer styles.
When a nitrogenated beer is poured into a glass, it has a homogenous,
creamy foam. Because the bubbles are smaller, the buoyant force pull-
ing them to the top is less, and they rise slowly. At the wall of the glass,
downward flow of beer can carry the bubbles with it, resulting in a
beautiful cascading effect.
Analysis and Quality Control of Foam

The major technical challenge in foam analysis and quality control is the
difficulty of generating foam from beer in a reproducible, yet realistic, way.
Perhaps the easiest method is to simply dispense the beer into a clean, clear
glass, recording impressions on the stability and attractiveness of the head.
The problem here is reproducibility and quantification. The following are
general descriptions of several methods used to assess head retention. They
are organized in increasing order of trouble and expense, going from free to
over $50 000 (US).
The Shake Method The shake method, described by Kapp and Bamforth
(2002), is a simple test that involves physical agitation in a tube to generate
foam. In brief, 5 mL of beer is added to a 15 mL tube. The tube is capped
tightly and shaken in a 40 cm arc with 10 oscillations to be completed in
10 seconds. The initial foam height is measured by calculating the distance
(mm) from the top of the foam to the foam/liquid interface. The cap is
removed and final foam height is measured after 30 minutes. Foam height or
percent change of foam height is reported.
Constant Method In the Constant method, a bottle of beer at the measuring

temperature is mounted in a clamp on a ring stand over a 1 L Berzelius (tall‐
form) glass beaker. The pouring apparatus is arranged so that the pouring
angle is determined by a mechanical stop. During the pour, the container
opening is 4 cm above the beaker, and the beer is directed to the bottom of
the beaker, rather than the sides. When all the beer has been poured, a timer
is started. The height of the liquid–foam interface and the top of the foam are
read at intervals. The height of the liquid after all foam has collapsed is also
measured. The logarithm of the foam height against time is fit to a straight
line, and various parameters are derived. This method is slightly more costly
FOAM 413
than the shake method, but it yields numerical results that can be useful for
monitoring foam quality. This method is most applicable to beer in bottles
or cans.
Sigma Value Method (ASBC Beer 22a) The beer is poured into a
cylindrical glass funnel of specific dimensions (pictured in Figure 13.12), with
a stopcock at the bottom, until the foam reaches a set height. Thirty seconds
later, the stopcock is opened and the liquid drained at a moderate rate. The
clock is started. After the clock runs 200 seconds, the liquid is drained into a
graduated cylinder over a period of 30 seconds, after which the clock is
stopped and the liquid volume (volume b) is measured. The foam remaining
in the vessel is discharged with a measured volume of a defoaming agent, and
the liquid is collected in a graduated cylinder. The volume is corrected by
subtracting the volume of the agent giving volume c. A calculation involving
the clock time (about 230 seconds) and volumes b and c yields a metric
termed the sigma value. Sigma values in the range of 95–105 seconds indicate
average quality. For best results, beer must be dispensed into the funnel in a
consistent and repeatable manner.
Rudin Method A glass tube with a porous disk on the bottom is marked at
intervals above the disk. Beer at the measurement temperature is added up
to the 10 cm mark. Carbon dioxide is blown through the disk, converting all
the liquid beer to foam until the foam reaches the 32.5 cm mark. The time it
takes for the liquid level from the collapsing foam to go from the 5 cm mark
to the 7.5 cm mark is the Rudin head retention value (HRV).
Flash Foam Method (ASBC Beer 22b) Beer is driven through a 0.8 mm
orifice, converting it entirely into foam, 200 mL of which is collected in a
graduated cylinder. After 90 seconds, the volume of liquid is measured. The
remaining foam is collapsed with isopropanol. The ratio of the volume of beer
released in 90 seconds to the entire volume of beer in 200 mL of foam is
multiplied by 200 to give the foam value units (FVU) of the beer.
NIBEM Method (ASBC Beer 50) A NIBEM apparatus generates a specific

amount of foam and has electrodes that detect the top of the beer head. As
the head recedes, the electrodes are automatically lowered to maintain
contact with the foam. The rate of lowering is recorded and used to generate
a head retention time called the NIBEM value.
Lacing One method for lacing analysis is to generate a 2 cm head on a glass
of beer. Beer is withdrawn from the bottom of the glass at intervals, as though
someone were sipping at it. When all the liquid has been removed, the lacing
is washed down to give a known volume of solution. The concentration of
Figure 13.12 A foam funnel used to measure the foam sigma value.
beer in the solution is analyzed by light absorption at 230 nm and used to

generate a lacing index.
13.4 HAZE
Clear beer is generally considered an important quality factor. Considerable

effort has been placed on ensuring clarity and its stability in beer over time.
Here we discuss what constitutes beer haze, how it is reduced, and how it is
measured. On the other hand, hazy or New England‐style IPAs promote and
embrace haze. Just as consistent clarity is a quality characteristic of bright
beer, consistent haziness is a quality characteristic of hazy beer. The promo-
tion of haze will not be discussed here.
Cloudiness, termed haze, is regarded as a defect in most beer styles. Beer
that is adequately clear is said to be bright. Haze in beer is caused by the
HAZE 415
resence of particles, especially those whose size is on the order of the wave-
p
length of visible light. Particles that are large enough to be seen individually
are called bits.
Bits
Bits, also called floaters or snowflakes, are visible particles in the beer often
associated with age. Bits are easy to remove by filtration, so any bits in the
consumer’s beer will have been formed during handling and storage of the
beer after packaging or from prolonged age. One source of bits is handling of
the beer in ways that raise foam. The bubble films are sometimes stable
enough that they remain as bits after the foam has collapsed. Finings and
other additives can interact in the package to produce bits. PGA (Figure 13.11),
and to an even greater extent its common impurity, alginic acid, can interact
with finings like papain and isinglass to produce a blizzard of bits. Brewers
should be cautious about introducing new additives. It may take months for
the bits to appear. The revised product should be subjected to several weeks
of accelerated aging as a minimum precaution. Other potential sources of bits
include impurities from processing such as dust from container closures,
lubricants, and filtration media.
Protein–Polyphenol Haze
Certain polypeptides can be can bound together by polyphenol molecules to
generate particles large enough to scatter light but small enough to remain in
suspension. Grain storage proteins that contain a high fraction of proline and
glutamine (Figure 13.13) yield fragments that are most active for haze f ormation.
The polyphenols most implicated in haze formation are proanthocyanidins,
which are composed of two connected polyphenols, each of which has a pair of
H
O
C
C
H2N
CH2
OH
H2C
C
NH2
O
(A) (B)
Figure 13.13 (A) Proline. (B) Glutamine.
Figure 13.14 Procyanidin B3.
fused six‐member rings connected to a third six‐member ring. Figure 13.14

shows procyanidin B3, a haze‐active proanthocyanidin found in beer.
Protein–polyphenol particles with only a few polypeptide molecules are
loosely held together. They break up at room temperature and only display
visible haze at low temperature. This type of haze is called chill haze.
Polyphenols can polymerize, especially in the presence of oxygen, which gives
them a tendency to bind more polypeptide molecules into larger particles.
The larger particles do not break up at room temperature. They give rise to
permanent haze that is visible at any temperature. Permanent haze is
promoted by age, heat, oxidation, heavy metals, and physical forces. Haze
may also be formed by excessive β‐glucan, excessive polyphenols, yeast in
suspension, and microbial contamination.
Promoting Colloidal Stability of Beer

A cold bottle of beer is poured into a glass. The beer is slightly hazy. As the
beer warms up, the haze disappears. This is chill haze. When the beer is chilled
again, the haze returns. If the temperature cycling is repeated a few more
times, the haze never disappears after warming; it becomes permanent haze.
It is important for beer quality to maintain clarity or colloidal stability for
the duration of the shelf life of the beer. Beer undergoes a cold conditioning
period and is then filtered cold to remove any chill haze material. But even
after removal of chill haze, haze‐forming protein or polyphenols are still
likely to be in the beer. Lowering the concentrations of both proteins and
polyphenols or eliminating one or the other can produce haze‐stable beer.
Haze‐active molecules can be captured and removed with finings, or they can
be degraded with enzymes.
Finings To control protein–polyphenol haze, either the haze‐active

polypeptides or the polyphenols are removed, usually by the addition of
HAZE 417
materials called finings. Finings clarify the beer by binding to haze‐active

molecules forming aggregates that can be removed by sedimentation or
filtration. Any treatment that removes or destroys proteins can be expected
to have some effect on head retention, because some haze‐active polypeptides
help promote foam. Some of the more common finings are listed below.
Silica gel is prepared by dissolving sand in sodium hydroxide to give
sodium silicate (Na2SiO3), acidifying the solution to precipitate silicon
hydroxide (silicic acid, Si(OH)4), and then drying in a kiln to give an amor-
phous (noncrystalline), highly porous solid. Certain grades of silica gel selec-
tively bind haze‐active polypeptides and have a lower (but not zero) affinity
for larger foam‐active polypeptides. Silica gel is usually mixed with deaerated
water and added to the beer on the way to the final filter.
Gelatin is a mixture of polypeptides made by hydrolyzing collagen. It is
usually prepared from animal skins. Gelatin selectively binds and coagulates
haze‐active polypeptides, which can then be allowed to settle. Gelatin
molecules are positively charged at the pH of beer. They can precipitate yeast,
which has negatively charged cells. Gelatin forms hydrogen bonds with haze‐
forming polyphenols allowing them to sediment out. An issue with gelatin is
that, as an animal product and potentially containing pork, it is unacceptable
to some customers.
Isinglass is a refined form of collagen derived from the swim bladders of
fish. In modern times, certain fish from between the tropic of cancer and the
equator, mostly in the region of Southeast Asia, are used. Like gelatin, isin-
glass has a positive charge at beer pH. It is attracted to yeast cells, which have
a negative charge, allowing them to form large particles that can be removed
by sedimentation. Usually isinglass is used to precipitate yeast from top
fermenting beer. It is typically added as a slurry after primary fermentation.
Like gelatin, isinglass is not acceptable to all customers.
Tannic acid is a polyphenol of plant origin. It binds and precipitates pro-
teins. Its use as a beer fining is not widespread, but advocates claim that, in
purified form, it selectivity precipitates haze‐active proteins.
Polyvinylpolypyrrolidone (PVPP), an insoluble, artificial polymer shown
in Figure 13.15, selectively removes polyphenols from beer. PVPP can accept
hydrogen bonds from the ─OH groups of polyphenols. The bonding is sup-
plemented by stacking forces. The PVPP particles with bound polyphenols
are filtered out. PVPP is classified either as one-use or as regenerable. The
one‐use grade has smaller particles giving a larger surface for interaction.
The regenerable grade requires a dedicated filter to capture the PVPP, which
is then washed with a sodium hydroxide solution and neutralized. One‐use
PVPP is often introduced together with silica gel, both of which are removed
with the same filter. This practice lowers the required dosage of both finings.
Because of the lower dose of silica gel, the risk of head retention loss is
decreased.
Figure 13.15 PVPP.
Figure 13.16 κ‐Carrageenan repeating unit.
Carrageenan, also called Irish moss, is a preparation derived from seaweed.

The active fining is kappa‐carrageenan (κ‐carrageenan), a polymer of galac-
tose modified with sulfate shown in Figure 13.16. Unlike the other finings men-
tioned in this section, carrageenan is added to the kettle at a rate of 4–8 g/hL
near the end of the boil. The molecules are negatively charged; they attract
and coagulate positively charged (basic) polypeptides that can give rise to
haze. The coagulated material comes out in the kettle trub.
Enzymes Papain is a protein hydrolysis enzyme derived from papaya. It is

effective for removing haze‐active polypeptides. It is not highly selective; it
can degrade foam‐active as well as haze‐active polypeptides. The problem is
exacerbated because papain is a very hardy enzyme; it can survive
pasteurization and be carried into the finished beer, hydrolyzing polypeptides
all the while. Often PGA is added to make up for the loss of foam‐active
polypeptides. The polypeptides hydrolyzed by papain yield free amino acids,
which can encourage growth of spoilage organisms.
HAZE 419
An enzyme, called Brewers Clarex®, specifically hydrolyzes proline‐rich

polypeptides, which are regarded as haze active. The enzyme in liquid form is
added to the fermenter at the start of fermentation. An additional advantage
of Clarex is that the polypeptides that it hydrolyzes are also responsible for
celiac disease and gluten sensitivity. Beer made with barley, wheat, or rye
treated with Clarex may qualify as a “reduced gluten” product, but it cannot
be labeled “gluten free” under current US regulation. It has been reported
that Brewers Clarex has no negative effects on beer foam.
Another enzyme used in the brewing industry is not a hydrolase but rather
a microbial transglutaminase (mTG). It functions by covalently cross‐linking
glutamine residues. The formation of colloids is promoted by the addition of
mTG after beer maturation but before filtration. In this manner, the protein‐
rich colloids created by mTG are then removed with filtration, improving
colloidal stability of the beer.
Other Hazes
Invisible Haze
Invisible haze is detected by light scattering at 90° but is not visible as cloudi-
ness in the beer. It is caused by very small particles (~100 nm). Invisible haze
is an analytical issue rather than a quality issue.
Starch/Carbohydrates Starch particles resulting from incomplete

hydrolysis during mashing can make the beer hazy. Other carbohydrate
materials from partial degradation of cell walls include beta glucan gums and
partially hydrolyzed hemicellulose.
Oxalate Oxalic acid (HOOC─COOH) is present in grain, including barley.

It can form an insoluble precipitate with calcium and other metal ions. If the
oxalate is not removed by precipitation during mashing, it is likely to form a
fine precipitate of calcium oxalate in the package. In addition to causing haze,
the precipitate particles can serve as nucleation sites for carbon dioxide
release, causing gushing. Oxalate precipitation in beer can be avoided by
using mash‐in water with sufficient calcium to remove the oxalate as insoluble
CaC2O4 during mashing.
Filter Aids Filter aids, like diatomaceous earth and perlite, can become
suspended in beer because of errors in procedure or equipment malfunctions.
Like oxalate, these particles can also cause gushing.
Packaging Materials Linings of bottle caps or can heads, processing

lubricants, dust in the empty package, fibers from packaging, and the like can
leave haze or bits in the beer. Identifying the source of the problem is often
more difficult than solving it. The ASBC Beer Inclusions publication, cited
below, has micrographs of many common problem materials.
Microbes Yeast that is not removed by filtration can be a significant cause

of haze. Some styles of beer are intended to have yeast haze. Yeast that is in
poor condition can break up and release fragments into the beer that are
difficult to remove. Bacteria can give rise to haze and other issues. Dead
bacteria can come with the malt and persist into the beer. Live bacteria
growing in the beer can give haze as well as films or rope (strings of gelatinous
polysaccharides) that customers will not tolerate.
Analysis and Quality Control of Haze

Haze is known in analytical chemistry as turbidity. Turbid samples scatter
light. The details of the scattering depend on the direction of light in and out,
the distribution of particle sizes, and the shapes of the particles. Figure 13.17
shows red laser light entering from the right passing through two samples.
The sample on the right is pure water. No scattering is evident. The sample on
the left is highly diluted milk, which provides small droplets of fat that scatter
the light.
Turbidity Standards The biggest issue in measuring haze is getting standard

samples for calibration. The official primary scattering standard for beer
analysis is formazin, a polymer suspension prepared from hydrazine sulfate
(N2H6SO4) and hexamethylenetetramine (formin, C6H12N4). Formazin has a
wide range of particle sizes and shapes. Working standards prepared from
these reagents have a short lifetime. The reagents, especially hydrazine sulfate,
Figure 13.17 Light scattering by clear and hazy samples.

HAZE 421
are toxic. Many laboratories use purchased standards prepared from

suspensions of polymer particles. These too have a limited lifetime. There are
permanent secondary turbidity standards (Gelex® from Hach, Inc.) that are
suspensions in a block of plastic. These last indefinitely.
Turbidity Units The major units for turbidity measurement are the formazin
turbidity unit (FTU); nephelometric turbidity unit (NTU), which is a version
of the FTU specified by the US Environmental Protection Agency (EPA);
and the formazin nephelometric unit (FNU), which is a version of the FTU
specified by the International Standards Organization (ISO). All involve
measurement of light scattered at 90° from the incident (incoming) light.
Instruments that measure NTU use a white light source. Those that measure
FNU use infrared light. Many instruments use angles other than 90°; some
measure multiple angles and make calculations to factor out light absorption
by the sample. NTU, FTU, FNU, and many other units of turbidity are defined
by the same standard suspensions. Solutions of 1 NTU (FNU, FTU) contain
1.25 mg/L of hydrazine sulfate and 12.5 mg/L of hexamethylenetetramine. The
ASBC standard solution prepared according to ASBC Method Beer 26 yields
a solution of 580 NTU. It is reported in the Method as a 10 000 FTU turbidity
standard, so an ASBC FTU is completely different from a standard FTU. We
will call this unit an ASBC turbidity unit. The European Brewing Congress
uses a unit called the EBC turbidity unit, which is equal to 0.25 NTU.
Table 13.4 summarizes the differences.
For example, to convert 20 EBC turbidity units to ASBC units, we look
at the intersection of the EBC row and the ASBC column. The entry is 69,
ASBC = 69 × EBC = 20 × 69 = 138, so 20 EBC units is equal to 138 ASBC units.
Secchi Disk A Secchi disk is a circle with a cross. Two opposite segments
are black and the others are white. The disk is mounted at the bottom of a
cylinder. The sample is added while viewing the disk from above until the
distinction between the light and dark areas of the disk are obscured by the
turbidity. The height of the sample is noted and compared with standards of
known turbidity. The turbidity can be calculated from the known turbidity of
TABLE 13.4 To Convert the Unit in the First Column

to That in the First Row, Multiply by the Table Entry
To Convert To
From NTU ASBC EBC
NTU 1 17.24 0.25
ASBC 0.058 1 0.0145
EBC 4 69 1
the standard and the heights of the sample and the standard. This method
depends on the lighting in the room and on the judgment of the analyst.
Visual Method (ASBC Beer 27A) Visually compare a beer sample to series
of standards, viewed in uniform red light. The turbidity is reported as equal to
that of the standard that seems closest in haziness to that of the sample.
Nephelometer Light scattered by the sample is compared with that

scattered by a standard and by turbidity‐free water. The sample scattering
should be between that of the water and of the standard. The nephelometer
light source can be a white incandescent bulb, an infrared or colored LED, or
white light passed through a wavelength filter. The scattering angle can be
90°, less than 90° (backscatter), or more than 90° (forward scatter). Many
units measure at several angles, including 0° (straight across from the source),
to correct for color in the sample.
Forcing Tests One major issue with haze is that it can take a long time to
form. It is routine for beer to have an expected shelf life of six months. Beer
that was brilliant when it left the brewery may be unappetizingly hazy after a
few months. The brewer needs to know within a few days of packaging if the
beer meets quality standards. There are two general methods to estimate the
lifetime of a batch of beer. The first is to subject the sample to conditions that
accelerate the aging process. These always involve high temperature and
sometimes other stresses. The second is to measure the concentrations of
haze‐active proteins and polyphenols.
ASBC Method Beer 27 II subjects the packaged beer to an elevated tempera-
ture (40, 50, or 60 °C) for one week, followed by cooling to 0 °C for 24 hours.
WARNING: Sealed packages heated to elevated temperatures can develop danger-
ous internal pressure that could cause the package to burst. Shielding must be
provided to protect against can or bottle fragments. The chill haze resulting from
this process is compared with that in samples that are kept at 22 °C. If a sample of
a certain beer takes nine weeks at 22 °C to throw the same haze as it does after
one week at 50 °C, then one week at 50 °C is equivalent to nine weeks at room
temperature. This result can then be used for other batches of the same beer.
Another accelerated aging process involves decarbonating the beer and
putting a small sample (10 mL) into a big (30 mL) test tube. The tube is held
for a certain time at 60 °C and then for a certain time at 0 °C. Periods of
24 hours at each temperature give results that correlate well with in‐package
methods. The availability of oxygen picked up during decarbonating and from
the headspace of the tube increases the intensity of the test. Subjecting a
small sample of decarbonated beer to 60 °C is a good deal less risky than to
do so with a sealed, carbonated package.
Case Study 423
Haze‐active proteins can be measured by treating the sample with tannic

acid and measuring the amount of precipitation that forms. Haze‐active
polyphenols can be precipitated with polyvinylpyrrolidone (PVP), a non‐
cross‐linked, soluble version of PVPP. A refined variation of these methods is
nephelometric titration. A solution of tannic acid (for polypeptides) or PVP
(for polyphenols) is added while measuring the turbidity with a nephelome-
ter. Light scattering increases as the target material precipitates. When the
material is depleted, precipitation stops, and the light scattering decreases
because additional solution dilutes the haze already present.
1. Calculate the frequency of light whose wavelength is 730 nm (7.30 × 10−7 m).

2. Why is the head on beer opaque?
3. What are two systems for reporting beer color?
4. What is CIE LAB color and how can it be used?
5. Describe the four mechanisms for foam collapse.
6. What is a surfactant?
7. What are the distinctions among foamability, foam stabilization, and
foam quality?
8. What are the sources of haze?
9. Discuss various finings and enzymes for haze‐proofing beer.
10. How is haze measured?
11. There has been increasing interest in making hazy or “juicy” beers. Using
what you know about making clear beer, how would you change your
process to produce hazy beer? How would you ensure that the beer is
consistently hazy?
Case Study
Case Study 1
You work for a brewery with an excellent quality control lab. You have
noticed a recent change in color for most of the brands, all increasing by
about 2 SRM. Explain how you will identify, evaluate, and resolve the
problem.
Case Study 2
You were recently hired as a brewer at a 40 bbl brewery with annual produc-
tion around 50 000 bbls. Your Director of Operations has expressed concern
over the substantial lack of foam stability in most of the brands. Develop a
plan to review and evaluate all points of production that could be the root
cause of the poor foam stability. Explain how you will identify, evaluate, and
resolve the problem.
BIBLIOGRAPHY
American Society of Brewing Chemists Identification Guide. 2008. Beer Inclusions:

Common Causes of Elevated Turbidity.
Aron PM, Shellhammer TH. 2012. A discussion of polyphenols in beer physical and
flavour stability. J. Inst. Brew. 116(4):369–380.
ASBC Methods of Analysis: Beer 10 Color. 2015. doi:10.1094/ASBCMOA‐Beer‐10.
ASBC Methods of Analysis: Beer 22 Foam Collapse Rate. 2018. doi:10.1094/
ASBCMOA‐Beer‐22.
ASBC Methods of Analysis: Beer 27 Physical Stability. 1975. doi:10.1094/
ASBCMOA‐Beer‐27.
Bamforth CW. 1985. The foaming properties of beer. J. Inst. Brew. 91:370–383.
Bamforth CW. 1999. Beer haze. J. Am. Soc. Brew. Chem. 57(3):81–90.
Bamforth CW. 2004. The relative significance of physics and chemistry for beer foam
excellence: theory and practice. J. Inst. Brew. 110(4):259–266.
Bamforth CW. 2006. Scientific Principles of Malting and Brewing. American Society of
Brewing Chemists. ISBN 978‐1‐881696‐08‐7.
Bamforth CW. 2012. Foam. American Society of Brewing Chemists. ISBN
978‐1‐938119‐00‐2.
Barth R. 2018. Beer Conditioning, Aging, and Spoilage. In Bordiga M (editor). Post‐
Fermentation and ‐Distillation Technology Stabilization Aging, and Spoilage. CRC.
ISBN 978‐1‐4987‐7869‐5.
Blasco L, Veiga‐Crespo P, Sanchez‐Perez A, Villa TG. 2012. Cloning and characteriza-
tion of the beer foaming gene CFG1 from Saccharomyces pastorianus. J. Agric.
Food Chem. 60(43):10796–10807.
Constant M. 1992. A practical method for characterizing poured beer foam quality.
J. Am. Soc. Brew. Chem. 50:37–47.
Gabriel P, Sladký P, Sigler K. 2016. A new rapid high‐throughput method for predic-
tion of beer colloidal stability. J. Inst. Brew. 122:304–309.
Hughes PS, Baxter ED. 2001. Beer: Quality, Safety, and Nutritional Aspects. Royal
Society of Chemistry. ISBN 0‐85404‐588‐0.
Kapp GR, Bamforth CW. 2002. The foaming properties of proteins isolated from
barley. J. Sci. Food. Agric. 82:1276–1281.
BIBLIOGRAPHY 425
Maye JP, Smith R, Leker J. 2016. Dry‐hopping’s effect on beer foam. Proceedings of
the World Brewing Congress, Dever, Colorado, USA.
Ronteltap AD, Hollemans M, Bisperink CGJ, Prins A. 1991. Beer foam physics. MBAA
Tech. Q. 28:25–32.
Taylor JP, Jacob F, Arendt EK. 2015. Fundamental study on the impact of transglu-
taminase on hordein levels in beer. J. Am. Soc. Brew. Chem. 73(3):253–260.
Wang H‐Y, Qian H, Yao W‐R. 2011. Melanoidins produced by the Maillard reaction:
structure and biological activity. Food Chem. 128:573–584.
Chapter 14
BIOLOGICAL STABILITY
The advantage of a small brewpub with only draft sales over a production
brewery with a distribution network lies in product turnover. If the beer is
quickly sold with sales only in the pub, then stability is less of a concern.
However, when beer is packaged and distributed, with product potentially
sitting on warm shelves for two to six months, then the importance of stabil
ity becomes critical. With competition for shelf space high, successful brew
ers will be those who put forward the best and most stable product.
Inadequate attention to stability could cost the brewery customers, or worse
yet, recalled product.
There are three main areas of beer stability that require attention: micro
bial spoilage, flavor staling, and colloidal stability. This chapter focuses
on microbial stability. Flavor stability was discussed in Chapter 12; colloidal
stability was covered in Chapter 13.
Although yeast is a microbial organism at the core of beer production, all
steps of production, from raw materials through packaging and on to shelf‐life
stability, can be threatened by unwanted microorganisms commonly found
in the environment. Microbes are everywhere, so the brewer must always

427
428 BIOLOGICAL STABILITY
be careful to detect and avoid contamination. Common sources of microbial

spoilage in the brewery include the following:
• Raw materials, especially malt.

• Untreated water.
• Airborne dust and debris.
• Insects.
• Dirty equipment and inefficient clean‐in‐place (CIP).
• Unclean floor drains
• Boots worn outside of the brewery
• Brewers.
After boiling, beer is free of live microbes. The brewery must focus attention on
sources of potential spoilage at all steps after kettle knock out. Meticulous and
thorough cleaning is vital to maintaining microbial stability. Chemical sanitiza-
tion and sterilization is covered in Chapter 16. Cleanliness extends beyond
equipment and should also encompass floors, walls, and drains. It also includes
employee cleanliness. Proper hygiene, work apparel, and boots for brewery use
only are good manufacturing practices to help avoid contamination.
Microbial stabilization is paramount to beer quality and consistency.
Contamination can lead to the following:
• Changes in alcohol content and attenuation after packaging.

• Excessive CO2 production, overcarbonation, and ruptured bottles or cans.
• Beer off‐flavors.
• Gushing.
• Premature yeast flocculation.
• Excessive acidity.
• Turbidity (haze).
14.1 IDENTIFYING SPOILAGE MICROORGANISMS
Identification of bacteria through traditional microbiological approaches

aids the identification of potential spoilage bacteria. By knowing the
identity of the contaminating microorganisms, the brewer may better

understand the source of contamination and potential risk of spoilage. The
Gram stain, oxidase test, and catalase test are simple methods that assist
in identification and characterization of spoilage microorganisms. To run
these tests, a bacterial isolate must first be obtained through the methods
described in Section 14.3.
IDENTIFYING SPOILAGE MICROORGANISMS 429
Chemical Tests
Gram Stain The Gram stain is a method for the differential labeling of the
bacterial cell wall. Gram‐positive cells have a thick cell wall outside of the cell
membrane. The cell wall retains crystal violet stain. Gram negative cells have
a thinner cell wall that is enclosed in a second membrane. In Gram‐negative
cells, the crystal violet stain is washed away. The application of a red counter‐
stain, safranin, colors the cells pink (Figure 14.1). Using this method, Gram‐
positive cells stain purple, obscuring the pink stain; Gram‐negative cells stain
pink. A mixed culture of Gram‐positive and Gram‐negative bacteria is shown
in Figure 14.1. The procedure for the Gram stain is as follows:
• Flame the top side of a clean slide.

• Draw a 1 cm circle with a wax pencil on the slide.
• Inside the circle, add a drop of sterile water with a sterile inoculation loop.
• Add the bacteria sample, smear it out.
• Heat‐fix the sample by passing the bottom of the slide through a flame
quickly three times.
• Turn off all flames.
• Add a few drops of crystal violet solution to the sample.
• Wait 30 seconds, then rinse by dipping the slide in pure water three
times.
• Add a few drops of Gram’s iodine solution.
• Wait 30 seconds, then rinse by dipping the slide three times in pure
water, then three more times in fresh pure water.
Figure 14.1 Gram stain. Source: Photo: Kent Pham.

• Hold the slide at a 45° angle and allow drops of decolorizer solution to
wash across the sample until the flow is clear (~15 seconds).
• Add a few drops of Safranin stain to the sample. Let stand 60 seconds.
• Rinse in pure water. Allow to dry.
• Inspect the sample under a microscope with an oil‐immersion objective
to visualize the bacteria.
Oxidase Test The oxidase test detects the presence of cytochrome C

oxidase. Most bacteria that are capable of aerobic respiration use the enzyme
cytochrome C oxidase to accept electrons, transferring them to oxygen.
In brief, an oxidation indicator, tetramethyl‐p‐phenylenediamine (TMPD) is
mixed with a bacterial sample. Cytochrome C oxidase, if present, accepts
electrons from the indicator, causing it to turn purple, a positive oxidase test
(Figure 14.2).
The test can be applied in several ways. A drop of indicator solution can be
added to a sample of bacteria on a slide. A sample of bacteria can be added
to a piece of filter paper impregnated with the indicator. A drop of indicator
solution can be added directly to a colony on a plate. A swab impregnated
with indicator solution can be wiped across a surface with the bacteria. In
each case, if a purple color develops within 10 seconds, the sample is oxidase‐
positive. If the color develops between 10 and 20 seconds, the result is
recorded as a delayed positive. If no color develops within 20 seconds, the
sample is oxidase‐negative.
Catalase Test The catalase test identifies the presence of catalase, an enzyme
that catalyzes the decomposition of hydrogen peroxide (H2O2) to oxygen and
water. Hydrogen peroxide is a toxic by‐product of oxygen‐based respiration.
Figure 14.2 Oxidase test. Source: Photo: Kent Pham.

Figure 14.3 Catalase test. Source: Photo: Kent Pham.
Most organisms that can use oxygen make catalase to protect themselves from
hydrogen peroxide toxicity. To run the test on a glass slide, a drop of 3%
hydrogen peroxide solution is placed on the slide, and an inoculum of bacteria
is added. Alternatively, the test can be run in a test tube with several milliliter
of hydrogen peroxide. The transfer of the reagent and the bacteria should be
done with a wooden stick or a glass rod, not any wire containing iron. If catalase
is present, the catalase‐dependent cleavage of hydrogen peroxide into water
and oxygen will produce copious bubbling; a positive catalase test (Figure 14.3).
Cell Morphology
When preparing cells for Gram staining, cell shape can also be noted.
Identification of bacterial morphology is essential for proper identification.
Most species of bacteria have a characteristic shape that does not change.
However, because some bacteria genera may share similar shapes and sizes,
differentiation by morphology alone is not enough. Figure 14.4 illustrates dif
ferent cell shapes and sizes of prokaryotes. Typical bacteria are 0.5−2 μm in
size. Bacilli are rod‐shaped. Cocci are spherical. Spirochetes are spiral‐shaped.
The prefix strepto‐ means long chains. The prefix staphylo‐ means clusters. In
this manner, streptobacilli are chains of rod‐shaped cells and staphylococcus
are clusters of cocci. Further differentiation is warranted for pairs of cells,
called Diplo‐, or for clustering of exactly four cells, called tetrads. Pleomorphic
bacteria demonstrate variability in the size and shape.
Coccus Diplococci Tetrad Streptococci Staphylococci
Cocci
Bacillus Diplobacilli Streptobacilli Palisade
Bacilli
Spirillum Spirochete
Figure 14.4 Bacterial morphology.
Common Spoilage Bacteria

A combination of the tests described above along with cellular morphology
and point of contamination records are essential for the identification of bac
teria. The following is a discussion of the most common spoilage bacteria in
the brewery broadly grouped into categories that make them unique among
beer spoilage microorganisms. Table 14.1 summarizes general characteristics
of the most common beer spoilers.
Lactic Acid Bacteria (LAB) Lactobacillus spoilage results in acidification

through lactic acid production and turbidity. All Lactobacillus are Gram‐
positive rods (Figure 14.5). They are commonly aerotolerant anaerobes with
typical risk in fermentation vessels, bright tanks, pitching yeast, and packaged
beer. While there are many Lactobacillus species, Lactobacillus brevis is the
most common spoiler, isolated in over 50% of contaminated samples. L. brevis
is heterofermentative and grows best at 30 °C and pH 4−6. It is generally
resistant to hop compounds and can utilize dextrins and starch, making it a
severe risk for over‐attenuation.
In addition to L. brevis, several other Lactobacillus species are known
spoilers of beer. These include L. amylovorus, L. backii, L. brevisimilis,
L. buchneri, L. casei, L. collinoides, L. coryniformis, L. delbrueckii, L. fer
mentum, L. frigidus, L. harbinensis, L. hilgardii, L. homohiochi, L. lindneri,
L. malefermentans, L. parabuchneri, L. paracasei, L. paracollinoides, L. pen
tosus, L. plantarum, L. perolens, L. reuteri, L. rhamnosus, and L. sakei. L. casei
is known to produce diacetyl, yielding an unacceptable buttery off‐flavor.
433
Figure 14.5 Lactobacillus brevis. Source: Photo: Eric Jorgenson.
Mechanisms of lateral gene transfer or evolution of novel resistance

mechanisms may cause expansion of this list.
Pediococcus Pediococcus spoilage may result in acidification, turbidity,

and/or diacetyl production. All Pediococcus species are Gram‐positive cocci
that grow in pairs or tetrads (Figure 14.6). They are aerotolerant anaerobes
that typically infect fermentation vessels, bright beer tanks, pitching yeast,
and packaged beer. They are homofermentative bacteria that commonly
produce excessive diacetyl. In addition, some species can produce
exopolysaccharides (EPS). EPS causes a thickening of the beer known as
rope. In spontaneous fermentations like lambics, ropiness is resolved over
time by wild yeast such as Brettanomyces. Pediococcus species can be resistant
to hops and are very ethanol tolerant. Identified spoilage species in beer
include P. acidilactici, P. claussenii, P. damnosus, P. inopinatus, P. pentosaceus,
and P. parvulus.
Leuconostoc Leuconostoc mesenteroides is the only known species to

contaminate beer. It requires a small amount of oxygen for growth. It is a
heterofermentative lactic acid‐producing bacterium and is Gram‐positive
with a pleomorphic morphology, forming either short rods or cocci. It is
ethanol and hop tolerant with very high acid tolerance.
Acetic Acid Bacteria (AAB) Acetobacter and other AAB are differentiated
from LAB in that they produce acetic acid through fermentation, they are
obligate aerobes, and they are Gram‐negative (Figure 14.7). Because of their
dependence on oxygen, Acetobacter can cause spoilage at beer‐air interfaces.
Common problem areas are pitching yeast, balance lines, draft lines, cask
Figure 14.6 Pediococcus damnosus. Source: Photo: Eric Jorgenson.
Figure 14.7 Acetobacter aceti. Source: Photo: Eric Jorgenson.
beers, and barrels. With modern brewing practices that severely reduce
dissolved oxygen in finished beer, AAB rarely spoils packaged product.
A. aceti and A. pasteurianus are known beer spoilers. Acetobacter oxidizes
ethanol into acetic acid, otherwise known as vinegar, the primary off‐flavor
caused by infection. Acetobacter can also oxidize acetate to carbon dioxide
and water. AAB are hop and ethanol (6−8% alcohol by volume [ABV]) tol
erant and very acid tolerant. Acetobacter are pleomorphic, shaped as rods or
ellipsoids, curved or straight. They may grow singly, in pairs, or as chains.
Because Acetobacter are obligate aerobes, they represent a major infection
risk in beer conditioning in wooden barrels due to openings in the wood and
between the barrel staves. For this reason, effort should be made to limit
Figure 14.8 Gluconobacter oxydans. Source: Photo: Eric Jorgenson.
xygen entering barrels by preswelling the barrels and minimizing headspace

o
after filling. It has been reported that barrels previously contaminated with
Acetobacter that produced excessive amounts of acetic acid can be saved by
CO2 purges of the barrel.
Gluconobacter Gluconobacter are Gram‐negative obligate aerobes, with

risk areas where beer meets air including pitching yeast, balance lines, draft
lines, cask beers, and barrels (Figure 14.8). They also oxidize ethanol into
acetic acid, but unlike Acetobacter, they do not produce CO2 through
oxidation of acetate. They utilize sugar over ethanol. Infection is characterized
by vinegar flavors from acetic acid, turbidity, increases in viscosity, and/or
pellicle formation.
Gluconobacter oxydans is the only known beer spoiling species, often form
ing single or short chains of bacilli‐shaped cells. Gluconobacter may be motile
or nonmotile, with motility enabled by multiple flagella. Cells may produce
pink or brown pigments that may assist differentiation of colonies on agar
media. Gluconobacter are hop, ethanol (12−13% ABV), and acid resistant, with
growth occurring in beer as low as pH 3.6. Because they are obligate aerobes,
minimizing oxygen at every step of production will prevent spoilage.
Enterobacter/Coliforms Enterobacteriaceae are a large family of Gram‐

negative, often rod‐shaped, facultative anaerobic bacteria including the
genera Citrobacter, Enterobacter, Hafnia, Klebsiella, Rahnella, Salmonella,
Serratia, and Shigella. Some species are encapsulated, which aids identification
through Gram staining (Figure 14.9). Hafnia protea and Rahnella aquatilis
(formerly Enterobacter agglomerans) are known contaminants of pitching
yeast, negatively affecting fermentation rates and leading to downstream
Figure 14.9 Klebsiella pneumoniae. Source: Photo: Eric Jorgenson.
contamination issues when yeast is repitched from cone to cone. Off‐flavors

of H. protea include parsnip‐like flavor and aroma. Off‐flavors from
R. aquatilis include diacetyl and DMS. Both species are hop and ethanol
resistant. Species of Klebsiella, Citrobacter, Enterobacter, Obesumbacterium,
and Escherichia are known wort spoilers, producing dimethyl sulfide (DMS),
organic acids, and diacetyl. These species of Enterobacter are hop resistant
but are very sensitive to ethanol and do not thrive under anaerobic conditions,
so they are not found in finished beer as active spoilage organisms, but
typically originate from contamination of wort or pitching yeast.
Zymomonas Zymomonas is a genus of anaerobes. Zymomonas mobilis

subsp. mobilis and Z. mobilis subsp. pomacea have been identified as
packaged beer spoilers, particularly finished beer that has been primed for
secondary fermentation in the package such as cask beer or bottle‐conditioned
beer. Zymomonas contamination is characterized by strong turbidity,
acetaldehyde, hydrogen sulfide, and overcarbonation. The reason Zymomonas
contaminates packaged beer for secondary fermentation is that it can only
utilize glucose, fructose, and sucrose. Secondary fruit additions may also
promote contamination. Strains are very alcohol tolerant (>16% ABV), hop
resistant, and acid tolerant (<pH 3.5). Zymomonas are reportedly aerotolerant
anaerobes, so culture conditions for detection should be anaerobic as they do
not thrive in the presence of oxygen. Zymomonas are Gram‐negative with a
rod‐shaped morphology. Cells grow singly, in pairs, or in a rosette pattern.
Megasphaera Megasphaera cerevisiae, Megasphaera paucivorans, and

Megasphaera sueciensis have been identified packaged beer spoilers. Infection
is characterized by turbidity with high levels of hydrogen sulfide, butyric acid,
and caproic acid. Megasphaera cells are Gram‐negative cocci that are obligate
anaerobes. Sampling and plating for detection must be strictly anaerobic with
minimal exposure to air, because even brief oxygen exposure can compromise
culturability. Megasphaera are sensitive to low pH and do not thrive in beer
above 3% ABV. For these reasons, Megasphaera often infect early or stalled
fermentations or low‐alcohol beer.
Pectinatus Pectinatus cerevisiiphilus and Pectinatus frisingensis are known

packaged beer spoilers. Pectinatus species are Gram‐negative, obligate
anaerobes with contamination indicated by turbidity and high amounts of
acetic acid, propionic acids, and acetoin, resulting in a sour rotten egg aroma
and flavor. They are hop tolerant, acid tolerant, and ethanol tolerant up to
approximately 5% ABV. Cell morphology are curved or spiral rods. Strict
anaerobic conditions must be met for culturing, as oxygen exposure is lethal.
Bacillus Bacillus coagulans and Bacillus stearothermophilus are known

spoilers of wort and malt, producing lactic acid in hot, sweet wort.
Contaminating Bacillus species can grow singly, in pairs, or in chains and
are Gram‐variable, appearing Gram‐positive during stationary growth
(Figure 14.10). They grow best in aerobic environments but can survive
through anaerobic conditions. Bacillus are very hop sensitive and thus do not
actively contaminate finished beer. However, they are very well known for
their ability to form endospores, which are highly heat tolerant. They can
persist through wort boiling, though subsequent germination requires ideal
nutrient and growth conditions that are not present in finished beer. Because
of the hardiness of Bacillus endospores, Bacillus is a common contaminant of
dirty zwickels. If identified on nutrient‐rich agar media, one should check the
Figure 14.10 Bacillus spp. Source: Photo: Michelle McHugh.

possibility that the problem comes from the environment as a result of poor
aseptic conditions during sampling, rather than from the beer.
Wild Yeasts
Any yeast species that is unintentionally present in beer is considered a wild
yeast, including certain strains of Saccharomyces cerevisiae. Wild yeast spoil
beer through secondary fermentation, which leads to overcarbonation, thin
body, noncompliance with ABV, and potential off‐flavors. Yeasts that pro
duce phenolic off‐flavors, like 4‐vinylphenol and 4‐vinylguaiacol, are consid
ered POF+.
Brettanomyces (also called Dekkera) was first discovered as a beer spoiler
in 1904. Five species have been identified: Brettanomyces anomalus (also
called Brettanomyces clausenii), Brettanomyces bruxellensis (also called
Brettanomyces intermedius or Brettanomyces labbicus), Brettanomyces custe
rianus, Brettanomyces naardenensis, and Brettanomyces nanus. Brettanomyces
are common beer spoilers because, like S. cerevisiae, they are Crabtree posi
tive. They typically require more oxygen than S. cerevisiae to reach critical
biomass, and they grow more slowly. Brettanomyces species present greater
spoilage risk due to their ability to utilize cellobiose and dextrins. For this
reason, they commonly take up residence in the wood of barrels and may
referment the dextrins in beer. They will survive in very poor, nutrient‐limited
conditions.
Brettanomyces species can provide sour off‐flavors through a process
known as the Custer effect. The Custer effect is the ability to produce acetic
acid (vinegar) from acetaldehyde in the presence of oxygen. This process is
very slow, requiring up to six months and exposure to oxygen. Other flavors
vary greatly by strain and by brewery. Predominant flavors include vinyl and
ester phenols, esters, and isovaleric acid, which contribute to flavors described
as clove, spicy, horsey, barnyard, smoky, medical, band‐aid, goaty, floral, and
tropical fruit.
There are a variety of non‐Saccharomyces yeasts that can grow in beer.
Their spoilage potential is variable and, if isolated by the brewery lab, should
be further evaluated for spoilage risk by testing over‐attenuation and pro
duction of phenolic off‐flavor. Common genera found in beer include Pichia,
Candida, Saccharomyces, Torulaspora, Zygosaccharomyces, Kluyveromyces,
Rhodotorula, Aureobasidium, Schizosaccharomyces, Hanseniaspora, Wicker
hamomyces, and many others.
A major beer spoilage yeast in unfiltered, unpasteurized beer is the yeast
Saccharomyces cerevisiae var. diastaticus, informally called diastaticus. While
some diastaticus strains are true wild yeast contaminants, other strains
are commercial ale strains selected for their high attenuation and production
of phenolic flavor. Excessive attenuation by diastaticus is caused by the
secretion of a glucoamylase, which catalyzes breakdown of dextrins into

fermentable sugars. Contamination and refermentation in packaged prod
ucts can lead to overcarbonation, changes in flavor, and increases in ABV
above that which may be legally permissible. Diastaticus strains represent
great heterogeneity in their ability to overattenuate and create off‐flavors, so
their spoilage potentials vary.
14.2 MICROBIAL STABILIZATION METHODS
There is a difference between a contaminating microorganism and a spoilage

organism. All bacteria or yeast present in processing or finished beer where
they do not belong are contaminating microorganisms. Contaminating micro
organisms that damage the product for example by lowering the pH, pro
ducing excess carbon dioxide, or changing the flavor profile are spoilage
microorganisms. Beer is susceptible to contamination, especially in small
operations without filtration or pasteurization, but there are contaminants
that may represent low to no risk in product quality. Determining the spoil
age potential of contaminating microorganisms is an important role for a
quality control scientist in a brewery.
Spoilage Potential
From a food safety perspective, beer is inherently free of pathogenic bacteria.
Pathogenic bacteria are those that cause sickness in humans, most commonly
including species of Salmonella, Clostridium, Campylobacter, Staphylococcus,
Listeria, Yersinia, and a specific Escherichia coli strain O157:H7. The US Food
and Drug Administration defines acid foods as those that have a natural pH of
4.6 or below. The reason for this distinction is that no pathogenic bacteria can
grow from spores at a pH lower than 4.6. Because beer is boiled and naturally
has a pH lower than 4.2, it is not susceptible to dangerous contamination.
Some of the factors that account for the safety of beer include boiling, low pH,
hops, alcohol, and low sugar. A beer with low alcohol and hops, perhaps mixed
with fruit juice, could move out of the safety zone. Brewers who create innova
tive beers with atypical ingredients should not take food safety for granted.
Although beer microbes are not normally a safety issue, beer is not free
from all spoilage microorganisms that threaten beer quality. Certain process
points may be more prone to infection than others. For example, consider the
properties of wort and beer as outlined in Table 14.2. In addition to pH, the
lack of simple carbohydrates and oxygen, and the presence of ethanol, carbon
dioxide, and hop bitter compounds in beer all provide a bacteriostatic envi
ronment; there are few microorganisms that can tolerate such conditions.
Those that may survive and may even thrive are discussed in Section 14.1.
MICROBIAL STABILIZATION METHODS 441
TABLE 14.2 Spoilage Potential of Wort Versus Beer

Wort Beer
Rich in carbohydrates Unfermentable dextrins
pH 5.2−5.8 pH < 4.2
Aerobic Anaerobic
Variable temperature Presence of CO2
>4% Ethanol
Hops
Unlike beer, wort is a microbial haven, rich in simple sugars for food and
oxygen that supports aerobic bacteria growth. With a pH of 5.2−5.8, it is not
food safe; it can also promote the growth of aerobic beer spoilers. Therefore,
wort should not be stored for a long time in the brewery without sufficient
sterilization. The major use of stored wort is for yeast propagation. For small‐
scale preparations, if wort cannot be fermented quickly, it can be autoclaved
and stored at 4 °C before use. For larger‐scale preparations, an in‐line pas
teurization device during wort transfer from the brewhouse to a wort storage
tank in the yeast propagation room is required.
Pasteurization
Pasteurization is a method of enhancing microbial stability of food by the
controlled application of heat. First applied to wine in 1864 by Louis Pasteur,
the pasteurization process is practical and effective. To pasteurize beer, the
temperature of the beer is increased to a high enough temperature for a long
enough time to kill most spoilage microbes. The key consideration here is that
pasteurization kills most of the spoilage microorganisms; it does not sterilize.
The severity of a pasteurization treatment is measured in pasteurization
units (PU). A pasteurization unit is a degree of heating (time and temperature)
that kills that same fraction of the target microbes as does the exposure of the
sample to 60 °C for one minute. For the spoilage organisms normally present
in beer, the number of pasteurization units accomplished can be estimated
from the equation
T 60  C
PU t 1.389 ,
where PU is the number of pasteurization units, t is the time in minutes, and T

is the temperature in degrees Celsius. For example, if a brewer wished to pas
teurize beer to 25 PU by holding at 60 °C, then solving for t yields a hold time
of 25 minutes. To shorten the time required to reach 25 PU, the brewer can
raise the temperature. Increasing the pasteurization temperature to 75 °C with
a goal of 25 PU yields a hold time of 11 seconds. This is the principle of flash
pasteurization. Because pasteurization can change the flavor of beer, the low
est effective severity is applied. Beer is most effectively pasteurized at 15−30
PU with 15 PU enough for low‐risk beers (high alcohol, low final gravity…)
and 30 PU for higher‐risk beers.
The usual pasteurization regimes are effective for organisms normally
found in beer. The use of unconventional ingredients and processes can radi
cally alter the picture. As one example of this, a brewery experimenting with
post‐boil additions added cacao nibs after fermentation. It was expected that
any potential spoilers would be neutralized by pasteurization. But months
later, bottles picked up excessive carbonation and off‐flavors. The cause was
determined to be an unconventional spoiler of the genus Sporolactobacillus.
As the name suggests, these bacteria form temperature‐tolerant spores. They
were introduced by the post‐fermentation addition and resisted pasteuriza
tion. When considering PU target values, it is also important to consider that
different microorganisms respond differently to PU values. For example,
Lactobacillus are more resistant than S. cerevisiae and wild yeast are more
resistant than Lactobacillus.
Tunnel Pasteurization Tunnel pasteurization is performed on bottled or

canned beer only. The packages travel on a conveyor and are sprayed with
water at a controlled temperature, as shown in Figure 14.11. In the example
shown, there are two preheat and two cooldown zones. In the first preheat
zone, the beer is heated with a water spray at around 35 °C. In the second
preheat zone, the spray is about 50 °C. The heating zone uses water several
degrees higher than the pasteurization temperature to bring the internal
temperature of the bottle to the pasteurization temperature, typically about
60 °C. The hold zone keeps the pasteurization zone constant. Two cooldown
zones follow with temperatures a few degrees lower than the corresponding
Preheat 1 Preheat 2 Heat Hold Cool 1 Cool 2
Figure 14.11 Tunnel pasteurization.

preheat zones. The preheat water exits cooler than it entered, it is then used
in a cooldown zone. The cooldown water picks up heat from the hot bottles.
It then is used as preheat water. The heat zone is hotter than the desired
pasteurization temperature. When the beer reaches the pasteurization
temperature, the packages enter a zone in which the water spray is at the
pasteurization temperature to prevent the beer from cooling. Because heat
exchange between the spray and the beer is slow, it can take 40−60 minutes
for a package to go from start to finish through a tunnel pasteurizer.
A tunnel pasteurizer takes up a lot of floor space because the system must
be designed to hold beer at the appropriate time and temperature to achieve
the target number of PUs. In a conveyor system, treatment time is the length
of the treatment zone divided by the speed. The tunnel length can be short
ened if the speed is slower, but then the throughput will be limited. Tunnel
pasteurization is not practical for large packages like kegs because it takes
too long for them to heat up and cool down. Other considerations are pres
sure and volume in the package. The volume of beer increases by 2% when
the temperature increases to 65 °C. Gas pressure in the headspace (empty
space above the beer) increases as temperature increases and as volume
decreases. Evaporation of water and ethanol adds to this. For glass bottles, a
minimum of 4% headspace is recommended to keep the pressure at a safe
level; for a 355 mL (12 fl. oz) serving, that comes to 14 mL (0.5 oz). Cans are
much less stiff than bottles; they deform under pressure, so the internal tem
perature should be limited to 62 °C.
At 60 °C, the equilibrium pressure of carbon dioxide of beer with 2.8 vol
umes of carbonation can be 7 bar (85 psig) or more. Tunnel pasteurization is
only practical because equilibrium is reached slowly, and the actual pressure
is temporarily lower than the equilibrium pressure; the beer is supersaturated
with carbon dioxide. Any jostling or bumping of the packages can cause the
internal pressure to reach dangerous levels almost instantly. The major advan
tage of tunnel pasteurization is that it is applied after the package is sealed.
There is no opportunity for microbes to enter after pasteurization. Some dis
advantages are high cost of operation, high space requirement, and a lot of
ruined beer if the unit stops during a run.
Flash Pasteurization In flash pasteurization, the pasteurization temperature

is high, and the hold time is low. The typical maximum temperature is in the
range of 71–79 °C for a period of 15–60 seconds. The volume under treatment
at a given time is small to allow the temperature to rapidly rise and fall. The
rapid, turbulent flow ensures that all beer experiences the designed time‐
temperature program, but it makes it impossible to maintain supersaturation
of carbon dioxide. The unit must be run under a high pressure of carbon
dioxide to maintain carbonation. The beer is first pumped through a plate heat
exchanger called the regeneration section. Here, it is preheated by hot beer
Pasteurized beer Coolant
Cooling section
Unpasteurized beer
Regenerator
Heating section
Holding loop
Steam
Figure 14.12 Flash pasteurization.
exiting from the holding loop. The warm beer now enters another plate
exchanger, the heating section, where it is heated to the pasteurization
temperature by steam or hot water. Next, the holding loop keeps the beer hot
for the correct length of time. Beer from the holding loop enters the other side
of the regeneration section, where it is cooled by the entering cold beer. Finally,
the pasteurized beer is chilled to packaging temperature by refrigerated
coolant in the cooling section. The process is illustrated in Figure 14.12.
Because of the shorter residence times at high temperatures, there is less of a
negative impact on beer color and flavor. The flash pasteurization unit feeds
directly into the packaging unit to minimize the chance of contamination of
the pasteurized beer. The major drawback of flash pasteurization is that keg
and package filling must be accomplished under near‐sterile conditions to
avoid reintroduction of spoilage organisms.
Sterile Filtration
Sterile filtration is a method of microbial stabilization that does not require
heat. Sterile filtration requires the beer to be passed through a membrane
filter with a pore size of 0.45 μm or smaller, which effectively removes all
yeast and bacteria. These filters can provide greater than 99.9% sanitation,
because the pore sizes are smaller than all brewing microorganisms
(Table 14.3). The term “sterile” filtration is a misnomer because a pore size of
0.45 μm may not exclude the smallest biological units such as spores and
viruses, thus they are not truly sterile. Most filter systems used for beer
clarification do not provide effective microbial filtration.
TABLE 14.3 Cell Sizes of Common

Brewery Microorganisms
Microorganism Size
Saccharomyces cerevisiae 9.5 × 10 μm
Saccharomyces pastorianus 7.0 × 8.5 μm
Brettanomyces bruxellensis 3.0 × 5.0 μm
Escherichia coli 0.5 × 2.0 μm
Lactobacillus brevis 0.5 × 3.0 μm
Pediococcus claussenii 1.0 × 2.5 μm
Acetobacter aceti 0.6 × 2.0 mm
Megasphaera paucivorans 1.5 × 1.2 μm
Commonly used sterile filters consist of cartridge/canister filters and

lenticular filters. Their operating principles and designs are discussed in
Chapter 10. Because of the small pore sizes employed in sterile filtration, the
filters can be easily clogged as material collects on the membrane. Therefore, it
is important to reduce yeast and large particles before sterile filtration. Particle
reduction can be accomplished by prolonged cold maturation times, the use of
fining agents such as gelatin or isinglass, and incorporation of upstream rough
filtration or centrifugation. Like flash pasteurization, any processes d
ownstream
of the microbial filter, including packaging, must be done under near‐sterile
conditions to prevent reintroduction of contamination.
Bacteriostatic Properties of Hops

Hop bitter compounds are toxic to most Gram‐positive beer‐spoilage bacteria.
This property may, in part, account for the prominence of hopped beer in
international trade under the auspices of the Hanseatic league after 1200.
Hanseatic trade was a key factor in popularizing the use of hops in European
beer. Hops preserved the beer, so it could be shipped for long distances. Before
hops were used, long‐lasting beer needed a high alcohol content to keep spoil
age bacteria in check. High alcohol means extra fermentable material, hence
higher cost. Today, the use of hops in beer is nearly universal; in some cases, it
is incorporated into the legal definition of beer.
Hop iso‐alpha acids are not as antimicrobial as alpha acids, but they are
present in beer at much higher concentration because of their higher solubility.
They are most active at low pH. The mechanism of their toxicity is still under
study, but it is believed that they assist the transport of hydrogen ions across
the cell membrane, lowering the internal pH of bacteria. They also bind man
ganese ions, which play a role in the bacterial defense against oxidative stress.
There are strains of bacteria that are hop tolerant. These can cause significant
spoilage, especially those that are also alcohol tolerant and that can survive at
low pH and under anaerobic conditions, like those in packaged beer.
14.3 ANALYTICS AND QUALITY CONTROL OF MICROORGANISMS
No brewery is free from contaminating microbes. Therefore, it is essential to

monitor process points to detect and correct the presence of spoilage yeast or
bacteria. Contamination may result in off‐flavor development, turbidity, and in
extreme cases, over‐attenuation and package rupture resulting in costly product
recalls. Microbe detection in the brewery is essential for any quality program.
Aseptic Technique
Sampling for microbiological stability requires strict attention to aseptic tech
nique. Aseptic technique describes procedures to minimize contamination by
foreign microorganisms. Failure to prevent outside contamination from
entering sample points and microbiological media may lead to false positives.
In general, aseptic technique requires the following:
• Wearing nitrile gloves and spraying them with 70% ethanol or other
disinfectant.
• Disinfecting the sample container and work surfaces before and after use.
• Working in a draft‐free, clean environment.
• Working with sterile goods (glassware, tubes, and transfer pipettes).
It is essential to prevent aerial contamination by dust‐borne bacteria and

yeast while sampling in the brewery to prevent false positives. There are sev
eral simple practices to maintain aseptic conditions. All sterile tubes or glass
ware for sampling should be kept covered unless in active use. While filling or
transferring from the container, the lid or cover should be kept above the
opening to avoid drop‐in contamination. Never completely remove the lid nor
set it aside on a table as the lid itself could become contaminated. Figure 14.13
demonstrates this technique.
All processing of beer samples for microbiological analysis must avoid
additional contamination from the environment. This is best achieved by
testing in a separate, enclosed room away from the brewhouse and cellar.
While working at a lab bench or microbiology station, the surface should be
disinfected with 70% ethanol. Drafts should be avoided by either working
near a flame or in a laminar flow hood. As illustrated in Figure 14.13, when
working near a flame, hot air rises, thus preventing drop‐in from dust and
airborne microbes. As a more expensive but more aseptic option, laminar
flow cabinets use a high efficiency particulate air (HEPA) filter to remove
microbes from incoming air, which is then gently pushed out through the
working area, creating an aseptic environment as demonstrated in Figure 14.14.
The laminar flow cabinet protects the sample, but provides no protection for
the operator, who works in the air flow from the sample.
ANALYTICS AND QUALITY CONTROL OF MICROORGANISMS 447
(A) (B) (C)
MJF 2018/08/10 MJF 2018/08/10
(D) (E) (F) (G)

Figure 14.13 Aseptic technique. (A) Work by flame. (B) Flame glass container
before use. (C) Use sterile pipet; protect interior of sample. (D) Flame container after
use. (E) Keep container closed. (F) Transfer sample to sterile, labeled container
minimizing the time the container is open. (G) Cover container.
Prefilter
Blower
HEPA filter
Airflow
Work area
Figure 14.14 Laminar flow cabinet.
Sampling Points
Beer should be sampled at critical sample points throughout the brewing
process. Boiling sterilizes the wort, so most microbiological analysis in the
brewery focuses on steps downstream of the wort chiller. Critical sample points
are identified as any point through which the beer passes to a new piece of
process equipment. During brewhouse design, this requires conscious
Filter
Chiller Fermenter
Centrifuge
Bright
beer
tank
Pasteurizer
Filler/
seamer
Sample point
Figure 14.15 Critical sample points in the brewery.
lacement of sample points upstream and downstream of all equipment. For

p
example, consider a brewery that has only two sample points downstream of
the boil kettle, one after the chiller and a second on the bright tank. Spoilage
bacteria were isolated from the bright tank but not the chiller. In this scenario,
the brewer cannot pinpoint the source of the contamination. It may have been
in dry‐hopping equipment, the fermenter, the centrifuge, the filter, the carbon
ation unit, or the apparatus to introduce finings. Ideal design includes sample
points before and after each critical process. This permits a much more accurate
determination of where contamination originates (Figure 14.15).
Beer is often sampled through sanitary zwickels. The zwickel must be prop
erly cleaned before and after sampling to prevent false positives identified
during analysis. The brewer should ensure that zwickels are sanitary in design,
can be integrated into a CIP procedure, are regulatory compliant, and can be
removed for sterile autoclaving or further cleaning. It can be advantageous to
place a sanitary valve between the equipment and the zwickel in case removal
is necessary while the equipment is in process or full of beer. The frequency
of beer sampling should be defined by the brewer and is dependent upon
frequency of use and potential for spoilage.
A PROTOCOL FOR SAMPLING FROM A ZWICKEL
Dirty zwickels are the most common source of false positives while
sampling for microbiological analysis. Proper sampling technique, illus
trated in Figure 14.16 is essential for maintaining aseptic technique
while sampling.
alc
70%
Run beer 5 s Swab 70% alcohol Rinse 70% alcohol Flame
alc
RA 8
8/6
/1 70%
Run beer to cool Collect sample Rinse 70% alcohol
Figure 14.16 Aseptic sampling from a zwickel.
1. Spray the inside and outside of the sample port with 70% ethanol.
You may wish to use a sterile cotton swab dipped in ethanol to scrub
the inside of the port.
2. Briefly flame the zwickel to ignite the ethanol, and then let it burn
off completely. Do not continue heating the zwickel as this can lead
to charring of the port and burning of the beer.
3. Let the zwickel cool for approximately 15 seconds.
4. Open the zwickel and collect beer in a waste container for approxi
mately 10 seconds. Discard this beer.
5. Collect the sample for analysis in a sterile container.
6. Spray the inside and outside of the sample port again with 70%
ethanol to remove any residual beer. Ignite the ethanol and allow it
to burn off.
7. Transfer sample to the laboratory.
Water provided by the town or city should arrive at the brewery free from
contamination according to specifications set by public health regulations. In
addition, typical water spoilers such as E. coli and other Enterobacteriaceae
do not survive in finished beer. Contamination is even further limited because
water is usually boiled as part of the brewing process. However, any water
used for cold‐side processing should be tested for contamination. This includes
water for pushing, dilution, or packaging operations. Traditionally, water

spoilage organisms are detected by plating on agar plates either directly or
after concentration by filtration. MacConkey, malt extract, sabouraud, univer
sal beer, and Wallerstein agar are just a few media frequently used for this.
Air and process gases can get contaminated by dust particles, moisture
droplets, reflux of wort or beer into the air lines, or by contamination at the
manufacturer’s plant. Any hoses or valves should be inspected for leaks,
which are prone to contamination. Air quality can be checked by directly
exposing an agar plate or broth culture to the air, or by passing the air through
a sterile filter which is then placed on top of an agar plate. For brewery appli
cations, a generic beer spoilage medium such as malt extract agar or universal
beer agar is appropriate with incubation at 25 °C for 48−72 hours.
Forced Wort Test

One of the simplest contamination tests to incorporate into the brewery is the
forced wort test. In this method, brewers set aside a sample of wort in a sanitized
container and place it in an incubator or warm place in the brewery ranging from
25 to 30 °C for a set period. The sample lid may be left loose or sealed to promote
aerobes or anaerobes, respectively. Contamination is monitored by sediment
formation, CO2 evolution, and/or turbidity. The method can be expanded to
yeast slurry and beer by using a nutrient‐rich broth medium containing a pH
indicator. After incubation with a sample, any acid producers will turn the
medium from red to yellow. These methods are quick and simple tests to check
for potential spoilers, however they do not measure the number of contaminat
ing cells nor do they identify the microorganisms, thus they are only useful to
identify potential problems but do not work well to quantify potential risk.
Plating Techniques
To identify spoilage risk, collected beer samples are traditionally evaluated
through plating techniques on nutrient‐rich agar plates. Proper detection of
contaminating microorganisms requires correct selection of the medium type,
the right plating methods for screening, and the right incubation and culture
conditions for growth.
Plate Spreading Proper spreading and cell concentration will isolate

individual cells on the agar medium. With appropriate incubation time and
temperatures, ranging from 25 to 30 °C and one to seven days depending on
the medium and organism, individual cells will multiply, each cell forming a
single colony (Figure 14.17). The colony represents 10−100 million cells that
divided over time on the plate, but which originated from a single cell in the
beer sample. Proper sample volume, concentration, and spreading technique
Figure 14.17 Streaked plate demonstrating distinct yeast colonies.
are required to obtain individual colonies for subsequent analysis. A properly

spread agar plate resulting in distinct colonies is shown in Figure 14.17.
A colony that grows is considered one colony forming unit (CFU).
A CFU represents a viable cell in the beer sample that was able to grow on
the medium. Thus if 10 colonies are on a plate, there are 10 CFUs. It is
important to note the limitation of this approach. Just because there are no
colonies on a plate, it does not mean there are zero CFUs. First, the type of
medium and culture conditions may limit the growth of certain bacteria.
Second, the number of CFUs in the sample may be too low to be captured
on the plate. For example, suppose a beer contains 1 CFU per liter but only
1 mL was plated, then the bacterium may not have been captured on the
plate. For this reason, if no growth is observed on a plate, this is described as
<1 CFU.
CFUs are typically reported as CFUs per mL. Thus, it is essential that the
original volume plated is known. For example, if 100 μL (0.1 mL) is plated
and 10 CFUs were measured, then 100 CFUs/mL are present in the sample.
Depending on the sample source, the sample may be plated directly,
diluted before plating, or concentrated through membrane filtration. If plated
directly, volumes should not exceed 200 μL on a 100 mm plate. If dilution is
necessary, a 1 : 10 or 1 : 100 dilution in sterile media or phosphate buffered
saline (PBS) is appropriate. If CFUs are likely low, as in finished beer, then
membrane filtration is required. Unfiltered beer cannot be membrane‐filtered
as the yeast and colloids will quickly clog the filter. Two techniques for spread
ing the sample on a medium are shown in Figure 14.18. A sample is pipetted
to the center of a plate. Then a sterile, “hockey‐stick”‐shaped glass rod is used
(A) (B) (C) (D) (E)
(F) (G) (H) (I)

Figure 14.18 Sample spreading techniques. (A) and (B) Sample pipetted to plate.
(C)–(E) Hockey stick spreader method. (F)–(H) Copacabana method. (F) Add glass
balls, cover. (G) and (H) Shake left and right and up and down (not in a circle).
(I) Remove beads, cover and incubate upside down.
to spread the liquid. Alternatively, sterile glass beads are added and the sam
ple is spread by shaking the plate, a technique called the Copacabana method.
Streaking Streaking is a technique to isolate cells by serial dilution on an

agar plate. It is not used for colony counting, rather it is used to prepare
pure cultures derived from individual cells. In brewing, streaking is often
used to prepare pure yeast cultures (Figure 14.17). Using aseptic technique
(Figure 14.19A), a sample is picked up on a sterile inoculating loop or
toothpick (Figure 14.19B). The loop is streaked across the agar surface near
one edge of the dish (Figure 14.19C). The dish is turned 90°. The loop is
flamed again (Figure 14.19D), or a new sterile stick is used to streak through
the edge of the previous streaks into the second quadrant (Figure 14.19E).
This takes a small amount of sample from the first streak and puts it on the
second streak; a dilution. The loop is flamed again, and the sample is streaked
from the edge of the second quadrant into the third quadrant (Figure 14.19F),
a dilution of the dilution. The last streak is pulled into the middle of the plate
(Figure 14.19G). If all goes well, this region should produce individual
colonies, each originating from a single cell. The plate is covered and incubated
upside down to prevent condensate from dripping into the culture. In between
each step, it is essential to allow the loop to cool after flaming to prevent
(A) (B) (C) (D)
(E) (F) (G)

Figure 14.19 Streaking a plate.
scorching and killing the microorganisms. Plates should always be incubated

in an upside‐down position, agar on top, lid on bottom.
Anaerobic Methods
Depending on the medium and the type of bacteria being detected, establish
ing anaerobic conditions may be warranted. Typical incubators in ambient air
support the growth of aerobic bacteria or aerotolerant anaerobes but may
prevent the growth of strict anaerobes. Certain lactic acid bacteria grow more
quickly in an incubator with 5% CO2 and do not require strict anaerobic
growth. Anaerobic cultures require attention to the availability of oxygen
from the environment.
The simplest method to create anaerobic conditions is to place plates in
an airtight container, inserting a small, lit candle in the jar before sealing.
The oxygen is depleted as the flame burns, extinguishing once the oxygen is
gone. A better method is to use an anaerobic chamber or jar with a gas
generating insert (Figure 14.20). The material in the insert releases carbon
dioxide and hydrogen. A catalyst in the jar causes the hydrogen and oxygen
to react, producing water and depleting the air of oxygen. Typically, a card
impregnated with methylene blue is placed in the jar as an indicator to show
that oxygen has been successfully removed.
Individual colonies can then be screened with Gram stain, catalase,
and oxidase tests, or other advanced methods to facilitate identification and
spoilage potential.
H2
Catalyst chamber
CO2
Gas pack
Inoculated dishes
Figure 14.20 Anaerobic jar.
Microbiological Media Used in the Brewing Industry

There are two concepts in selecting the right microbiological media to test for
brewery contamination: find everything or find only the high‐risk, beer spoil
age microorganisms. Generally, in the brewery lab, multiple microbiological
media (Table 14.4) are employed to cover a wide spectrum of contamination
but also to create redundancies and support further differential identification.
The media discussed in this section are not exhaustive but rather represent a
good spectrum for the detection of most brewery microorganisms.
TERMINOLOGY FOR DIFFERENT TYPES OF MEDIA USED

IN MICROBIOLOGICAL EVALUATION
Nutrient media: Synthetic, complete media that contain all nutrients

required for growth.
Selective media: Encourage growth of some microorganisms while pre

venting others often through addition of chemicals. Common selective
media additions include the following:
Cycloheximide – inhibits yeast
Chloramphenicol – inhibits bacteria
Penicillin/Streptomycin – inhibits bacteria
Differential media: An observable change in the media occurs after a
biochemical reaction from the presence of a microorganism.
Enriched media: Encourage growth of a particular microorganism over

others through addition of special nutrients.
TABLE 14.4 Commonly Used Media in the Brewing Industry

Name Used for
Yeast Extract Peptone Dextrose (YPD) General yeast media
Yeast Extract Peptone Maltose (YPM) General yeast media
Wort Agar Wort spoilers
Universal Beer Agar (UBA) Beer spoilers
Wallerstein Labs Nutrient (WLN) LAB, AAB, Enterobacter
Lee’s Multi‐Differential Agar (LMDA) LAB, AAB, Enterobacter
Schwarz Differential Agar (SDA) LAB, AAB, Enterobacter
Raka Ray LAB
De Man, Rogosa, and Sharpe (MRS) General bacteria media
Hsu Lacto Pedio (HLP) LAB, AAB
Nachweismedium für bierschädliche LAB, AAB, Enterobacter
Bakteriën (NBB)
Selective Media Megasphaera and Strict anaerobes
Pectinatus (SMMP)
Lin’s Wild Yeast Medium (LWYM) Wild yeast (Saccharomyces spp.)
Lin’s Cupric Sulfate Medium (LCSM) Wild yeast (non‐Saccharomyces
spp.)
Lysine Wild yeast (non‐Saccharomyces
spp.)
Xylose, Mannitol, Adonitol, Cellobiose, Wild yeast
Sorbitol (XMACS)
Preparation of Microbiological Agar

The brewer can save money by preparing his or her own microbiological
media. Many recipes are published or are sold as pre‐weighed and mixed rea
gents. In most cases, the brewer combines the solid nutrient chemicals with
distilled water. The solution is gently heated to dissolve the contents, and then
it is sterilized in an autoclave. In the case of agar media, the sterilized media is
cooled to approximately 50 °C and then poured into sterile plates using asep
tic technique. Typical plates are 100 mm in diameter, but some brewers prefer
smaller 50 mm plates to conserve reagents and space. Before stacking and
storage, plates should remain covered and allowed to polymerize overnight at
room temperature to prevent condensation on the lids. Plates are then stored
inverted at 4 °C. Careful attention to manufacturer’s recommendations for
shelf‐life is important as selectivity may decline over time.
Sterilization of microbiological media is essential and routinely requires
the use of an autoclave, the most effective method of sterilization, killing
all living microorganisms and destroying any spores or viruses. Autoclaves
provide wet heat under pressure. By increasing pressure in the device, the
boiling point temperature can be increased. Common autoclave parameters
are 121 °C at 1 bar gauge (15 psig) for 15 minutes. A large autoclave requires
a steam generator and significant floor space. Smaller tabletop autoclaves are
available with their own steam generators.
TIPS FOR AUTOCLAVING MICROBIOLOGICAL MEDIA
• NEVER place a sealed vessel in an autoclave or dangerous pressure

could build up. If the container is open, cover the opening with foil. If
the container has a screw cap, leave the cap on loosely.
• Use autoclave tape to indicate sterilization temperatures were
reached. The tape can be left on in the laboratory to show that glass
ware or reagents were autoclaved.
• For agar media, only fill a container about 25−30% full, as boil over
can occur in the autoclave. Containers with broth media can be
75−80% full.
PCR and Advanced Detection Methods

Traditional microbiology plating methods require one to seven days of
culture time for results, depending on the media type and microorganisms
present. If analysis for contamination in beer is required before release for
sale, this may pose an issue. Several biotechnology companies have utilized
the polymerase chain reaction (PCR) for rapid contamination detection.
PCR‐based methods of microorganism detection can be completed in as
little as 4–12 hours.
PCR is a technique that makes millions of copies of a specific piece of
DNA in a tube. The method uses the fundamentals of DNA replication
in which a primer pair specifies the area of the DNA to be copied, typically
a gene or gene sequence within the genome. After primer binding, DNA
polymerase makes the copies. The process is repeated many times, amplifying
the specific region of DNA as defined by the primers. Each cycle consists of
three steps. First, a high‐temperature step denatures the DNA, dissociating
the double strand. Second, the temperature is reduced to a target that pro
motes primer binding to the DNA template. Then the temperature is further
reduced promoting the activity of the DNA polymerase and copying the
DNA sequence. This temperature cycle is repeated 30–40 times. The number
of target DNA molecules doubles with each cycle.
In applying the PCR method to the identification of spoilage bacteria
and yeast in beer, companies have identified key genes that either convey
spoilage potential or that are specific to a problematic species. For example,
current PCR methods for diastaticus detection use primers that amplify the
STA1 gene. The STA1 gene encodes the glucoamylase enzyme responsible
for hydrolysis of dextrins to glucose. Another example of a PCR target is
the HorA gene, which renders certain Lactobacillus species resistant to
hops. The detection platform typically includes a method for semiquantita

tive analysis of the amplified products.
Many platforms that use PCR technology differentiate themselves with
proprietary means of quantifying the PCR results in addition to keeping the
primers and conditions a trade secret. Sensitivity, time to results, number of
species detected, and cost per test should all be carefully considered when
evaluating a PCR platform. While rapid results are a major advantage
of PCR‐based methods, limitations involve sensitivity and focus on only a
few genes.
Typical PCR‐based methods have a minimum sensitivity of 10 CFUs/mL,
otherwise requiring an enrichment step in a culture medium before the PCR
test. To overcome the limitations in sensitivity, several platforms utilize
quantitative PCR (qPCR). qPCR employs sensitive fluorescent dyes that
enable the measurement of PCR products in real time, greatly increasing the
sensitivity of the method. The cost of qPCR machines has limited their use
in breweries, but as new platforms develop cheaper methods, qPCR use is
on the rise.
PCR methods are further limited by the complexities of gene expression
(see Section “Regulation of Gene Expression” in Chapter 3). There is no sin
gle gene that enables spoilage by all species or strains. For example, there are
Lactobacillus strains that lack the HorA gene but that still spoil beer. PCR
platforms with multiple gene targets aim to overcome this limitation.
Nonetheless, there will always be exceptions and evolving mechanisms of
contamination. PCR‐based methods represent the means for rapid spoilage
detection for the most common beer spoilers, but a sound traditional micro
biology program with plating on selective media is recommended to further
support the detection of all possible microorganisms in beer.
1. Describe the purpose of aseptic technique. Explain best practices, equip

ment, and space necessary for practicing aseptic technique.
2. What are some characteristics of wort and beer that encourage or dis
courage microbial growth?
3. One cannot practically use every possible microbiological medium in the
laboratory. Propose a reasonable set of media to use in a quality control
lab that covers the detection of typical beer spoilers. Explain your ration
ale for their inclusion.
4. How do the methods for sample spreading and streaking differ? What is
the goal of each?
5. Discuss the advantages and disadvantages of pasteurization and sterile

filtration.
6. What is flash pasteurization?
7. A sample is brought to 64 °C for 4.0 minutes. How many pasteurization
units is this?
8. What is an anaerobic jar or chamber? For what purpose is it used in a
microbiology program?
9. A sample derived from beer wort gave a positive Gram test, a negative
catalase test, and looks like circles in the microscope. What could it be?
10. Describe some hazards and precautions for using an autoclave.
CASE STUDY
Your brewery recently installed a canning line with a four‐head filler. After
placing some cans in a warm area of the brewery, you noticed three out of six
of the cans are bulging, developing excessive pressure due to overcarbonation.
Assuming you have access to a lab with microbiology capabilities, describe
your approach to determine the source of contamination including the point
of infection and the identity of the responsible microorganism. Once you have
isolated colonies, how will you evaluate spoilage risk?
BIBLIOGRAPHY
Bamforth CW. 2017. Freshness. American Society of Brewing Chemists. ISBN

978‐1‐881696‐27‐8.
Bokulich NA, Bamforth CW. 2013. The microbiology of malting and brewing.
Microbiol. Mol. Biol. Rev. 77(2):157.
Boulton C, Quain D. 2006. Brewing Yeast and Fermentation. Blackwell Science. ISBN
978‐1‐4051‐5268‐6.
Haakensen MC, Butt L, Chaban H, Deneer HG, Ziola B, Dowgiert T. 2007. horA‐
Specific real‐time PCR for detection of beer‐spoilage lactic acid bacteria. J. Am.
Soc. Brew. Chem. 65(3):157–165.
Jorgenson E. 2017. An overview of bacteria found in brewing exosystems. Tech. Q.
Master Brew. Assoc. Am. 54(2):95–102.
Lewis MJ, Young TW. 2002. Brewing, 2th ed. Springer. ISBN 978‐1‐4615‐0729‐1.
Menz G, Andrighetto C, Lombardi A, Corich V, Aldred P, Vriesekoop F. 2010. Isolation,
identification, and characterisation of beer‐spoilage lactic acid bacteria from
microbrewed beer from Victoria, Australia. J. Inst. Brew. 116(1):14–22.
BIBLIOGRAPHY 459
Sakamoto K, Konigs WN. 2003. Beer spoilage bacteria and hop resistance. Int. J. Food
Microbiol. 89:105–124.
Sanders ER. 2012. Aseptic laboratory techniques: plating methods. J. Vis. Exp.
2013(63):3064.
Vriesekoop F, Krahl M, Hucker B, Mens G. 2012. 125th Anniversary review: bacteria
in brewing: the good, the bad and the ugly. J. Inst. Brew. 118:335–345.
Chapter 15
MATHEMATICS OF QUALITY
Any manufacturing process has a strong quantitative component. In this

chapter, we will introduce some aspects of quality management that provide
valuable tools to improve the quality of beer, the efficiency with which it is
produced, and the quantity of profits realized.
15.1 STATISTICS FOR QUALITY
Normal Distribution
Beer brewing is subject to variation in outcomes. If the target for wort strength
is 12.00 °P, and only 11.8 °P was reached, that might be acceptable by some
standards. If only 10.75 °P was attained, this would be a problem. Small varia-
tions in outcomes may be acceptable, but large deviations represent process
problems or mistakes.
A histogram plots the number of observations against the range of measure-
ment. Figure 15.1 is a histogram showing strengths of 30 representative batches
of wort. The histogram is a bar graph showing the number of measurements
whose outcomes fall in the indicated range. Superimposed on the histogram is

461
462 MATHEMATICS OF QUALITY
10
6
Number
0
11.4–11.6 11.6–11.8 11.8–12.0 12.0–12.2 12.2–12.4 12.4–12.6
Wort strength (°P)
Figure 15.1 Histogram. Red, number of measurements in each range. Blue, normal
distribution.
a curve showing the best fit of the results to the normal distribution. The nor-
mal distribution is a mathematical function, also called the Gaussian, that
describes the probability of manufacturing and measurement outcomes in
many, but not all, situations. The familiar bell‐shaped curve of the normal distri-
bution is a widely recognized result of probability. The normal distribution for
any specific case or measurement in the brewery depends on two parameters.
The mean, or average, locates the center of the distribution, and the standard
deviation (σ, Greek sigma) relates to the width of the curve. For the 30 meas-
urements in Figure 15.1, the average is 11.96 °P and the standard deviation is
0.24 °P. It is easier to work with the normal distribution in a standard form,
called the Z‐score. The conversion to Z‐scores is given by Z = (x – avg)/σ. The
average of the Z‐scores is always zero and the standard deviation is one. The
idealized normal distribution plotted against Z‐scores is shown in Figure 15.2.
The mean and standard deviation can be calculated from a list of numbers.
The relevant equations are given below. The symbol Σ (sigma) means the sum
of all items with subscripts; xi is one of the measured values, so Σxi means to add
all the measured values. To calculate the mean (average), the sum of the num-
bers is divided by the number of values (N) in the analysis. Means and standard
deviations are most accurately calculated on a computer spreadsheet, like
Excel®. The Excel format for the mean is =average(list), where list is the list of
numbers to be averaged. The format for the standard deviation is =stdev(list):
2
xi xi2 xi /N
Average x
N N 1
STATISTICS FOR QUALITY 463
0.4
0.3
f(z)
0.2
0.1
0
–3 –2 –1 0 1 2 3
Z
Figure 15.2 Normal distribution.
If we take the samples in groups, the average remains the same, but the
standard deviation of the means of groups of n items is the individual stand-
ard deviation divided by the square root of the number of items in the group.
For example, suppose the standard deviation for carbonation for individual
bottles is 0.2 volumes. If we use averages of the carbonation of groups of four
bottles, the standard deviation of these averages will be 0.2 volumes divided
by the square root of 4, which comes to 0.1 volumes.
The normal distribution is an important tool for monitoring the quality
and consistency of brewing processes. The significance is that the probability
of any measurement of the variable being between two values of Z is the area
under the curve between those values. The colored area shown on Figure 15.2
represents the probability of a measurement of Z coming in between −1 and +1.
The probability is 0.683 or 68.3%. Thus, 31.7% of the measurements will be
further than one standard deviation from the average. The area between −2
and +2 is 95.45%, and that between −3 and +3 is 99.73%, so about 5% of
measurements lie outside of two standard deviations from the mean, and
about three of every thousand lie outside of three standard deviations. For
measured numbers, the range of values whose area contains a specified prob-
ability, often 95%, is called the confidence interval for the measured number.
Tables and spreadsheet functions with cumulative areas of the normal distri-
bution from −∞ to a specified value of Z are available. The Excel® function for
the cumulative area of the normal distribution is =norm.dist(x,mean,std
dev,1), where x is the measurement. If the measurement is given in Z‐scores,
the mean is 0 and the standard deviation is 1. The difference between the
cumulative areas for two measurements is the area between them. Table 15.1
gives the Z‐score limits for various levels of probability.
TABLE 15.1 Probability

that a Measurement Will
Be Outside of ±Z
Probability ±Z
0.05 1.96
0.001 3.29
10−4 3.89
10−5 4.42
10−6 4.89
Suppose we made a batch of the wort shown in the histogram in Figure 15.2

and measured the wort strength as 11.17 °P for a batch of the wort mentioned
above whose average strength is 11.96 °P and whose standard deviation is
0.24. This batch is 0.79 °P below the mean of 11.96 °P. The Z‐score is
Z = −0.79 °P/0.24 °P = −3.29. The probability of a wort strength that far from
the average is 0.001. Either we witnessed a one‐in‐a‐thousand event, or this
measurement is not actually part of the original distribution, meaning some-
thing went wrong. Perhaps the measuring device is not working properly, or
maybe the mash temperature (or its measuring device) was not correct. When
a measurement is very improbable, we suspect that there is an issue with the
process or the measurement, and it should be investigated.
T‐test
Measurements themselves are subject to random variations. Procedures like
weighing and pipetting can introduce variations. Measuring devices are
subject to electronic effects, like noise and drift. As a result, multiple meas-
urements of the same sample may yield a normal distribution of results. The
standard deviation is seldom independently known; it must be estimated
from the measurements that are taken. To correct for an imperfect knowl-
edge of the standard deviation, the T‐test, also called the Student’s T‐test, is
used. The T‐test has a distinguished history in brewing. “Student” was a pseu-
donym of William Sealy Gosset (1876–1937), a chemist/mathematician who
worked for the Guinness brewery.
The T‐test provides information about the probability that a series of
measurements is different from a target value or from a second series of
measurements. The null hypothesis is that the observed result does not differ
significantly from the target or that the two series of measurements do not
differ significantly from one another. The null hypothesis is rejected if its
probability is below a certain level, typically 0.05 = 5%. If the null hypothesis
is rejected, the conclusion would be that the sample is off target or that the
two series of measurements are different.
STATISTICS FOR QUALITY 465
Suppose a certain beer has a color target of 30 SRM. We make three inde-
pendent measurements of the color with results 27.4, 26.5, and 28.2 SRM. The
mean of these measurements is 27.36, and the standard deviation is 0.85 SRM.
We calculate the t‐statistic from
y y0
t
s/ n

where |ȳ − ȳ0| is the absolute value (always positive) of the difference between
the mean and the target value, n is the sample size, and s is the sample stand-
ard deviation. For the three colors measured,
3
t 27.4 30 5.36
0.85
The degrees of freedom in this case are the number of values minus one, in
this case, 3 − 1 = 2. The critical value of t for a specific probability and number of
degrees of freedom is returned by the Excel spreadsheet function =t.inv.
2t(prob,df). Tables with the critical t values are also available in books and on
the web. In this case, the Excel entry would be =t.inv.2t(0.05,2), which returns
4.302. If the t value exceeds the critical value, the null hypothesis can be
rejected. In this case, the t value is 5.36 and the critical value is 4.302. The
measured color is statistically different from the target. Statistically different
is not the same as discernably different. Customers may not notice a differ-
ence of a few degrees SRM, even though it can be confidently detected
analytically.
There is another type of T‐test that is used to compare two sets of meas-
urements. Suppose the brewery is considering changing the boiling routine
from 15% evaporation to 10%. Six batches are prepared alternating between
the old and new routines. The resulting beers are taste tested with the follow-
ing scores rated out of 5:
Old New
4.65 4.22
4.55 4.5
4.28 4.45
The t‐statistic for comparison of two means is
y1 y2
t
s12 /n1 s22 /n2

The number of degrees of freedom is n1 + n2 − 2. For the example above

ȳ1 − ȳ2 = 0.103, s1 = 0.1914, s2 = 0.1493, and t = 0.7373. The critical value of t
=t.inv.2t(0.05,4) is 2.776. The null hypothesis cannot be rejected; these meas-
urements do not provide evidence that the new boiling routine affects the
flavor score.
Poisson Distribution
If we take a small sample of beer and count the number of microbes in it, the
count is exact. But if we take a duplicate sample and count the microbes in it,
the result is likely to be different. The variation arises from the random distri-
bution of microbes throughout the sample, not from any error in the count
itself. Counted items in samples follow the Poisson [pwa‐SONE] distribution.
Because a count is never negative, the Poisson distribution is not symmetrical
about the average. If the count is 10 or more, the asymmetry becomes less
significant, and the Poisson distribution becomes reasonably close to a n ormal
distribution with the same mean and standard deviation.
One very useful feature of the Poisson distribution is that the standard
deviation is equal to the square root of the expected count. Suppose a 10 mL
sample of beer wort is diluted to 100 mL (dilution factor of 10) in a sterile
phosphate‐buffered saline (PBS) solution. Then 100 μL (0.1 mL) of the
diluted sample is plated on growth medium supported by agar in a Petri dish.
After an appropriate period of incubation, 10 bacterial colonies are observed.
Ten colony‐forming units (CFU) in 0.1 mL comes to 100 CFU in 1 mL.
Multiplication by the dilution factor by 10 yields 1000 CFU/mL in the origi-
nal wort. The estimated standard deviation for the original count is 10 = 3.16.
The 95% confidence interval is ±2 × 3.16 = ±6. This gives 1000 ± 600 CFU/
mL, a very wide range of uncertainty. Suppose the dilution step had been
omitted and 100 μL of undiluted wort was applied directly to the plate. If the
count is 100 CFU, the standard deviation would be 100 = 10 for a confi-
dence interval of ±20.The final result would be (100 ± 20 CFU/100 μL) × 1000 μL/
mL = 1000 ± 200 CFU/mL, a much more precise count. This is the reason that
the sample should be diluted to give a count of no less than 50 CFU on the
plate. Note that the standard deviation must be calculated from the actual
count, before any adjustments for sample size and dilution are made.
15.2 CONTROL CHARTS
When a process gives an average and standard deviation that, over time,
remain the same, the process is said to be in control. This is not to say that the
process cannot be improved, but rather, based on current methods, a range of
data is expected. If the mean drifts up or down, or the degree of scatter from
CONTROL CHARTS 467
batch to batch changes (especially upward), the process is no longer in con-

trol. The beer may still be salable, but trouble is on the horizon. Something
has changed. A control chart is a graphic device to monitor whether the
process is in control.
X‐bar Chart
The most basic type of control chart, sometimes called an X‐bar chart, is a
graph of some process variable, like wort strength, against time or batch num-
ber. A different control chart is necessary for different recipes, because the
performance of the process is compared with its own history. A common
refinement of the X‐bar chart is to mark the historical mean across the center
of the chart and “control lines” at three standard deviations above and below
the mean. Sometimes “warning lines” are added customarily at two standard
deviations above and below the mean (Figure 15.3). If the samples are taken
in groups, the group standard deviation should be used to locate the lines.
A control line is not the same as a specification. Specifications are set by
what is acceptable to the customer or some other brewing necessity. For exam-
ple, customers may not be able to tell the difference between 26 and 30 IBU
(International Bittering Units), so beer that is 26 IBU should not be discarded.
By contrast, if the standard deviation on hop bitterness is 1 IBU, the controls
lines would be at 27 and 33 IBU. Statistically speaking, the process should
remain in that region if it is under control. If specifications are too close to the
control lines, the process is not sufficiently refined to meet the specification
reliably. The process should be adjusted to lower the standard deviation.
Upper control limit

1.048
Upper warning
1.046
Original gravity
1.044
1.042
Lower warning
1.040 Lower control limit
10 20 30 40 50 60
Batch
Figure 15.3 Control (X‐bar) chart.
There are several ways for a process to be out of control. First, a single
measurement outside of the control limits has a probability of 0.003 and indi-
cates that the process is out of control. Second, nine measurements in a row
on the same side of the mean has a probability of (0.5)9, which is 0.002, indi-
cating loss of control. Third, two of three points outside the 2σ line or six
points in a row all trending up or down indicate loss of control. And finally, if
multiple batches measure outside of the warning lines, all on an upper or
lower limit, there may be loss of control.
Figure 15.3 shows a control chart for wort original gravity. Until the out‐of‐
control point at batch 50, the chart appeared in control. If scrutinized, there is
a feature that could have been cause for concern if it were noticed. Of the six
batches outside of the warning lines, all were above the upper warning; none
fell below the lower warning line.
CUSUM Chart
Another type of control chart is the cumulative sum (CUSUM) chart. In the
CUSUM chart, the deviations from the mean or the target are calculated and
converted to Z‐scores by dividing by the standard deviation. The sum of all
Z‐scores up to the current batch is plotted for each batch. Figure 15.4 shows
the CUSUM chart of the same data as those plotted in Figure 15.3. In the
CUSUM chart, if the target is lower than the average measurement, the
points will drift upward at a constant slope (steepness of rise or fall). If the
average changes, the slope changes. In Figure 15.4, the slope of the graph
increases at about batch 19. This suggests that the average original gravity
50
40
CUSUM (Z-score)
30
20
10
0
10 20 30 40 50 60
Batch
Figure 15.4 Cumulative sum (CUSUM) chart.
DIMENSIONS, UNITS, AND CONVERSIONS 469
increased at about this time. It could have been a batch or two earlier or later,
but batch 19 is the place to start looking. CUSUM charts are more sensitive
to small changes in the process average than X‐bar charts.
15.3 DIMENSIONS, UNITS, AND CONVERSIONS
A dimension is a quantity that can be measured, like mass or power; a unit is

a standard quantity in which the dimension is measured, like kilograms or
watts. Volume is a dimension; it can be measured in units of liters, gallons, or
barrels. Every dimension can be expressed in terms of some combination of
seven basic dimensions: length, time, mass, electric current, temperature,
amount of substance, and luminous intensity. Combined dimensions are
called derived dimensions. Volume is a derived dimension based on length. If
something fills a box of a certain length, width, and height (each of which has
the dimension of length), the volume is given by the product of these three
lengths, so the dimension of volume is length cubed.
There is a system of units called the International System (SI) that is
accepted internationally and that is coherent. A coherent system of units can
be used with the equations of physics to give the correct results. Suppose we
would like to know the kinetic energy of a 10 kilogram mass moving at 6 meters
per second. The formula for kinetic energy is E = ½mv2, so the energy is (0.5)
(10 kg)(6 m/s)2 = 180 kg∙m2∙s2. It turns out that the dimension of mass∙length2/
time2 comes up often enough that it has its own name, energy, and a derived
unit, the joule (J). The kinetic energy comes to 180 J. In noncoherent units,
like American customary units, this calculation does not work well. Table 15.2
gives the six of the seven basic dimensions (we will not use luminous inten-
sity), their base units, and the symbols for the units.
The base units can be combined using the equations of physics to pro-
duce derived units. For example, force is described by Newton’s second law
as mass times acceleration. Acceleration has dimensions of speed divided
by time. Speed has dimensions of length divided by time. So
force = mass × length/time2. The SI unit of force is kg∙m/s2 = kg∙m∙s−2. This
TABLE 15.2 SI Dimensions and Units

Dimension Base Unit Symbol
Length Meter m
Mass Kilogram kg
Time Second s
Electric current Ampere A
Temperature Kelvin K
Amount of substance Mole mol
TABLE 15.3 Derived Units

Dimension Unit Symbol Base units
Energy Joule J kg∙m2∙s−2
Force Newton N kg∙m∙s−2
Pressure Pascal Pa kg∙m−1∙s−2
Power Watt W kg∙m2∙s−3
TABLE 15.4 Unit Prefixes

Multiplier Prefix Symbol
10−9 Nano n
10−6 Micro μ
10−3 Milli m
0.01 Centi c
100 Hecto h
103 Kilo k
106 Mega M
109 Giga G
derived unit is called a newton (N). Table 15.3 shows some important
named derived units and their symbols.
Base units are not always a convenient size. A yeast cell may be 0.000 004 m
in diameter; the pressure of the atmosphere is about 110 000 Pa. To simplify
the measurement, prefixes are combined with unit symbols to describe
smaller or larger SI units. Table 15.4 shows useful unit prefixes.
For example, 0.000 004 m = 4 μm; 100 000 Pa = 100 kPa. Prefixes that are
not powers of 1000, like hecto and centi, are only used in certain cases. There
are a few units with special names: 100 kPa = 1 bar; 0.001 m3 = 1 liter (symbol L).
These units can take the standard prefixes: mL, Mbar. When writing a number
with a unit symbol, there should be a space between the number and the unit
symbol. Unit symbols do not get a period unless they end a sentence.
Despite the elegance and universality of the SI system, there are many
measurements reported in other traditional unit systems, especially in
English‐speaking countries. In some cases, the same name applies to different
units. For example, a US gallon is 3.785 L but an Imperial (UK) gallon is
4.546 L, a difference of more than 20%. The volume unit that is called a barrel
differs from one place to another and by what is being measured, like oil or
beer. Even countries that follow the SI system use some nonstandard units,
like hours and days.
Some English‐speaking countries retain an eclectic system of customary
units, which can vary from place to place and by what is being measured.
A pump may be rated in gallons (US) per minute and a tank volume in US
BREWING CALCULATIONS 471
arrels (bbl US). The brewer is faced with problems like the following: how
b
long will it take a 55 gal/min pump to fill a 30 bbl tank? To solve such prob-
lems, the same quantity must be expressed in different units, a procedure
called unit conversion. Unit conversion starts with an equivalence, an equa-
tion that relates the units. In this example a suitable equivalence would be
1 bbl = 31 gal. From the equivalence, conversion factors are derived: (1 bbl)/
(31 gal) and (31 gal)/(1 bbl). Because the numerator (top) and denominator
(bottom) of the conversion factors are “equal” in terms of the quantity they
measure, they are equivalent to 1; a quantity can be multiplied or divided by
the conversion factor without changing its value. The objective is to get the
volume units for the pump rate to match the units for the tank capacity. To do
so, the pump rate can be converted to barrels per minute, or the tank volume
can be converted to gallons. We will change the tank volume to gallons.
The units we want to get rid of are barrels, and the units we want to bring in
are gallons. We multiply the tank volume in barrels by the conversion with the
gallons on top and the barrels on the bottom, as shown in the equation below:
31 gal
30 bbl 930 gal
1 bbl
The barrels on top and bottom cancel out, leaving gallons. The pumping
time can be calculated: (930 gal)/(55 gal/min) = 16.9 min. Table 15.5 has some
equivalences useful in brewing.
15.4 BREWING CALCULATIONS
Dilution
One common calculation in the brewhouse is composition before or after
dilution. Suppose 50 L of clean in place (CIP) solution containing 2%
(2 g/100 mL) sodium hydroxide (NaOH) is needed. The NaOH product, also
called the stock solution, is 50% w/v (50 g/100 mL). How much of the stock
solution is needed? In this case, the dimensions of the composition are mass
of NaOH divided by volume of solution: c = mass/vol. The key insight for
concentration calculations is that dilution does not change the quantity of the
material being diluted, in this case NaOH. The mass of NaOH is given by
mass = conc∙vol = cV. The mass is the same before and after dilution, so
c1V1 = c2V2, where the ones refer to the stock solution and the twos refer to
the CIP solution to be prepared. c1 is 50 g/100 mL, c2 is 2 g/100 mL, and V2 is
50 L. The result is V1 = c2V2/c1 = (2 g/mL)(50 L)/(50 g/mL) = 2 L.
The calculation can also be performed in the other direction; the concen-
tration of the stock sample can be calculated from the concentration in the
TABLE 15.5 Unit Equivalences

Mass
1 Pound (lb) =453.5 grams (g)
1 Avoirdupois ounce (oz avoir.) =28.35 grams (g)
1 Grain (gr) =64.799 milligrams (mg)
Length
1 Foot (foot) =0.304 8 meter (m)
=12 inches (in.)
1 Mile =5280 ft
=1609.34 m
Volume
1 Cubic meter (m3) =1000 liters (L)
=10 hectoliters
1 Cubic centimeter (cc or cm3) =1 milliliter (mL)
1 US gallon (gal US) =3.785 liters (L)
1 Fluid ounce (fl oz) =29.57 mL
1 US quart (qt) =0.946 4 liter (L)
=57.75 cubic inches (in.3)
1 Imperial gallon (gal UK) =4.546 6 liters (L)
1 US beer barrel (bbl US) =31 gal US
=117.35 L
1 UK beer barrel (bbl UK) =163.66 L
=36 UK gal
1 Firkin =0.25 bbl UK
=40.91 L
1 Cubic foot =28.32 L
=1728 cubic inches (in.3)
Pressure
1 Pound per square inch (psi) =6895 pascal (Pa)
1 Atmosphere =101 325 Pa
=14.696 psi
=1.013 25 bar
1 Bar =100 000 Pa
=14.504 psi
=0.986 92 atm
Concentration
1 Degree Plato (°P) =1% by weight
≈(SG − 1)/0.004
Gases
1 Volume of carbonation =1.963 g CO2/L
Color
Standard Reference Method (SRM) =1.97 × EBC
≈Lovibond (°L)
BREWING CALCULATIONS 473
diluted sample. Suppose a 10.00 mL sample of yeast slurry is diluted to

1000 mL with saline solution to count the cells in a hemocytometer
(Figure 9.5). The cells are counted in five of the squares in the central region.
Each of these squares is 0.02 cm (0.2 mm) on an edge and 0.01 cm deep. The
volume of each square is 0.02 cm × 0.02 cm × 0.01 cm = 4 × 10−6 cm3 = 4 × 10−6 mL.
There are 225 cells in five squares. The total volume of the squares is 5 × 4 ×
10−6 mL = 2.0 × 10−5 mL. The cell concentration after dilution is 225 cells/2.0 ×
10−5 mL = 1.13 × 107 cells/mL.
To get the concentration in the original slurry, the dilution equation is
used: c1V1 = c2V2, where the ones refer to the original slurry and the twos refer
to the diluted slurry. The volumes apply to the dilution (not the part we
looked at in the hemocytometer), so V1 = 10 mL and V2 = 1000 mL. The slurry
concentration is c1 = c2V2/V1 = (1.13 × 107 cells/mL) × (1000 mL/10 mL) = 1.13 ×
109 cells/mL. The original count was 225; the standard deviation is 225 = 15,
so the 95% confidence interval for the count is ±30 cells. Dividing by the
volume and factoring in dilution gives 30/(2.0 × 10−5 mL) × (1000 mL/10 mL) =
±1.5 × 108 cells/mL, so the concentration is 1.1 ± 0.2 × 109 cells/mL. (The
confidence interval was rounded to one digit, and the cell count was rounded
to match the confidence interval.)
Alcohol
Alcohol by volume (ABV) is the volume of pure ethanol divided by the total
volume times 100%, as measured at a reference temperature (usually 20 °C).
Alcohol by weight (ABW) is the mass of ethanol divided by the total mass,
measured at any temperature. ABV is always higher than ABW, because a
gram of alcohol (density = 0.7893 g/mL) occupies about 25% more volume
than a gram of water (density = 0.9982 g/mL). The equations below relate
ABW and ABV:
0.7907 ABV
ABW
SGbeer
ABW SGbeer
ABV
0.7907
Extract and Degree of Fermentation

In the lexicon of brewing, extract means solids content of wort or beer. The
original extract (OE) is the percent solids (degrees Plato) in the wort before
fermentation. The real extract (RE) is the percent solids in the beer after
fermentation. The real degree of fermentation (RDF) is given by
Mass wort solids Mass beer solids

RDF 100%
Mass wort solids
One complication is that beer has ethanol and solids dissolved in water.
Simple analytical methods, like specific gravity and refractive index, are
affected by both. Another complication is that the mass of the beer is not the
same as that of the wort, because material is lost as carbon dioxide and as
yeast biomass. To account for this, CJN Balling created a formula in 1865:
2.0665 g extract gives 1.0000 g ethanol + 0.9565 g carbon dioxide + 0.011 g
yeast (dry weight). This means that for every gram of extract consumed in
fermentation, (0.9565 + 0.11)/2.0556 = 0.5161 g is lost as carbon dioxide and
yeast, and 0.4839 g is converted to alcohol.
There are issues with this formula. The mass of yeast varies with wort
oxygen content, yeast species/strain, temperature, and even the shape of the
fermenter. Another issue is that the formula is based on fermentation of a
six‐carbon monosaccharide; a disaccharide, like maltose, will yield about 10%
more product than a monosaccharide per gram consumed. Nonetheless, after
150 years, the Balling formula still holds relevance in the industry. Its errors
tend to be less than the measurement errors, so it gives a reasonable estimate.
Note that the four decimal places in the coefficients can give an exaggerated
illusion of accuracy. The best‐known equation derived from the Balling
formula is the Balling equation
100 2.0556 ABW RE

OE
100 1.0665 ABW
Both parameters of the Balling equation, the ABW and the RE, can be
ifficult to measure directly. There are online tables that provide reasonable
d
estimates for these parameters from specific gravities before and after
fermentation.
Many brewers dodge the complications of calculating RE and RDF by
using apparent extract and apparent attenuation. The apparent extract,
before, after, or during fermentation, is the extract that one reads from specific
gravity tables, such as that in the American Society of Brewing Chemists
(ASBC) Methods, not correcting for alcohol content. The apparent attenua-
tion is given by
SGinit SGfinal
AA 100%
SGinit 1
The apparent attenuation is always a good deal higher than the RDF
because the alcohol content after fermentation lowers the final specific
gravity.
The apparent extract can be used to estimate the RE:
RE 0.1948 OE 0.8052 AE
Combining this equation with the Balling equation gives this estimate for
ABW:
0.8052 OE 0.8056 AE
ABW
2.0556 0.010 665 OE
1. The target carbonation for a certain beer is 2.6 volumes. Three bottles are
sampled with the following results: 2.5, 2.3, and 2.6. Perform a T‐test to
determine if there is evidence at the 95% level that the carbonation is off
target.
2. To secure vegan certification, a brewery is considering switching from
gelatin to a different fining. Turbidity measurements give the follow-
ing readings: for gelatin, 18.2, 16.6, and 19.4 and for the new fining,
20.1, 18.6, and 17.5. Use the T‐test to determine if these results pro-
vide evidence at the 95% level that the finings give different
turbidities.
3. A brewery with a 50 hL mash tun would like to buy a hot liquor tank with
a capacity of 2.5 times that of the mash tun. What does this come to in US
gallons?
4. Iodophor stock solution has 16 g/L iodine. What volume in milliliter
would be needed to make 10 US gallons of a 25 ppm (mg/L) solution?
5. A batch of beer has an original extract of 14.3 °P and an apparent extract
of 2.8 °P. Calculate the percent of alcohol by weight (ABW).
6. For the beer mentioned in problem 5, calculate the percent of alcohol by
volume (ABV).
7. For the beer mentioned in problem 5, calculate the real degree of fermen-
tation (RDF).
CASE STUDY
You are the Director of Quality at a brewery. You are interested in tracking the
data collected at critical control points in the brewery, and you feel like your
process has been fairly controlled to date. You decide to start with mash pH.
Prepare an X‐bar chart to visualize the data below. Graph the mean, the
upper and lower warning lines, and the upper and lower control limits.
Mash pH data points (in order by production lot): 5.2, 5.23, 5.14, 5.31, 5.18,
5.23, 5.25, 5.24, 5.17, 5.29, 5.19, 5.32, 5.18, 5.24, 5.24, 5.17, 5.28, 5.31, 5.29, 5.15,
5.21, 5.29, 5.19, 5.31, 5.15, 5.25, 5.22, 5.2, 5.18, 5.29.
After preparing the X‐bar chart above, you continue monitoring mash pH
over 30 more production lots with results below. Using the warning lines and
control limits established above, analyze the following data. Is this data within
the established limits? Identify the points at which the pH is outside of con-
trol. Were there any data trends that indicated the specification was out of
control?
Mash pH data points (in order by production lot): 5.18, 5.25, 5.13, 5.27, 5.22,
5.23, 5.21, 5.14, 5.32, 5.31, 5.26, 5.31, 5.33, 5.33, 5.36, 5.37, 5.38, 5.33, 5.43, 5.24,
5.41, 5.34, 5.29, 5.32, 5.27, 5.45, 5.34, 5.29, 5.45, 5.38
If the process is out of control, how will you will identify, evaluate, and
resolve the problem with mash pH?
BIBLIOGRAPHY
American Society of Brewing Chemists. 1940. Tables Related to Determinations on

Wort, Beer, and Brewing Sugars and Syrups.
American Society of Brewing Chemists. 2018. Methods of Analysis. Beer–6.
Bamforth CW. 2002. Standards of Brewing. Brewers Publications. ISBN
978‐0‐937381‐79‐3. Chap. 3.
Holle SR. 2010. A Handbook of Basic Brewing Calculations. Master Brewers Association.
ISBN 0‐9718255‐1‐3.
Pellettieri M. 2015. Quality Management Essential Planning for Breweries. Brewers
Spedding G. 2016.Alcohol and Its Measurement. In Bamforth CE (editor). Brewing
Materials and Processes. Academic Press. ISBN 978‐0‐12‐799954‐8. Chap. 7.
Chapter 16
CLEANING, CIP, AND SANITIZATION
Beer has been brewed for thousands of years. Before the development of our
scientific understanding of microorganisms and their impact on beer, people
still made alcohol. The beer was probably terrible by modern standards, but
they liked it. Today, beer competes on quality; strict attention is now placed
on maintaining a clean facility, not only for government regulation and food
safety, but to ensure high‐quality product.
Do not let the allure of the brewing industry fool you. To brew beer is to clean
equipment. The brewer spends substantial and significant effort cleaning in any
brewery. From kettles to kegs, all areas of the brewery are susceptible to soils that
compromise beer quality or production efficiency. Here we discuss the most
essential definitions of cleaning, some simple concepts for effective cleaning, and
the most common chemicals used by the brewing industry. Your chemical suppli-
ers are excellent resources and should always be consulted for best use and
application.

477
478 CLEANING, CIP, AND SANITIZATION
16.1 CLEANING A BREWERY
It is not possible to make good beer with dirty equipment. Deposits of soil
contribute off‐flavors, provide refuge to spoilage organisms, and interfere
with the proper operation of heat transfer surfaces, valves, pumps, and sen-
sors. Cleaning refers to the removal of unwanted materials from surfaces.
Sanitizing refers the processes that reduce microbes to acceptable levels.
Sanitization should not be confused with sterilization. Sterilization effectively
destroys all living cells, spores, and viruses. Sanitization only eliminates the
living cells.
Sinner Circle
The Sinner circle is a concept put forward in 1959 by Dr. Herbert Sinner of
Henkel, AG. There are four essential elements to cleaning: temperature, time,
mechanical action, and chemicals. These are represented in a divided circle
shown in Figure 16.1. The concept of the Sinner circle is that all four elements
are required for effective cleaning. If there is less of one element, the other
elements need to be increased to maintain cleaning quality.
Regarding temperature, higher temperature makes molecules move faster.
Reactions go faster at high temperature, so many cleaning chemicals become
more effective. In addition, many constituents of soils become more soluble
as the temperature is raised, improving their removal.
Chemicals, such as acids and bases, serve as complexing agents that bind
constituents of soil and help them dissolve. Surfactants enhance contact
between the water and the soil. Oxidants react with soils to improve their
solubility. Chemical suppliers innovate and often protect their specific formu-
lations as trade secrets. The best designed chemical cleaners help reduce the
other aspects of the Sinner circle.
Mechanical action can include scrubbing, stirring, and even ultrasonic
treatment. In most brewery cleaning situations, mechanical action is provided
Temperature Time
Chemical Mechanical
Figure 16.1 Sinner circle.

CLEANING A BREWERY 479
by jets of cleaning solution under pressure. Mechanical action is increased by

turbulent flow, correct fluid flow velocities, and pulse cleaning, which creates
spikes of turbulence. Foaming chemicals and sprayers are effective for clean-
ing large, complex exterior surfaces like packing lines. In these foam applica-
tions, mechanical action is limited to the popping of bubbles, and it is not
usually possible to increase the temperature, so cleaning effectiveness
depends on long contact time and strong chemicals.
Sanitary Design
Brewery design, installation, and planning for future expansion must provide
for effective cleaning. Valves and fittings that carry beer, wort, brewing liquor,
or anything that goes into the beer must be free of cracks and crevices that
are difficult to clean. Sanitary fittings are used to connect pipes and hoses.
The most commonly used fittings in the brewing industry are stainless steel
tri‐clamps (Figure 16.2). Tri‐clamp fittings involve two flat flanges or ferrules
that come together around a gasket. The flanges are pulled together by a
clamp.
Threaded pipe fittings are not suitable, because the spaces between the
threads prevent effective sanitation. All contact surfaces, including the insides
of pipes and tanks, should be smooth. Abrupt bends or size changes should be
avoided. Elbows and corners should have a radius at least 1.5 times the tube
inside diameter. Transitions from one tube diameter to another should be
made with smoothly changing transition fittings.
Gasket
Flange
Clamp not shown
Figure 16.2 Sanitary fitting.

Valve
High point
Sharp
Low point bend
Dead leg
Abrupt
transition
Figure 16.3 Piping problems.
Pipe layout is important for sanitary design (Figure 16.3). Branches in the

plumbing can lead to “dead legs” in which flow stagnates. High points without
vents can collect air, leading to stagnant zones. Low points without drains can
collect fluid. This applies to sagging pipes as well. Abrupt bends or changes in
pipe diameter interfere with the flow pattern, which can give rise to zones of
incomplete mixing.
Exterior Cleaning
The floors, walls, ceilings, storage areas, and exterior surfaces of equipment
must be kept clean. A regular program of sweeping, mopping, vacuum clean-
ing, application of cleaning foam, and hosing down should be implemented.
Areas under and behind things need special attention. Exterior cleaning
helps maintain a healthy work environment, holds down insect and rodent
infestation, and reinforces a culture of quality and professionalism that is as
much an ingredient of quality beer as are malt and hops.
16.2 CLEAN IN PLACE
Clean in place, or CIP, is a system in which apparatus and plumbing for

cleaning are built into the design of the plant. Cleaning is accomplished with-
out the need to disassemble or physically enter the equipment. CIP is nearly
universal in the food (including brewing) and pharmaceutical industries. In a
CIP‐enabled plant, each vessel is equipped with sprayers or jets to project
cleaning agents. The sprayers or jets are connected to tanks with cleaning
agents or rinse water. Return lines carry the used agents or rinse water back
to tanks for recovery. Heat exchangers maintain the proper temperature. The
cleaning cycle usually includes a prerinse to remove bulk soil and soluble
materials, a cleaning step; intermediate rinse to remove cleaning agents,
CLEAN IN PLACE 481
TABLE 16.1 The Steps of a Typical Clean in Place (CIP) Cycle

Step CIP Program Time (min)
1 Purge out CO2 5
2 Prerinse with water 5
3 Wash with caustic (recirculation) 30–50
4 Rinse with water 5
5 Wash with acid wash (recirculation) 10–15
6 Rinse with water 5
7 Wash with sanitizer (no recirculation) 15–20
sanitation to kill microbes; and final rinse to remove sanitation chemicals

unless no‐rinse sanitizers are used. These steps are often subdivided, for
example, an alkaline cleaning step may be followed by an acid cleaning step.
The cycle is often automated, allowing the reproducible application of mate-
rial to standardize cleaning and minimize waste. At minimum, a pump is
required to push chemical into tanks and a second pump for draining.
In steps where mineral deposits are unlikely, the acid wash may be
employed less frequently. Table 16.1 lists the typical steps in a CIP process
using a no‐rinse sanitizer. Draining steps are omitted. Temperature and time
are highly variable depending on the chemicals used and the CIP system. To
conserve water, the initial rinse for removing spent grain, wort, or beer may
be recycled rinse water from previous CIP cycles.
Cleaning of Vessels
Vessels, in contrast to pipes, tubes, hoses, and the like, have a large cavity.
Sprayers installed in the cavity can spray cleaning agents onto the walls. The
two classes of sprayers are spray balls and jets. Spray balls are hollow fixtures
with multiple holes to spray the cleaning or rinsing solutions. They distribute
cleaning agent widely throughout the vessel but without much force.
Figure 16.4 shows a spray ball and its action in a vessel. The pattern and posi-
tion of the ball is critical to ensure full coverage of the vessel surfaces.
Sometimes the spray is pulsed to increase mechanical scouring.
Jets have a few (typically 2–4) moving nozzles that drive cleaning agent
against the surface under high pressure. The impact of the fluid on the surface
provides mechanical scouring. Jets can project fluid a longer distance than
spray balls; they are often used in large vessels or those that are tall compared
to their width, or vice versa. The nozzles usually rotate in two planes to give
thorough coverage. Figure 16.5 shows a four‐nozzle jet that rotates in the
horizontal and vertical planes. The black line in Figure 16.5B shows the spray
pattern of one nozzle.
(A) (B)
Figure 16.4 (A) Spray ball. (B) Spray ball action.
(A) (B)
Figure 16.5 (A) Clean in place (CIP) jet. (B) Jet action.
For both spray balls and jets, the sprayers and other internal equipment
must be located so that the spray is not blocked in parts of the vessel. Such
“shadow” spots may include manways, temperature probes, sample lines,
racking arms, and spaces around gaskets. All equipment should be visually
inspected on occasion for CIP effectiveness with additional scrutiny of poten-
tial shadow spots.
CLEAN IN PLACE 483
Cleaning Pipes and Hoses

Pipes and hoses are cleaned by circulating cleaning solutions through them
with a pump. In permanently installed lines, a device called a pipeline pig may
be inserted to promote mechanical action. The cleaning cycle is the same as
in vessels. Mechanical scouring is provided to a limited extent by turbulent
flow. Because the flow is parallel to the walls, it cannot scour the pipe walls
directly. The key issue is to make sure every surface inside the pipe or hose
contacts the cleaning agent. Flow upward is more effective than flow down-
ward, as shown in Figure 16.6. It may be helpful to run the cleaning cycle in
both directions.
Hoses have the additional problem of deterioration. They are made of
polymer, their interiors are difficult to inspect, and the inside usually
takes more wear than the outside. The result is that hoses can look fine
but be riddled with cracks inside making them impossible to clean
effectively.
Cleaning Out of Place

Some parts of a system are not compatible with the CIP regimen. They
can be damaged by the heat or chemicals, or they have interior channels
that require special treatment. These must be removed and cleaned out of
place (COP) before the CIP cycle is initiated. Procedures for reinstalling
COP parts must ensure that the parts are not forgotten and that they are
not contaminated during storage or installation. Tri‐clamps, gaskets, and
other fittings can be soaked in cleaner according to manufacturer
specifications.
No contact
(A)
(B)
Figure 16.6 Cleaning pipe. (A) Flow down. (B) Flow up.
16.3 CLEANING CHEMICALS
There is no purpose in cleaning an extensively soiled surface. It will stay

soiled. For example, you would never add caustic to a mash tun still coated
with spent grain. A system should look significantly clean before attempting
the CIP cycle. This is accomplished by prerinsing with water.
Water
Water is an outstanding cleaning agent. It can be highly effective, especially
with polar or ionic soils. It is cheap, readily available, nontoxic, noncorrosive,
free of off‐flavors, and environmentally friendly. All cleaning is done with
solutions in which water is the major component. Water must be supple-
mented with other agents, all of which lack one or more of water’s desirable
properties.
Sodium Hydroxide
Sodium hydroxide, NaOH, is also called caustic soda, lye, alkali, or just
caustic. It is an inexpensive agent whose action results from its strong
basicity. Sodium hydroxide is particularly effective on protein soils and bio-
films. It is often used at concentrations of 2–5% and temperatures of 70–90 °C.
The main mode of action of sodium hydroxide is hydrolysis. It hydrolyzes fats
into more soluble fatty acid salts, called soaps, and glycerol as shown in
Figure 16.7. It hydrolyzes proteins into smaller fragments and amino acids.
WARNING: Sodium hydroxide solutions, especially when hot, are very
corrosive to the skin and eyes. Careful attention to training, equipment, oper-
ating and maintenance procedures, personal protective equipment (PPE),
and procedures for handling spills is necessary.
Some disadvantages of sodium hydroxide are that it can form insoluble
salts with some metal ions; it is not a surfactant; it is not active at binding
(sequestering) ions like calcium; it can foam; it sticks to surfaces, it can be dif-
ficult to rinse off, and it reacts with carbon dioxide to produce sodium bicar-
bonate: NaOH + CO2 → NaHCO3. A hectoliter of carbon dioxide can
neutralize the sodium hydroxide in 3 L of cleaning solution. The loss of sodium
hydroxide diminishes the effectiveness of the cleaning program. The loss of
carbon dioxide can produce an unexpected vacuum in a vessel, potentially
crushing it. For this reason, CO2 must always be purged from tanks before
cleaning. Effective pressure relief valves must be installed as a backup. Please
review Section “Cylindroconical Fermenters” (Chapter 9), which covers the
sources of implosion risk in brewing vessels. Not only will implosion ruin an
expensive piece of equipment, but it is also a severe safety risk associated
with CIP processes.
CLEANING CHEMICALS 485
+ 3NaOH
Na+ +
Na+ +
+
Na+
OH
HO OH
Figure 16.7 Hydrolysis of fat.
Sodium hydroxide is incompatible with aluminum. Despite the disadvantages,

sodium hydroxide is widely used, usually with additives to make up for its
deficiencies.
Sodium Metasilicate
Sodium metasilicate, Na2SiO3, provides alkalinity and helps disperse soils. It
is often used as a component of cleaning preparations, especially for beer
dispense systems.
Phosphoric Acid
Phosphoric acid (H3PO4) is the most commonly used acid. Acid cleaners do
not react with carbon dioxide. They rinse freely. Sometimes they are used to
remove sodium hydroxide. Acid cleaners are used to dissolve mineral depos-
its. They are particularly effective at removing calcium oxalate, also known as
beer stone. They are less effective than alkaline cleaners for fat and protein
removal.
Nitric acid is a strong oxidizing acid that may be blended with phosphoric
acid to promote cleaning and protection of stainless steel. Nitric acid is effec-
tive at removing rust and producing a thin, corrosion‐resistant oxide coating
on stainless steel, a process called passivating.
Surfactants
Surfactants have a polar (or ionic) and a nonpolar region. They lower
the interfacial tension between water and hydrophobic soils. This allows
the soils to become dispersed into small droplets surrounded by
surfactant molecules. In this context, they are sometimes called disper-
sants. Surfactants that do not dissolve in water have antifoam properties.
For most CIP applications, foam is undesirable, so antifoam surfactants
are usually part of the formulation.
Sequestrants
A sequestrant acts on ions to prevent them from forming precipitates giving
scale or scum. One type of sequestrant forms covalent bonds to hardness ions,
like Ca2+ to yield complex ions. The hardness ion tied up in the complex
becomes unavailable for forming scale. These are called stoichiometric
sequestrants. The sequestrant reacts with the ions it sequesters and is con-
sumed. Stoichiometric sequestrants have unshared electron pairs, often on
oxygen or amino (─NH2) groups. Figure 16.8 shows ethylene diamine tetraac-
etate (EDTA) ion, a powerful sequestrant of calcium ions frequently used in
cleaning formulations.
The other type of sequestrant is the threshold sequestrant. A threshold
sequestrant does not react directly with the hardness ions. It modifies the
surface of the solid so that it does not stick to form scale. Most threshold
sequestrants contain several phosphate groups. An example is 1‐hydrox-
yethane diphosphonic acid (HEDP) shown in Figure 16.9.
O
O C
C O
H2C
H2C H2
C N
N C CH2
H2
CH2 C
O
O O
C
Figure 16.8 Ethylene diamine tetraacetate (EDTA).

SANITIZERS 487
Figure 16.9 1‐Hydroxyethane diphosphonic acid (HEDP).
16.4 SANITIZERS
Sanitizers are compounds that kill microbes on surfaces. Ordinary sanitizers

will not make a surface sterile. They will, if properly applied, lower the
concentration of microbes to an acceptable level. Chlorine and bleach are
powerful sanitizers that should never be used with brewing equipment due to
their corrosive action on stainless steel.
Acid Sanitizer
Acid sanitizers contain about 300 mg/L phosphoric acid and an equal amount
of a surfactant. Acid sanitizers are used at room temperature. They sanitize in
one to two minutes and do not require rinsing. The concentrate, as delivered,
is irritating, but the diluted solution is harmless. The major disadvantage for
CIP use is foaming. They are quite suitable in soak baths for COP. Star San®
is a well‐known brand.
Peracetic Acid
Peracetic acid (PAA), CH3C(═O)OOH, also called peroxyacetic acid, is an
organic peroxide. Its antimicrobial activity comes from oxidation. It is used at
or below room temperature at 75–300 mg/L. PAA is smelly and decomposes
over time to acetic acid and hydrogen peroxide. The hydrogen peroxide
decomposes to water and oxygen gas, so the storage containers should allow
gas to escape. It is suitable for use in a final CIP rinse; no further rinsing is
required. Perasan® is a well‐known brand.
Iodophor
Iodophor is iodine stabilized with a surfactant. It is an oxidizer. It is used at
room temperature at 10–25 mg/L iodine. Iodophor is not suitable for use at
high pH. If the equipment had been treated with an alkaline agent, it should
be neutralized with acid prior to the iodophor rinse. Iodophor can be corro-
sive to stainless steel at high concentration. The undiluted stock solution
should not be allowed to make contact with the vessel. Iodophor can be used
for CIP final rinse and in COP soak baths. The solution should be allowed to
drain for 15 minutes after treatment. Iodophor stains plastic, and it can lend
an off‐flavor to beer if present at higher than the recommended concentra-
tion. BTF Iodophor® is a well‐known brand.
Chlorine Dioxide
Chlorine dioxide, ClO2, is a powerful sanitizing agent used at room tempera-
ture at concentrations of 0.5–1 mg/L. It is an oxidizer. Chlorine dioxide has
many desirable properties. It introduces no flavor taints; it is not corrosive; it
can be used as a final CIP rinse. Its major disadvantage is that it is not chemi-
cally stable. Chlorine dioxide is usually generated by a chemical reaction at
the point of use. One common method is the reaction of sodium chlorite
(NaClO2) with an acid:
5NaClO2 4H 4ClO2 4Na NaCl 2H 2 O
The solution must be used at once. Sodium chlorite is not to be mistaken

for sodium hypochlorite (NaClO, bleach).
Ozone
Ozone dissolved in water at a rate of 1–2 mg/L is an oxidizing sanitizer similar
in some respects to chlorine dioxide. Ozone is generated at the point of use
by treating air or oxygen with an electric discharge (arc). The resulting ozone
decomposes to oxygen, so the solution must be used at once. It leaves no
flavor taint and no harmful residue. It is even approved for direct application
to food surfaces. At normal concentration it is not harmful to brewing
equipment.
Hydrogen Peroxide
Hydrogen peroxide, H2O2, is a neutral oxidizing sanitizer. It eventually
decomposes to water and oxygen. Nonfood grades can contain harmful stabi-
lizers. Hydrogen peroxide can be used as a final rinse in CIP systems, but its
high effective concentration of 3% can be inconvenient.
Bleach
Sodium hypochlorite (NaClO), called bleach, is a very popular disinfectant in
water systems and swimming pools. It is still used for food and beverage sani-
tation at a concentration of 50–300 mg/L. Bleach has several serious disad-
vantages. It can react with beer constituents, especially polyphenols, to
produce off‐flavors in the beer. It can produce pitting corrosion in stainless
ANALYSIS AND QUALITY CONTROL OF CLEANING EFFECTIVENESS 489
steel. Its effectiveness is strongly dependent on pH. WARNING: Bleach must

not be mixed with acid; toxic chlorine gas will be released. The use of bleach
in breweries should be avoided.
16.5 ANALYSIS AND QUALITY CONTROL OF CLEANING

EFFECTIVENESS
The easiest quality control test for cleaning is to visually inspect surfaces.
With attention to problems areas like brandhefe rings, potential shadow
points, and beer stone deposits, if a surface looks dirty, then it is dirty. No
further tests are needed. Once a surface looks clean, a sensitive method to
confirm cleaning effectiveness is to use an adenosine triphosphate (ATP)
luminometer. Rinsing effectiveness should be checked with a pH meter, and
chemical concentration should be validated with titration. Many chemical
suppliers provide kits or instructions on tests for validation of the recom-
mended working concentrations of their products
Surface ATP Tests

The ATP surface test is deemed essential because of its easy use and rapid
results. It is most commonly employed to check for general CIP cleaning
effectiveness of brewery surfaces. Any surface with routine exposure to wort,
beer, or yeast should be regularly checked. Though a surface may look clean,
the presence of bacteria is nearly impossible to see with the naked eye unless
there is a severe problem, like a biofilm. Biofilms that harbor bacteria can
be very difficult to remove completely. The ATP test can also be adapted to
check for air and water quality. There are many suppliers of ATP systems,
including Hygiena® (Camarillo, CA), VWR® (Radnor, PA), and 3M®
(Maplewood, MN).
The ATP test measures the presence of bacteria or yeast. The reagents
contain an enzyme called luciferase and a substrate called luciferin. The lucif-
erase catalyzes a reaction of luciferase with ATP resulting in emission of light
(luminescence), the very same reaction that occurs in fireflies, which is how
these reagents were discovered. The amount of light emitted depends upon
the availability of ATP from the environment. ATP is found in all bacteria
and yeast, living or dead; the more bacteria that are present, the more lumi-
nescence is detected by the ATP test.
To run the test, a sterile swab is brushed in a pattern against a 10 × 10 cm
(4 × 4 in.) swatch of the surface in question to collect any surface bacteria
or yeast (Figure 16.10). The swab is exposed to the reagents and placed
back into the collection tube. The collection tube is then placed into a
58
RLU
10 cm
Go
(A) (B) (C)

Figure 16.10 Adenosine triphosphate (ATP) swab testing procedure. (A) Swab
surface. (B) Activate reagents. (C) Results.
luminometer to record relative light units (RLUs). Swabs with samples can
be stored, before exposure to reagents, for up to four hours. Once exposed,
they should be quickly analyzed. The acceptable RLUs for a brewery
depend upon specifications set by each brewery. Typically, a reading of
0–10 RLUs is acceptable; 10–40 RLUs warrants caution; greater than 40
RLUs is unacceptable.
Liquid ATP Test

The same ATP test, with a revised sample collection procedure, can be
used to detect contamination in liquids. Liquid samples from equipment
with inaccessible surfaces, like pipes and hoses, can be evaluated for clean-
liness. Liquid testing can also be used on the final rinse for brewing vessels.
Liquid testing gathers a sample from the entire surface, so it is good for
detecting localized contamination that could be missed by swabbing, but it
gives no indication of exactly where the contamination is located. In liquid
testing, the equipment is rinsed, and ATP testing is conducted on a sample
of the rinse water. The sample is collected with a probe that picks up a
measured volume. The sample in the probe is processed in the same way as
a swabbed sample.
pH Check of Rinse Water

It is important to remove all soils from equipment, but it is equally important
to remove all traces of the cleaning reagents. Because most cleaning reagents
are caustic or acidic, checking the rinse water pH is a quick and effective
method to monitor rinsing effectiveness. Checking the pH of the rinse water
may also help to prevent excess rinsing, thereby saving water.
CASE STUDY 491
1. What is the Sinner circle?

2. A brewer cannot mechanically scrub all surfaces of every piece of equipment
that contacts beer. Using the Sinner circle with practical examples, explain
how a reduction in mechanical scrubbing is overcome in the brewery.
3. What are some features of sanitary fittings?
4. Identify potential sanitary problem areas in pipe layouts.
5. Define clean in place.
6. What are some common design elements in brewing vessels to promote
CIP effectiveness?
7. How does sodium hydroxide work as a cleaning agent?
8. What are three ways to avoid collapsing a tank during CIP cleaning?
9. What are suitable applications for acid cleaners?
10. What are the roles of surfactants and sequestrants in cleaning?
11. Discuss the application of ATP testing in validating cleaning effectiveness.
CASE STUDY
You were recently hired to run quality control at a brewery with a 10 bbl brew-
house and 20 bbl fermenters. The brewery currently makes their own caustic.
They clean with 2% (w/v) sodium hydroxide solution at 70 °C. The brewery does
not use an acid wash step, and they use iodophor for sanitation. You are eager to
start working at the brewery but cannot relocate for another few weeks. You
decide to get started by creating an auditing checklist, developing a plan to eval-
uate effectiveness, and doing some research on new chemicals to purchase.
As one of your first initiatives, you will audit the design of the CIP system
and its effectiveness. In anticipation of auditing the brewery, create an auditing
checklist of essential CIP design elements for each processing step that you
deem essential (brewhouse, chiller, fermenter, and bright tank).
Describe how you will use the auditing checklist to validate efficacy of the
current CIP system.
Finally, recommend a caustic cleaner, acid cleaner, and sanitizer for imple-
mentation in the brewery. You are encouraged to reach out to local chemical
suppliers or brewers in your area to inquire about their recommended products.
In your recommendation consider the cost of implementing new chemicals on
the bottom line of the business. Explain the rationale for the new expense.
BIBLIOGRAPHY
CRC. ISBN 0‐8493‐2547‐1. pp. 637–647. Covers sanitary design, cleaning agents, and
sanitizers.
Lewis A. 2006. Plant Sanitation. In Ockert K (editor). Brewing Engineering and Plant
Operations. Master Brewers Association. ISBN 0‐9770519‐3‐5. Chap. 2.
Praeckel U. 2009. Cleaning and Disinfecting. In Eßlinger HM (editor). Handbook of
Brewing. Wiley VCH. ISBN 978‐3‐527‐31674‐8. Chap. 25.
GLOSSARY
1000 kernel weight n Mass of 1000 seeds estimated from a representative clean
sample of grain. Also called the 1000 corn weight or thousand corn weight.
α‐acid n Alpha acid.
α‐amylase n Alpha‐amylase.
β‐acid n Beta acid.
β‐Amylase. Beta‐amylase.
absorbance n Measure of light absorbed by a sample calculated from
2 − log(%T), where %T is the transmittance of a sample, expressed as a
percentage.
ABV n Alcohol by volume.
ABW n Alcohol by weight.
acetaldehyde n Organic compound CH3CHO. Precursor to ethanol in
fermentation.
acetate n Ionized form of acetic acid. Final product of ethanol metabolism.
acetic acid n Organic compound: CH3CO2H. Gives vinegar flavor.
acetobacter n Bacteria that can gain energy by oxidizing ethanol to acetic
acid in the presence of oxygen.

493
494 GLOSSARY
acetyl coenzyme A n Biological thioester used to transport acetic acid.

acid 1. n Any chemical compound that provides a hydrogen ion. 2. adj Having
a pH of less than 7. 3. adj Exhibiting sourness characteristic of acidity.
acidic adj Dominated by acid.
acidity 1. n Quantity or concentration of acid in a sample. Also called titrata
ble acidity. 2. n Sour flavor or other property characteristic of acid.
acid rest n A period during which the mash temperature is held at about
35–40 °C (95–105 °F) to allow phytase enzyme to release phosphoric acid
lowering the mash pH.
acidulated malt n Malt that has been subjected to a bacterial process to
generate acid, usually lactic acid. Used to lower mash pH without contra
vening the Reinheitsgebot. Also called Sauermalz.
acrospire n Shoot issuing from the embryo of a germinating seed.
activated carbon n Highly porous carbon made by treatment of coke or
charcoal at high temperature with a material that reacts with it to give a
gas. Used to purify water and other fluids.
activation energy n Minimum energy needed for a chemical reaction event.
active site n Location on a catalyst molecule or surface responsible for the
catalytic reaction.
actuator n Device that automatically operates a mechanical system, like a
valve, in response to a control signal.
addition n Chemical reaction in which the second or third bond in a multiple
bond breaks and groups bond to each end of the broken bond.
adenosine diphosphate n ADP. Adenosine ester with pyrophosphoric acid
(H4P2O7) attached to the ribose portion, the low‐energy form of ATP.
Chemical name: adenosine pyrophosphate.
adenosine triphosphate n ATP. Adenosine ester with tripolyphosphoric acid
(H5P3O8) attached to the ribose portion, the molecule that carries energy
in cells. Chemical name: adenosine tripolyphosphate.
adjunct n Source of fermentable material other than malted grain.
administrative control n Policy or procedure that reduces the risk or severity of
a hazard. For example, a policy that sets a schedule for testing relief valves.
admix n Body feed.
ADP Adenosine diphosphate.
advanced hop product n Flavorings for beer derived from hops by liquid
extraction, hydrogenation, etc.
aerobe n Organism that uses oxygen.
aerobic adj Using oxygen.
agar n Jellylike material derived from seaweed. Used to support growth
media for microbial cultures.
GLOSSARY 495
aging n Deliberate process of storing an alcoholic beverage or other food for

an extended time to develop characteristic flavors.
air‐actuated valve n Valve that is opened or closed by the application or
removal of air pressure.
air knife n Device that blows compressed air in a laminar flow across bottles
or cans to facilitate drying. Used in packaging operations.
alcohol n 1. Organic compound with the ─OH group as its principal func-
tional group. 2. Ethanol.
alcohol by volume n Volume fraction of ethanol in a solution measured at
20 °C, usually expressed as a percent. Abbrev: ABV.
alcohol by weight n Mass fraction of ethanol in a solution, usually expressed
as a percent.
alcohol dehydrogenase n Enzyme that catalyzes the dehydrogenation of
ethanol to acetaldehyde or the reverse. Abbrev: ADH.
alcoholic beverage n Liquid containing ethanol for human consumption.
alcoholic fermentation n Fermentation in which the major products are
ethanol and carbon dioxide.
alcoholism n Addiction to ethanol.
alcoholometer 1. n Hydrometer designed for measuring ethanol concentration
in water solution. 2. n Any instrument for measuring ethanol concentration.
aldehyde n Compound with a C═O group bound to one or two hydrogen
atoms.
aldehyde dehydrogenase n Enzyme that catalyzes the dehydrogenation of an
aldehyde to a carboxylic acid. Abbrev: ALDH.
aldose n Monosaccharide originating as an aldehyde.
ale 1. n Formerly, beer made with gruit instead of hops. 2. n Beer fermented at
a temperature above 15 °C (60 °F), typically with Saccharomyces cerevisiae
ale strains known at top cropping yeast.
aleurone layer n Thin layer of living cells beneath the bran or hull. A source
of proteins and lipids. Produces enzymes when the plant embryo
germinates.
alkali 1. n Base. 2. n Sodium hydroxide, potassium hydroxide, or a mixture.
alkaline adj Basic.
alkalinity n Measure of the amount of base in water.
alkaloid n Naturally occurring amine.
alkane n Organic compound with only carbon and hydrogen and only single
bonds.
alkene n Hydrocarbon with one or more C═C double bonds.
alkyl group n Part of a molecule including only C and H atoms with only
single bonds.
496 GLOSSARY
alloy n Mixture displaying metallic character comprising one or more metals

and possibly nonmetals.
alpha n First letter of the Greek alphabet: α.
alpha‐acetolactate n Compound: anion of C5H8O4. Precursor for diacetyl.
alpha acid (α‐acid) n One of three compounds in hops, humulone, cohumu
lone, or adhumulone that, after isomerization, gives hop bitterness.
alpha‐amylase (α‐amylase) n Enzyme that hydrolyzes alpha(1→4) glycosidic
links on a starch chain at random locations.
American Society of Brewing Chemists n Learned society that devises ana
lytical procedures and sets standards for malting, brewing, and packaging.
amide n Carbonyl compound with a nitrogen atom bound to the carbonyl
carbon.
amine n Compound with an amino or substituted amino group as its principal
functionality.
amino n ─NH2 group.
amino acid n Molecule with the carboxyl group (─COOH) and the amino
group (─NH2), usually connected to the same carbon.
amino nitrogen n Free amino nitrogen.
aminopeptidase n Enzyme that hydrolyses peptide molecules at the
amino‐terminus.
Amorphous adj Arrangement of atoms or molecules in which there is no
regular pattern or order.
amphipathic adj Amphiphilic.
amphiphilic adj Partly polar and partly nonpolar. Said of a molecule. Also
called amphipathic.
amylase n Enzyme that hydrolyzes alpha(1→4) glucose links on starch chains.
amyloglucosidase n Enzyme that hydrolyzes all glycosidic links in starch.
Also called glucoamylase.
amylolytic adj Having the ability to hydrolyze starch. Said of an enzyme.
amylopectin n Polymer of glucose with mainly alpha(1→4) links with
alpha(1→6) branches every 30–50 units. A type of starch.
amylose n Unbranched polymer of glucose with alpha(1→4) links. A type of
starch.
anabolism n Biological process in which simple molecules are assembled to
give complex molecules.
anaerobe n Organism that does not use oxygen.
anaerobic adj Without air or oxygen.
analyte n Substance whose quantity is being measured.
analytical balance n Laboratory balance with a sensitivity of 0.1 mg or smaller.
GLOSSARY 497
anion n Atom or group of atoms with a negative electric charge.

anomeric carbon n Hemiacetal or hemiketal carbon atom in a cyclic carbohy-
drate molecule. Has bonds to two oxygen atoms.
anticodon n Sequence of three RNA nucleotides complementary to a codon.
Found on tRNA.
antifreeze n Substance, such as ethylene glycol, added to a solution to lower
the freezing point.
antioxidant n Substance that inhibits oxidation either as a reducing agent or
a free radical trap.
antiparallel adj Oriented with the major axes parallel but with opposite direc
tionality or spin. Said of polymers that have inherent directionality,
like proteins or nucleic acids, and of bodies with angular momentum, like
atomic nuclei.
apparent attenuation 1. n Difference between specific gravity before (initial
gravity: OG) and after (final gravity: FG) fermentation. 2. n Apparent
degree of fermentation.
apparent bulk density n Mass divided by the bulk volume of a sample, with
out taking void space into account. Sometimes called unit weight.
apparent degree of fermentation n Difference between specific gravity before
(initial gravity: OG) and after (final gravity: FG) fermentation reported as
a percentage of OG. The measure is “apparent” because after fermenta
tion, ethanol, which is less dense than water, makes the specific gravity an
inaccurate estimate of the solids content. Abbrev: ADF.
apparent density n Density calculated from a mass determined without t aking
buoyancy in air into account.
apparent extract n Solids content equal to that of a sucrose–water solu
tion of the same specific gravity. Usually said of beer during or after
fermentation.
apparent gravity n Final gravity. This term is not recommended; the specific
gravity is real. The solids content estimated from it is apparent.
aqueous adj In water solution.
arabinose n Specific five‐carbon aldose often found in cell walls.
Archimedes principle n Law of physics: a body immersed in a fluid experi
ences an upward force equal to the weight of the fluid whose volume the
body displaces.
aroma n Sensation caused a material in the gas phase detected by smell.
aroma hops n Hops added shortly before or after the end of boiling to impart
a characteristic aroma to the beer.
aromatic adj Having a ring containing alternating single and double bonds.
Said of an organic compound.
498 GLOSSARY
aseptic adj Free from contamination of unwanted microorganisms.

ash n Solid remaining after a sample has been completely burned. Often
expressed as the mass fraction of ash to the original dry mass of the sample.
as‐is adj Based on the mass of a sample without correction for moisture. Said
of an analytical result. See dry basis.
assortment n Size distribution. Said of grain and malt.
astringent 1. adj Dry or puckering mouth feel. 2. n Astringent (1) substance.
asymmetric carbon n Carbon atom with four different types of atoms or
groups attached.
atom n Tiny particle that is the smallest single unit of a particular element.
atomic number n Number of protons in an atom. The atomic number deter
mines each unique element.
atomic weight n Molar mass of atoms of a particular element.
ATP n Adenosine triphosphate.
ATP bioluminescence n Test for the presence of microbes. Microbes, living or
dead, contain adenosine triphosphate (ATP). The ATP is made to gener
ate light. The intensity of light generated is an indication of the number of
microbes in the sample. Used to test the effectiveness of sanitation.
attenuate v Lower the solids concentration by fermentation.
attenuation n Difference between initial (before fermentation) and final
(after fermentation) solids content of wort or must, often expressed as a
fraction of the initial solids.
attenuation limit n Maximum attenuation possible with a particular strain of
yeast and a particular wort composition. Typically determined by forced
fermentation.
attract v Exert a force that pulls something closer.
auger n Screw conveyor.
autoclave n Container or device that enables high pressure and temperature
for sterilization, often through steam.
autolysis n Rupture of a cell membrane by action of the cell’s own enzymes.
awn n Long spiky extension of the hull of a seed of grain. Also called a beard.
axial 1. adj In a direction perpendicular to the plane of a ring. 2. adj In the
direction of the optical axis.
bacillus n Rod‐shaped bacterial cell. pl bacilli.
back‐titrate v Analyze by mixing the analyte with a known amount of reac-
tant that is enough to be an excess. Then analyze the excess reactant by
titration.
bacteria n Organisms belonging to a large domain of single‐cell prokaryotes.
Singular: bacterium.
GLOSSARY 499
bacteriostatic adj Biological or chemical agent that prevents bacteria from

reproducing but does not necessarily kill them.
balance 1. n Instrument to measure the mass of an object. 2. v Adjust the coef-
ficients of a chemical equation to get the same number of each type of
atom and the same total charge on the reactant and product sides of the
equation.
balanced 1. adj Having equal numbers of each type of atom on each side; said
of a chemical equation. 2. adj Having a pleasing ratio of flavor elements,
especially maltiness to bitterness in beer.
Balling n Scale relating specific gravity to sugar content for aqueous solutions
of sucrose. Considered obsolete. See Plato.
ball valve n Valve with a rotating ball with a hole bored completely through
it. The valve is operated by positioning the hole parallel to the flow path
to open it or perpendicular to the flow path to close it. Can be operated
partially open to provide coarse control of flow rate. Is not capable of CIP.
bar 1. n A counter for serving alcoholic beverages. 2. n An establishment that
sells alcoholic beverages for consumption on the premises. 3. n A unit of
pressure equal to 100 000 pascals (0.987 atm or 14.50 psi).
barley n Grassy plant of the genus Hordeum.
barm beer n The liquid beer present within and/or on top of a yeast slurry.
barrel 1. n Cylindrical container often made of wood staves. Usually refers to
sizes small enough to be moved. 2. n Any of various measures of volume,
for example, the US beer barrel is 31 US gallons (117.35 L). Abbrev: bbl.
See cask (2), foeder.
barrier tubing n Tubing lined with an oxygen‐impermeable coating, usually
polyethylene terephthalate (PET). Used in beer lines.
base 1. n Substance whose molecules accept hydrogen ions. 2. n Nucleobase.
base malt n Malt with at least sufficient diastatic power to saccharify its own
starch.
base pairing n Selective hydrogen bonding interaction among nucleobases.
basic adj Dominated by base (1).
batch sparge v Sparge with a technique where the wort is completely drained
during the lauter. The mash/lauter is then refilled with water; the grain bed
is re‐established, and the second runnings are drained.
bauxite n Ore of aluminum with about 50% aluminum oxides and hydroxides
and the rest mostly iron oxides.
beer 1. n Fermented alcoholic beverage made from a source of starch without
concentrating the alcohol. 2. n Beer made with hops in contrast to ale (1).
beer hall n A large establishment that sells beer for consumption on the
premises.
500 GLOSSARY
beer line n Tubing to carry beer in a dispensing system.

Beer’s law n Also known as the Lambert–Beer law. Describes, in spectros
copy, the relationship between light absorption by a material and the
concentration of the material.
beer stone n Solid whose major component is calcium oxalate. Beer stone can
stick to beer brewing and dispensing equipment.
beta n Second letter of the Greek alphabet: β.
beta acid (β‐acid) n One of three compounds in hops, lupulone, colupulone,
or adlupulone. These compounds do not isomerize to give bitterness, but
their oxidation products can provide bitterness. Also called lupulone.
beta‐amylase (β‐amylase) n Enzyme that hydrolyses the second alpha(1→4)
glycosidic bond from the nonreducing end of a starch chain to yield
maltose.
beta‐glucan (β‐glucan) n Gum comprising glucose mostly with beta(1→4)
linkages but with beta(1→3) linkages every four to six glucose units.
Increases the viscosity of water solutions.
bill of lading n Document issued by a carrier to acknowledge receipt of cargo.
When signed by the receiver, serves as proof that the cargo arrived.
binding site n Location on one molecule that has a specific attraction for
another molecule or part of a molecule.
biopolymer n Polymer synthesized by a cell, such as a protein, DNA,
or polysaccharide.
biotransformation n Chemical change of a substance resulting from the
action of a cell.
bits n Particles large enough to be individually distinguished by eye rather
than as a homogenous haze.
bittering hops n Boiling hops.
bitterness unit n Measure of isomerized alpha acids in beer according
to ASBC Method Beer 23A: bitterness units (BU) or the equivalent
EBC method. Abbrev: BU. Roughly equivalent to one milligram of
isohumulone per liter. Also called international bitterness unit.

Abbrev: IBU.
bleach 1. n Solution of about 5% sodium hypochlorite (NaOCl) in water.
Used to remove color and as a disinfectant. 2. v Cause color to fade.
body feed n Filtration medium suspended in the material to be clarified. See
precoat.
boiling hops n Hops added when boiling starts to add bitterness to beer. Also
called bittering hops.
boiling point n Temperature at which the vapor pressure of a liquid is equal
to the surrounding pressure.
GLOSSARY 501
boil over v Rise above the opening and flow out of a container of boiling
liquid because of excessive buildup of foam.
boilover n Instance of boiling over. Also spelled boil‐over.
bond n Force of attraction holding atoms together.
bond energy n Amount of energy needed to break a particular bond. Also
called bond strength.
bonding pair n Pair of valence electrons shared between two atoms.
bound adj Held to something by forces of attraction.
boundary layer n Thin, stationary, non‐flowing region of a moving fluid (or of
a fluid through which a solid moves) against the immersed solid surface.
Matter and energy are exchanged between the bulk (moving) fluid and the
boundary layer largely by diffusion.
bouza n North African style of beer made from bread and malt.
brandhefe n Cold break lipids, protein, and yeast left behind as a ring near the
top of a fermenter after the krausen subsides [Ger. burnt yeast].
brass n Alloy of copper and zinc.
breathalyzer n Portable device to measure alcohol concentration in exhaled
breath.
Brettanomyces n Genus of yeast used to make certain beer styles.
brew v Prepare beer.
brewer’s grain n Spent grain after mashing.
brewery n Facility for making beer.
brewhouse n Portion of a brewery with equipment for mashing, wort separa-
tion, boiling, wort chilling, and associated processes.
brewhouse efficiency n Ratio of actual carbohydrate extracted to potential
extract of carbohydrate sources in the mash.
brewing liquor n Water that is to be made into beer.
bright adj Clear; free of haze.
bright beer n Beer from which yeast has been removed.
bright beer tank n Vessel for bright beer. Also called bright tank or brite tank.
brink n Vessel for storing used yeast prior to pitching into a new
fermentation.
brittle adj Susceptible to cracking or shattering.
Brix 1. n Scale relating specific gravity to content for aqueous solutions of
sucrose. 2. n A degree Brix, which closely approximates 1% sugar by
weight. Abbrev: °Bx.
BTU n British thermal unit. Unit of energy equal to 1054.35 Joules. In heat
ing and cooling systems, often erroneously used for BTU/h, a measure of
power. 1 BTU/h = 0.2929 W.
502 GLOSSARY
bud 1. n Immature yeast cell still attached to the parent cell. 2. v Produce a
bud (1).
budding index n Fraction or percent of a sample of cells that are producing
buds (1).
buffer 1. n Solution containing a partially neutralized weak acid or weak base,
allowing it to maintain a relatively constant pH upon the introduction of
small amounts of acid or base. 2. v Resist change in pH because of the
presence of a buffer (1).
bung 1. n Stopper for the side opening of a cask or barrel, also called shive. 2.
v To close with a bung (1). 3. v Spond.
buoyancy n Force pushing a submerged or floating object upward.
buoyancy correction n Correction applied to the measured mass of an object
taking into account the effect of buoyancy of air. For materials whose den
sity is near that of water, the correction is about 0.11%.
burr n Female hop flower.
butterfly valve n Valve with a plate that, when it is perpendicular to the flow
direction, blocks flow. The valve is opened by rotating the plate to be paral
lel to the flow.
calandria n Tubular heat exchanger that provides heat to a liquid to boil it.
calorie n Unit of energy equal to 4.184 joules. Symbol: cal.
Calorie n Unit of energy equal to 1000 calories or 4184 Joules; a
kilocalorie.
cAMP n Cyclic adenosine monophosphate.
Campaign for Real Ale n Consumer movement to maintain the traditional
forms of serving ale to preserve a cask‐conditioned flavor.
CAMRA n Campaign for Real Ale.
candi sugar n Brewing adjunct prepared by heat treatment of unrefined beet
sugar.
capacitance n Ability to store electrical charge, defined by C = Q/V, where C
is the capacitance (farads), Q is the electric charge (coulombs), and V is the
electrical potential (volts).
caramel color n Material prepared by heat treatment of sugar alone or with
the addition of acid or base. Caramel color has an intense brown color
that can be used to adjust the color of food and beverages. Caramel
color for beer is usually prepared by heating sugar with ammonium
compounds.
caramel malt n Crystal malt.
carbohydrate n Substance with only carbon, hydrogen, and oxygen, h aving
two hydrogen atoms for each oxygen atom, a carbonyl group and one
─OH group on each of the other carbon atoms, or a substance made by
condensing two or more of these with the elimination of water.
GLOSSARY 503
carbonate 1. v Dissolve carbon dioxide in a solution. 2. n Compound containing

the carbonate ion.
carbonate ion n CO32− ion.
carbonyl n C═O group.
carboxylic acid n Organic compound with the ─COOH group.
carboxypeptidase n Enzyme that hydrolyzes peptide molecules at the
carboxyl‐terminus.
carboy n Very large bottle made of thick glass or plastic.
carrageenan n Polymer of sulfated galactose units prepared from seaweed.
Used as a fining during the wort boil. Also called Irish moss.
cask 1. n Cylindrical container with two or more openings used to transport
and serve beer. 2. n Container of any size made of wood staves for storage
or transportation of materials. See barrel (1), foeder.
cask breather n Valve to admit carbon dioxide to a cask during beer dispense
to keep air out.
cast 1. v Transfer liquid or slurry from a vessel, especially to transfer wort
from the kettle. 2. adj Having been cast.
catabolism n Biological process in which complex molecules are broken
down to simpler molecules.
catabolite repression n Sugars other than glucose are not fermented when
the glucose concentration is high. Also called glucose repression. See
Crabtree effect.
catalase n Enzyme that catalyzes the decomposition of hydrogen peroxide to
oxygen and water, used to characterize bacteria.
catalyst n Material that speeds up a chemical reaction but is not a reactant or
a product.
catalyze v Speed up a chemical reaction without becoming a reactant or a product.
cation n [CAT‐eye‐on] An atom or group of atoms with a positive charge.
caustic 1. adj Strongly basic. 2. n Sodium hydroxide.
celiac disease n Autoimmune response to gluten that damages the small
intestine. Also spelled coeliac disease.
cell n Basic unit of life containing structures and substances surrounded by a
membrane.
cellar 1. n Part of a brewery in which fermentation takes place. 2. n Room for
storing beer before it is served.
cell membrane n Thin film surrounding a cell, also called plasma membrane.
Sometimes mistakenly called the cell wall.
cellobiose n Disaccharide comprising two glucose units with a beta(1→4) link.
cellulose n Long chain carbohydrate comprising glucose units with beta(1→4)
links.
504 GLOSSARY
cell wall n Rigid layer outside the cell membrane in plants, fungi, and
bacteria.
centiliter n Non‐recommended unit equal to 10 milliliters. Symbol: cL.
centrifuge n Device to spin a sample rapidly causing heavier particles to sepa
rate from lighter ones by sedimentation.
cereal n Grassy plant that yields edible grains. These include many of the
grains used to make beer.
cereal cooker n Vessel to boil unmalted grain used as an adjunct.
chalk n Calcium carbonate.
channel n Protein structure extending through a membrane that can open to
allow certain ions or molecules to flow through the membrane.
chaperone protein n Protein that folds another protein into a specific tertiary
structure.
charcoal n Carbon made by heat treatment of plant or animal material.
check valve n Valve that allows a fluid to flow in one direction only.
chelating agent n Compound that can provide two or more electron pairs that
form covalent bonds with metal ions. This lowers the effective concentra-
tion of the bound ions. Used in cleaning solutions.
chemical bond n Bond.
chemical equation n Symbolic statement of a chemical reaction showing how
much of each item is consumed and how much is produced.
chemical formula n Symbolic representation of a compound or molecule in
which element symbols are given subscripts showing how many atoms of
each element are in a unit of the compound or molecule (subscripts of one
are omitted).
chicha n South American beer style made from maize.
chiller 1. n Heat exchanger used to lower the temperature of wort after boil
ing. 2. n Refrigeration unit.
chill haze n Aggregation of hop polyphenols and barley proteins in beer that
results in cloudiness that appears at low temperature and disappears at
room temperature.
chime 1. n Portion of the staves of a barrel that extend beyond the head. 2. n
Protective rail around the ends of a keg. Also spelled chimb.
chiral adj Having a mirror image that is different from the original molecule.
chit 1. n Small protrusion of root from a seed during sprouting. 2. v (Of seeds)
to display a chit (1).
chitin [KITE’n] n Polymer made of modified glucose units connected by
beta(1→4) linkages. Structural material in fungus cell walls.
chit malt n Seeds that are kilned as soon as they chit (2), so they are minimally
modified.
GLOSSARY 505
chromatography n Method of separation and analysis that uses difference

in affinities of the molecules under study for a stationary and a mobile
phase.
chromosome n Long strand of tightly coiled DNA in living cells that encodes
genetic information or genes.
CIP adj Clean in place.
citric acid cycle n Biochemical pathway in which acetate ion reacts to
give carbon dioxide and several hydrogenated molecules that can be
combusted to yield energy in the form of ATP. Also called Krebs cycle.
clean 1. adj Free of undesired material. 2. v Remove undesired material from
a surface.
clean in place adj Relating to a method of cleaning inside surfaces of
equipment and plumbing while it is still assembled. Abbrev: CIP.
coagulate v Form solid particles in a liquid.
coalescence n Particle growth by smaller particles colliding and sticking
together to form larger particles. See disproportionation.
coccus n Spherical bacterial cell. pl cocci.
codon n Sequence of three RNA nucleotides that specifies a particular amino
acid in biological protein synthesis.
coefficient n Number in a chemical equation indicating the number of
molecules or ions consumed or produced.
cohesive adj Having attractive forces that hold parts of a substance together.
coke n Carbon made by heat treatment of coal.
cold break n Solid material precipitated upon chilling of wort. See trub.
collagen n Protein in animal connective tissue.
colloid n Heterogenous material that consists of a continuous phase and a
dispersed phase, especially one in which the phases do not separate quickly.
Examples include beer haze and foam.
colloidal stability n Resistance to the appearance of haze.
colony n Cluster of microbes originating from a single cell.
colony forming unit n Unit estimating the number of live microbes in a
sample based on formation of visible colonies. Abbrev: CFU.
column n Tube or cylinder.
complementary adj Engaging in a specific binding interaction. Said of nucle-
obases: guanine is complementary to cytosine; adenine is complementary
to thymine in DNA and to uracil in RNA.
component n One of the substances in a mixture.
composition 1. n Relative amount of each component of a mixture. 2. n
Relative amount of each element in a compound, often called elemental
composition.
506 GLOSSARY
compound n Single substance with more than one type of atom.

compression n Force tending to decrease the length or volume of an object;
push. See tension.
compression fitting n Fitting for tubing comprising a body with a cup‐shaped
sealing surface, a deformable ring called a ferrule, and a cap called a nut
that can be tightened to threads on the body. To make the joint, the ferrule
is place in the body, and the nut screwed on lightly. The tube is inserted into
a hole in the nut and through the ferrule. The nut is tightened, deforming
the ferrule and making it grip the tube and press against the sealing sur
face in the body. See pipe fitting.
concentration n Ratio of a measure of mass, moles, volume, or other units of
a component to a measure of the amount of the mixture.
condense 1. v Change from the vapor to the liquid state. 2. v React to connect
two molecules and release a water molecule.
condenser 1. n Part of a refrigerator in which coolant vapor is condensed
under pressure, releasing heat into the warm side of the cooling cycle. 2. n
Part of a light microscope that illuminates the sample. 3. n Laboratory heat
exchanger used to condense (1) vapors during distillation.
condition v Process fermented beer to give improved clarity and flavor.
cone hops n Leaf hops.
confidence interval n Range of values for a measurement within which there is
a specified probablity that the average of all possible measurments would lie.
confined space n Place that is possible for a person to enter but with limited
access making it unsuitable for habitation. Special precautions must be
observed when it is necessary for a person to enter a confined space.
Congress mashing v Small‐scale, standardized laboratory method of mashing
to assess malt quality.
conjugated adj Having alternating single and double bonds or unshared pairs.
continuous sparge v The rinsing of grains after lautering whereby water is
sprayed over the grain bed at similar rate to wort runoff, maintaining a thin
level of water above the grain.
control chart n Graph showing a time sequence of measurements (or statistics
derived from the measurements) taken at a specific point in a process. The
chart is usually marked with the mean and with upper and lower control limits,
usually three standard deviations above and below the mean. Used to esti
mate the inherent variability in the process and to diagnose loss of control.
control limit n Boundary of the region outside of which a process is regarded
as out of control.
control point n Step or process at which control can be applied to reduce risk
of a defect.
GLOSSARY 507
conveyor n Device for continuously moving objects or material.

coolship n Wide shallow open vessel in which hot wort is allowed to cool by
contact with ambient air.
copper 1. n Highly conductive red metal, element 29, symbol Cu. 2. n (chiefly
British) Kettle.
core 1. n Part of an atom including the nucleus plus electrons of lower energy
than the outmost electrons. 2. adj Belonging to the core.
corn 1. n Seed of grain. 2. n Maize.
corrosion n Loss of metal due to oxidation.
countercurrent adj Fluid being processed flows in the opposite direction of
the fluid moving heat in or out.
coupler n Fitting that connects a keg to a dispensing system. Has provision to
provide gas to the headspace of the keg and to accept beer from the spear
and deliver it to the beer line.
covalent adj Sharing electrons.
covalent bond n Chemical bond resulting from sharing electrons.
Crabtree effect n Alcoholic fermentation despite the presence of oxygen.
crash v Quickly lower the temperature of beer after fermentation to cause
the yeast to sediment.
crimp 1. v Join two parts by bending one around the other. Said of crown caps
and bottles. 2. n Seal between a crown cap and bottle.
critical point n Temperature and pressure for a particular substance at which
the distinction between vapor and liquid disappears. Not to be confused
with triple point.
crop v Collect yeast from fermentation for reuse.
crown cap n Cap with puckers along its rim. Used for sealing bottles.
croze n Groove in the staves of a barrel to accommodate the head.
crush v Mill (2).
crystal n Regular three‐dimensional pattern of atoms, ions, or molecules to
form a solid.
crystalline structure n Arrangement of atoms or molecules into a regular
pattern in three dimensions.
crystal malt n Class of malt prepared by stewing to convert starch in the
kernel to sugar or dextrins. Also called caramel malt.
culinary steam n Hot water vapor of a quality suitable for direct contact with
food. See process steam.
culm n Root from sprouted grain seeds.
culture 1. n Cells growing under cultivation in an artificial medium (which
could be beer wort). 2. v Prepare or perpetuate a culture (1).
508 GLOSSARY
curing n Final stage of malt drying.

current n Rate of transfer of electrical charge. Sometimes called “amperage.”
CUSUM chart n Control chart in which the cumulative sum of deviations
from the mean or from a target value is shown on the y‐axis.
cyclic adenosine monophosphate n Nucleotide comprising adenosine, ribose,
and a phosphate group attached at two points to the ribose to make a ring.
Serves as a second messenger in some flavor transduction pathways,
including those for aroma. Abbrev: cAMP.
cylindroconical adj Shaped as a cylinder mounted upon a cone with the apex
pointing down. Said of brewing vessels.
cytoplasm n Liquid material inside a cell excluding the nucleus and other
organelles.
Darcy’s law n Flow of a fluid through a permeable medium is directly propor
tional to the flow area and the pressure drop and inversely proportional to
the viscosity of the fluid and the length of the medium.
deciliter n Non‐recommended unit equal to 100 milliliters. Symbol: dL.
decline phase n Final stage in a microbial growth curve in which overall cell
death leads to a loss in cell number.
decoction n Raising the temperature of mash by boiling a portion of it and
returning the hot portion to the mash tun.
defect 1. n Property that fails to meet a quality standard. 2. n Deviation from
perfect regularity in the structure of a crystal.
degree of fermentation n Fraction or percentage of the mass of wort solids
that is converted during fermentation. Slightly lower than the fractional
real attenuation because of the loss of carbon dioxide and yeast. Also
called real degree of fermentation (RDF).
degrees Balling 1. n Mass percent solids as estimated from the obsolete
Balling scale. 2. Degree Plato. Abbrev: °B.
degrees Brix n Mass percent solids as estimated from the Brix scale, often
adapted to refractive index measurements. Equivalent in practice to
degrees Plato. Abbrev: °Bx.
degrees Oeschle n Points. Abbrev: °Oe.
degrees Plato n Mass percent total dissolved solids as estimated from the
Plato scale. Abbrev: °P.
dehydration 1. n Chemical reaction in which water is removed and a bond is
formed between two molecules to make a larger molecule or between two
parts of a molecule to make a ring. 2. n Loss or removal of water, drying.
deionize v Demineralize.
demineralize v Subject to ion exchange treatment in which undesired ions
are replaced with hydrogen ions and hydroxide ions, which combine to
yield water.
GLOSSARY 509
denature 1. v Cause protein or DNA molecules to lose their shape and func
tion as a result of high temperature, extreme pH, mechanical stress, etc. 2.
v Add a toxic or repellant substance to ethanol to make it undrinkable.
densitometer n See oscillating density meter.
density n Ratio of mass to volume.
deoxyribonucleic acid n DNA.
detector n Sensor for an analytical instrument.
detergent n Surfactant used for cleaning.
dextrin n Soluble but unfermentable carbohydrate with several sugar units
resulting from partial hydrolysis of starch. See maltodextrin, unfermenta-
ble dextrin, and dextrin malt.
dextrinase n See limit dextrinase.
dextrinizing unit n Measure of alpha‐amylase content in terms of enzymatic
activity. Abbrev: DU.
dextrin malt n A type of crystal malt that is roasted at a low pH and high
temperature to promote formation of 1,6 glycosidic bonds without devel
opment of color. Contributes body and foam stability to beer.
dextrose n Glucose (2).
diacetyl 1. n Ketone CH3C(═O)─C(═O)─CH3 that has a buttery flavor.
Official name: butanedione. 2. Informally vicinal diketone (VDK).
dial thermometer n Thermometer in which a bimetal strip arranged in a spiral
moves a pointer across a graduated dial face.
diastase n Amylase.
diastatic power n Amount of starch hydrolysis that a certain amount of malt
can produce. Abbrev: DP.
diastereomer 1. n One of a set of isomers distinguished by different configura
tions about asymmetric carbons, but that are not mirror images of
one another. 2. n One of a set of isomers with the atoms connected in the
same way but oriented differently in space that are not mirror images of one
another.
diatom n Algae with a silicon dioxide‐containing cell wall.
diatomaceous earth n Porous claylike material composed of diatom cell walls,
used as a filtration medium. Also called kielseguhr. Abbrev: DE.
differential media n Microbiological medium that provides an observable
change after a biochemical reaction induced by the presence of a specific
microorganism.
differential pressure n The difference in pressure between two parts of a
system than can drive flow, such as the pressure above and below the grain
bed in a lauter tun.
diffusion n. Spontaneous transport of matter from higher to lower
concentration.
510 GLOSSARY
dimension 1. n Type of measurable quantity, like length or speed. 2. n Length

measured in a particular direction.
dimer n Molecule consisting of two identical parts.
dimethyl sulfide n (CH3)2S, gives an off‐flavor to beer. Abbrev: DMS.
dioecious adj Having the two sexes on different individuals. Hops are dioec
ious; there are male plants and female plants.
diplo– adj Prefix: occurring in pairs. Said of bacteria.
dipole n Particle with a positive end and a negative end.
dipole–dipole interaction n Force of attraction between polar molecules.
dipole moment n Vector quantity representing the extent and direction of
polarity.
direct‐fired adj Heated by the application of flame, said of a kettle.
direct steam injection n Method of heating wort by adding superheated
culinary steam.
disaccharide n Carbohydrate with two simple sugar units.
dispersion n Forces resulting from temporary polarity.
disproportionation n Particle growth by the dissolving or evaporating of
material from small particles and the deposition of material onto larger
particles. Also called Ostwald ripening. See coalescence.
distill 1. v Purify by evaporating and condensing. 2. v Loosely, to concentrate
ethanol by any means.
dm3 n Cubic decimeter. Properly called a liter.
DNA n Deoxyribonucleic acid. Polymer of nucleotides whose sequence
codes for the amino acids in proteins.
DNA polymerase n Enzyme that adds deoxyribonucleotides to the 3′ end of
a strand of DNA.
dockage n Plant material that contaminates grain including seeds of other
plants, parts of plants other than seeds, or shriveled or broken seeds.
DON n Deoxynivalenol, mycotoxin that frequently contaminates grain. Also
called vomitoxin.
dormancy 1. n State of being dormant. 2. n Fraction of seeds that are
dormant.
dormant adj Temporarily unable to germinate; said of grain seeds.
double bond n Covalent bond formed by sharing two pairs of electrons.
draff n Brewer’s grains.
draft adj Drawn from a keg or cask, said of beer. Also spelled draught.
drauflassen v To top up a fermentation with fresh wort, commonly used to
propagate yeast due to lack of a propagation system or larger fermenter
volume as compared the brewhouse volume.
GLOSSARY 511
drunk adj Incapacitated to some extent as a result of consumption of

ethanol.
dry basis adj Corrected to reflect only the non‐water portion of the sample,
usually by dividing by (1 − wf), where wf is the mass fraction of water. Said
of an analytical result.
dry hopping n Process of adding hops to wort or beer after chilling.
dyne n Unit of force equivalent to g∙cm∙s−2 = 10−5 newtons (exactly) =
2.248 × 10−6 pound‐force (approximately).
EBC n European Brewing Convention.
electrical potential n Energy required to move a unit charge between two
points. Also called voltage.
electrode n Solid electrical conductor that makes contact with a nonmetallic
part of a circuit.
electron n Elementary negatively charged subatomic particle.
electronegativity n Tendency to attract shared electrons in a covalent bond.
electron group n Unshared pair of electrons or a bond (single, double, or
triple).
element n Substance composed of atoms with a particular atomic number.
elementary charge n Charge on a proton: 1.602 × 10−19 C.
elongation n Step of transcription or translation in which the chain length is
increased.
Embden–Meyerhof pathway n Version of glycolysis used by all organisms
higher than bacteria. Makes two molecules of pyruvic acid, two of ATP,
and two of NADH for each glucose molecule consumed.
embryo n Baby plant or animal in a seed or egg.
emmer n Early form of wheat: Triticum dicoccon.
enantiomer n One of a pair of compounds that are mirror images of one
another.
endopeptidase n Enzyme that hydrolyzes peptides in the interior of the chain.
endoplasmic reticulum n Network of tubes attached to the nucleus (3) of a
cell. Tags proteins and is involved in protein transport and secretion.
Abbrev: ER.
endoprotease n Enzyme that hydrolyses large proteins in the interior of the
protein chain.
endosperm n Part of a seed containing starch and some protein.
energy n Quantity measuring the capacity to make something move or
do work.
energy level n Value of the energy permitted by physics that a particle can
have. Particles cannot have energies between the energy levels.
512 GLOSSARY
engineering control n Design, built‐in device, or modification to reduce the

risk of injury or harmful exposure. For example, ventilation to capture and
remove dust from a mill. Contrast personal protective equipment.
enol n Compound with an ─OH group attached to a carbon atom that also
has a double bond to another carbon atom.
enriched media n Microbiological medium that encourages the growth of
some microorganisms while preventing the growth of others through the
addition of special nutrients.
enzyme n Protein that acts as a catalyst and speeds up specific chemical
reactions.
equatorial adj Directed in the plane of a ring pointing from the center to the
outside. See axial.
equilibrium n State of a system in which the rates of forward and reverse
progress are equal, so no change is evident.
equilibrium constant n Numerical value of the reaction quotient of a chemi
cal reaction at equilibrium.
equivalent 1. n Amount of a material that can provide or accept one mole of
hydrogen ions. 2. n Amount of a material that can provide or accept one
mole of elementary charge. Abbrev: Eq.
ester 1. n Organic compound that can be formed by condensation of a carbox-
ylic acid and an alcohol, releasing water. 2. n Compound that can be formed
by condensation of an alcohol with an inorganic oxyacid.
ethanol n Two carbon alcohol, CH3CH2OH, also called ethyl alcohol.
ether n Compound with C─O─C as the principal functional group.
eukaryote n Organism whose cells have a nucleus and possibly other
organelles.
European Brewing Convention n Beer standard setter for Europe. Also
applied to any of their analytical methods, especially color. Abbrev: EBC.
exopeptidase n Enzyme that hydrolyzes protein molecules at points near the
ends of the protein chains. See aminopeptidase and carboxypeptidase.
exponential 1. n Mathematical function characterized by increase or decrease
by a fixed fraction or percentage in each time period. 2. adj Increasing or
decreasing according to the exponential (1) function.
exponential phase n Second stage of a microbial growth curve where cell
division occurs rapidly, resulting in exponential increases in cell number.
extensive property n Property of a system that scales with the mass. An
example is the volume. See intensive property.
extract 1. n Soluble carbohydrates recovered from mash. 2. n Fully or partly
dehydrated beer wort. 3. n Solids content of beer or beer wort. 4. v Retrieve
or pull out.
GLOSSARY 513
eyepiece n Lens of a light microscope nearest the eye of the viewer. Also
called ocular.
facultative adj Optional. Said of organisms that can survive with or without
oxygen.
false bottom n Perforated plate to hold up grain during wort separation or
hops in a hop back.
FAN n Free amino nitrogen.
Farbebier n Very dark malt fermentation product used to adjust beer color.
fass v Transfer beer from a fermenter to a vessel or container.
fassing adj Used for or associated with transfer of beer from a fermenter.
Like a fassing centrifuge.
fat n Ester of glycerol with three fatty acids.
fatty acid n Carboxylic acid with un unbranched carbon chain, usually of four
or more carbon atoms. Natural fatty acids have even numbers of carbon
atoms.
ferment 1. v Be consumed by fermentation. 2. v Cause a material to ferment (1).
fermentability n Extent to which carbohydrates are usable by yeast.
fermentation n Energy production by microbes from a source of food without
the consumption of oxygen. See alcoholic fermentation.
fermentation, degree of n Degree of fermentation.
fermentation lock n Tube filled with liquid that allows gas out of the f ermenter
and prevents the entry of air.
fermentation vessel n Fermenter (1). Abbrev: FV.
fermented beverage n Liquid containing ethanol prepared for human con
sumption by fermentation of sugars.
fermenter 1. n Vessel in which fermentation is carried out. Also called
fermentation vessel. 2. n Any agent or substance that causes fermentation.
See fermentive organism. Also spelled fermentor.
fermentive organism n Microbe that performs fermentation, especially one
that produces desired products.
FG n Final gravity.
FIBC n Super sack. For flexible intermediate bulk container.
film boiling n Mode of boiling in which the bubbles form on the surface and
then coalesce to form a film that interferes with the transmission of heat to
the liquid.
filter 1. n Device or material used to filter (2). 2. v Remove particles from a
fluid by passing it through a medium with small holes or channels.
filtration medium n Material through which a fluid is passed to remove
particles.
514 GLOSSARY
final extract n Solids content after fermentation. Also called real extract.
final gravity n Specific gravity after fermentation.
fining n Material added to beer or wort to bind and precipitate haze‐causing
materials and to clarify the beer.
finish n Part of a bottle that makes a gas‐tight seal with the cap.
firkin n Unit of volume equal to 40.91 L = 9 imp gal. Used for casks.
fitting n Device to make a connection between one or more pipes, tubes,
valves, or other components of a fluid handling system. See pipe, tubing,
sanitary fitting, pipe fitting, compression fitting.
flash pasteurize v Pasteurize a liquid by subjecting it to a high temperature
for a short time in a flow system.
flavor 1. n Composite sensation resulting from aroma, taste, and mouth feel.
2. v Provide with flavor (1). Also spelled flavour.
flavor threshold n Lowest concentration at which a flavor compound can be
detected by aroma, taste, or mouth feel.
flavor unit n Concentration of a flavor‐active substance given in multiples of
the flavor threshold.
flocculant 1. adj Tending to flocculate. 2. n Additive that causes particles to
flocculate.
flocculate v Stick together in clumps.
flower hops n Leaf hops.
fluid n Material that flows. Liquid, gas, or slurry.
flux n Material added to lower a melting point.
fly sparge v Continuous sparge.
foam n Particles of gas in a liquid or solid matrix.
fob 1. n Foam. 2. v Emit foam. 3. v Cause to emit foam, as during packaging to
purge air from the package.
FOB detector n Foam‐on‐beer detector. Valve to prevent the flow of foam
into a beer line.
foeder [FOO‐der] n Large vessel made of wood staves. Used to ferment and
age beer. See barrel (1), cask (2).
forced carbonation n Adding carbon dioxide by introducing it under pressure.
forced fermentation n Test to determine attenuation limit. After yeast is
pitched, a sample of the mixture is subjected to constant stirring at an ele
vated fermentation temperature (typically 27 °C). The dissolved solids
content after activity stops is the unfermentable portion of the wort.
fork lift n Motor vehicle equipped with a hydraulic lift that can raise a
frame called a mask. Long narrow protrusions, called tines, extending
GLOSSARY 515
parallel to the floor, are often attached to the mask. The tines can engage
a pallet or skid and raise it off the floor or shelf to transport it. Also
called a fork truck.
formal charge n Fictive electric charge calculated by allocating shared
electrons equally between the two bound atoms.
formula n Representation of a molecule or compound using the symbols
for the elements in it with subscripts to show how many atoms of each
element are in a unit of the compound.
fouling n Accumulation of solid deposits on a surface, interfering with the
function of the device.
foundation water n Water added to cover the false bottom of a lauter tun or
mash tun (2) before mash is added.
free amino nitrogen n Concentration of nitrogen from amino acids not includ
ing proline and di‐ and tripeptides that cannot be assimilated by yeast.
Some testing methods also include ammonia and inorganic ammonium
compounds, in which case the result is properly called yeast assimilable
nitrogen. Abbrev: FAN.
free radical n Atom, molecule, or ion with an unpaired electron.
freezing point depression n Lowering of the melting point of a substance by
the presence of a dissolved material.
fresh hops n Whole hop strobiles that have not been dried.
friabilimeter n Instrument to measure malt friability.
friability n Tendency to crumble into small pieces under pressure.
full mash adj Following a process to make beer starting with preparation of
wort by mashing malt in hot water.
functional group n Group of atoms that give a molecule characteristic behav
ior or properties.
fungus n Member of a eukaryotic kingdom characterized by the presence of
chitin in the cell wall. pl fungi.
fusarium head blight n Fungal disease of grain. Produces DON, a mycotoxin.
Infested malt may cause gushing in the beer. Also called head scab.
fused quartz n Glass made from pure silicon dioxide. Used in high tempera-
ture applications.
fusel alcohol n Any alcohol with three or more carbon atoms found in an
alcoholic beverage. Also called higher alcohol.
FV n Fermentation vessel.
galactose n Specific aldohexose.
gas 1. n Fluid phase of matter that expands to fill its container. 2. n Substance
above its critical pressure but below its critical temperature. See vapor.
516 GLOSSARY
gas chromatograph n Instrument to analyze mixtures of substances that can

evaporate by allowing them to separate on a packed or coated column.
gas law n Any of several equations that relate volume, pressure, temperature,
and/or amount of a sample of gas.
gate valve n Valve with a plate or wedge that slides in and out of the flow path
at right angles to the flow direction. Usually used only in the full open or
closed positions.
gelatin n Hydrolyzed form of collagen often derived from animal skin or
bones. Used as a fining.
gelatinize v Cause the absorption of water between the chains of molecules
of substances made up of long chains, like starches or proteins.
gene n Part of a DNA molecule that carries the code for a single protein.
gene expression n Process of transcription of a gene and translation into a
protein.
gene regulation n Inhibition or enhancement of gene expression.
geometric isomer n One of a set of isomers distinguished by the arrangement
of groups on the same side or across from one another with reference to
some feature of the molecule. An example would be the cis‐ and trans‐
forms of some compounds with double bonds.
geometry n Underlying geometry.
germinate v Begin to grow.
germinative capacity n Ability of seeds to germinate eventually. Live seeds
have germinative capacity even if they are dormant.
germinative energy n Ability of seeds to germinate vigorously. Seeds that are
dead or dormant lack germinative energy.
gibberellin n Plant growth hormone.
glass 1. n Brittle, transparent, noncrystalline mixture of silicon dioxide and
other oxides. 2. n Any noncrystalline solid that softens without a definite
melting point as the temperature is increased.
glass electrode n Electrode with a special glass envelope making it selective
for the hydrogen ion. Used in sensors of pH meters.
glassy adj Steely.
globe valve n Valve in which fluid flows through a port that can be covered
with a plug that can be moved into or out of the port by a rod called the
stem. See needle valve.
glucan 1. n Any compound made by connecting glucose molecules with
glycosidic links. 2. n (informal) Beta‐glucan gum.
glucoamylase n See amyloglucosidase.
glucose 1. n A aldose sugar, C6H12O6 in a specific form. 2. n One of the
enantiomers of glucose (1), d‐glucose, which is found in living cells.
GLOSSARY 517
gluten 1. n Mixture of storage proteins in seeds of grassy plants such as wheat,

barley, oats, and rye. 2. n Protein or fragment that causes an adverse reac
tion in persons with celiac disease.
glycerol n Organic compound C3H8O3, an alcohol with an ─OH group bound
to each carbon atom. Used to prevent damage to cells during freezing of
cultures.
glycogen n Starch chain with branches every 10–12 glucose units. Used to
store energy by animals and fungi.
glycol 1. n Organic compound with two hydroxyl groups on adjacent carbon
atoms. 2. n Ethylene glycol, officially named 1,2‐ethanediol. 3. n (informal)
Heat transfer fluid consisting of ethylene glycol or propylene glycol dis
solved in water.
glycolysis n Pathway to convert glucose to pyruvic acid. ATP and NADH are
produced.
glycoprotein n A class of protein to which an oligosaccharide chain is cova-
lently attached.
glycosidic link n Bond between an anomeric carbon atom on a carbohydrate
molecule and an ─OR group.
Golgi apparatus n Organelle consisting of stacks of membrane‐bound com
partments. Facilitates posttranslational modification of newly formed pro-
tein molecules.
grain 1. n Dry edible seed. Also called corn. 2. n Plant grown for grain (1).
gram stain n Staining technique for the characterization of bacteria. Gram
positive bacteria have a thick, external peptidoglycan layer in the cell wall
and stain purple. Gram negative bacteria have a thin internal peptidogly
can layer and stain pink.
grant n Vessel that holds the fluid output of another vessel at atmospheric
pressure prior to the transfer to another vessel or a pump. Prevents the
application of excessive suction to the first vessel. Often used to receive
the output of a lauter tun. Also called underback.
gravity 1. n (informal) Specific gravity. 2. n (very informal) Wort solids
content.
green beer n Beer before conditioning, also called ruh beer.
green hops n Fresh hops.
green malt n Malt that has been steeped and germinated, but not dried.
grist n Crushed grain.
grist case n Vessel for holding dry grist from the mill and delivering it to the
mash tun.
grits n Milled grain with particle size between 0.25 and 1.25 mm.
group 1. n Column of the periodic table. 2. n Functional group.
518 GLOSSARY
growth medium n Substance prepared to support the growth of certain types

of microorganisms. pl growth media.
gruit n Mixture of herbs formerly used to flavor beer.
gum n Non‐starch, water‐soluble polysaccharide that can cause a large
increase in viscosity.
gushing n Premature or excessive release of dissolved gas from beer.
HACCP n Hazard analysis and critical control points. Set of procedures
designed to minimize the risk of unsafe defects in food and beverages.
Also used to minimize risk of nonhazardous defects.
half‐reaction n Oxidation portion or reduction portion of an oxidation–
reduction reaction.
Hall–Heroult process n Electrochemical method to make aluminum metal
from aluminum oxide.
hammer mill n Device to break up a material to small particles using rotating
metal bars called hammers. Most have a device, such as a screen, to allow
the release of sufficiently small particles while retaining particles that
require additional milling.
hard 1. adj Resistant to scratching and piercing. 2. adj Having a high concen-
tration of calcium, magnesium, or other ions with an electrical charge of +2
or more, said of water. 3. adj Containing ethanol, said of a beverage.
haze n Cloudiness.
head 1. n Foam on a serving of beer. 2. n Seed‐bearing part of a grain plant. 3.
v Develop a head (2).
head retention n Stability of foam on beer.
headspace 1. n Space in a filled container that is not actually occupied by
liquid. 2. adj Regarding the gas or vapor in the headspace (1). See ullage.
heat 1. n Energy that flows from a region of high temperature to a region of
lower temperature. Not to be mistaken for temperature. 2. v Provide or
apply heat (1).
heat capacity n Amount of energy needed to increase the temperature of an
object by 1 °C. See molar heat capacity, specific heat capacity.
heat exchanger n Device to transfer heat from one fluid to another.
heat of fusion n Energy needed to melt a specific quantity of a substance.
Also called latent heat of fusion.
heat of vaporization n Energy needed to convert a specific quantity of a sub
stance from liquid to gas or vapor. Also called latent heat of vaporization.
hectoliter n Unit of volume equal to 0.1 cubic meter (100 L). Used in brewing,
but otherwise not recommended.
hedonistic 1. adj Judgment based on liking or disliking. 2. adj Concerned with
pursuit of pleasure.
GLOSSARY 519
helical adj Having the shape of a helix.

helicase n Enzyme that separates paired strands of DNA.
helix n Twisted, corkscrew shape. pl helices.
hematite n Geological term for iron(III) oxide (Fe2O3).
hemiacetal n Product of the reaction of an aldehyde with an alcohol.
hemicellulose n A polysaccharide that can contain many different monomers
including glucose, xylose, arabinose, galactose, and mannose. A main com
ponent of the endosperm cell wall in barley.
hemiketal n Product of the reaction of a ketone with an alcohol.
hemocytometer n Thin transparent chamber into which a liquid can be
injected to a precise depth. The bottom of the device has lines defining a
grid pattern with precise dimensions. Used in a microscope to count cells
in a known volume of liquid. Also spelled haemocytometer.
Henry’s law n Gas dissolves in proportion to its pressure at the surface of a
liquid.
HEPA adj Capable of removing 99.97% of particles larger than 300 nm. Said
of a filter. For high efficiency particulate air.
heteroatom n Atom other than carbon and hydrogen covalently bound in an
organic molecule.
heterofermentive adj Producing more than one fermentation product. See
homofermentive.
heterogenous adj Having regions, called phases, with different compositions
or properties.
hexose n Sugar with six carbon atoms.
higher alcohol n Any alcohol with three or more carbon atoms found in an
alcoholic beverage.
high gravity adj Regarding a brewing technique in which wort is made and
processed at substantially higher original extract than indicated by the
desired strength of the beer. The resulting strong beer is diluted with deaer
ated water to bring it to the desired ethanol concentration. This method
can make more beer without increasing the volume or number of vessels.
histogram n Bar chart showing a frequency distribution. The horizontal
axis shows ranges of outcomes, and the vertical axis shows number of
occurrences.
homofermentive adj Producing a single fermentation product. See
heterofermentive.
homogenous adj Displaying the same composition and properties in all
regions down to the molecular level.
hop 1. n Plant, Humulus lupulus, whose strobiles (cone‐like fruits) are used to
flavor beer. 2. v Add hops to, as “beer hopped with Citra.” See hops.
520 GLOSSARY
hop back n Straining device using hops as a filtering medium.

hop cannon n Device for delivery and dispersal of hops into beer via pressur
ized ejection.
hop creep n Secondary fermentation of beer observed after dry hopping as a
result of the introduction of glucoamylase from hops.
hop doser n Any of several types of devices to introduce and disperse hops or
hop products into wort or beer at some stage of brewing. Many are named
after weapons.
hop jack n Hop back.
hopped wort n Wort that has been treated with hops.
hops n Strobiles (cone‐like fruits) of the hop plant. Used to flavor beer.
hop utilization n Fraction of a desired component or derivative of hops, usu
ally iso‐alpha acids, that survives in the beer.
hordein n Storage protein in barley. Also the specific name of a gluten protein
in the barley plant.
Hordeum vulgare n Common barley.
hormone n Compound used by one part of an organism to signal other parts
of the organism.
hot break n Protein and other solids that precipitate from wort during boil
ing. See trub.
hot liquor tank n Vessel for holding or heating the hot water that will be used
in the brewing process, especially the water for mashing and sparging.
hot water extract n Measure of malt extract potential reported in points ×
liters per kilogram of malt.
huangjiu n Chinese beer style made from rice.
hull n Woody outer covering of a seed. Also called glume.
humulone n Principal alpha acid produced by hop strobiles.
Humulus lupulus n Botanical name for the hop.
hydrate 1. n Compound whose formula includes one or more water molecules.
2. v React by the addition of water to a compound.
hydrated adj Surrounded by water molecules.
hydrocarbon n Compound with only hydrogen and carbon.
hydrogen bond n Force of attraction between a hydrogen atom bound to an
N, O, or F atom and an unshared pair of electrons on another molecule
(or on a remote place on the same molecule).
hydrolyze v Add a water molecule across a bond in a larger molecule resulting
in two smaller molecules.
hydrometer n Instrument to measure density or specific gravity of a liquid by
how high it floats in the liquid.
GLOSSARY 521
hydronium ion n H3O+ ion. Signature of an acid in water.

hydrophilic adj Polar, charged, or hydrogen bonding, said of a molecule or a
region of a molecule.
hydrophobic adj Nonpolar, said of a molecule or a region of a molecule.
hydrophobic force n Tendency for hydrophobic molecules or regions of mol
ecules to repel water, other highly polar compounds, or hydrophilic regions
of molecules.
hydrophobin n Highly hydrophobic polypeptide produced by certain fungi.
hydroxyl group n ─OH group.
hypothesis n Proposed explanation for an observation. pl hypotheses.
IBU n Bitterness unit.
ideal gas law n Equation relating pressure, volume, temperature, and amount
(moles) of a gas under moderate conditions of temperature and pressure.
Abbrev: IGL.
IKE n Isomerized kettle extract.
Imhoff cone n A long, transparent conical cup with volumetric gradations
used to quantify sedimentation.
immersion lens n Light microscope objective lens designed for use with
immersion oil.
immersion oil n Liquid with a high refractive index (typically >1.5) that occu
pies the space between the objective lens and the sample to enhance the
numerical aperture.
in n Square inch (6.452 cm2).
2
indicator n Compound whose color depends on pH.

induced fit n Mechanism of enzyme function in which binding of the reactant
molecule causes a change in the shape of the enzyme molecule.
inebriated adj Drunk.
infrared adj Having a wavelength in the range of 700 nm to 1 mm. Said of light.
infusion mashing n Mashing without raising the mash temperature.
initiation n First step of transcription or translation process.
in‐line adj Located and installed to allow continuous measurement of some
property of the contents of a vessel, pipe, or other conduit. Said of an ana
lytical instrument or procedure.
inoculate v Transfer a sample of microbes to medium in a container.
inoculation loop n Tool with a loop to transfer samples of microbes. The loop
can be wire, in which case it is flame sterilized before each use, or single‐
use sterile plastic.
intensive property n Property of the system that is unchanged by the size of
the system. An example is temperature. If two 1 kg samples of water each
522 GLOSSARY
at 40 °C are combined, the combined system still has a temperature of

40 °C. See extensive property.
interface n Location where one phase of material meets another phase or
vacuum. See surface.
interfacial tension n Energy needed to make a unit area of interface. Usually
applied to interfaces not involving gas or vacuum.
intermolecular force n Force attracting ions or electrically neutral molecules
toward one another.
international bitterness unit n Bitterness unit. Abbrev: IBU.
intoxicated adj Drunk.
iodine test n Test for starch by treating a sample with iodine dissolved in
potassium iodide solution. Amylose shows a blue‐black color; amylopectin
shows blue with a slight red cast; large dextrin molecules show a red color.
Small dextrins and polypeptides give no reaction.
ion n Electrically charged particle.
ion–dipole force n Intermolecular force between polar molecules and
dissolved ions.
ion exchange n Method to soften or purify water by replacement of
undesirable ions with acceptable ions.
ionic adj Having or caused by charged particles.
ionic bond n Chemical bond resulting from force of attraction between a
positive ion and a negative ion.
Irish moss n Seaweed: Chondrus crispus. Natural source of carrageenan.
isinglass n Collagen derived from fish swim bladders. Used as finings.
iso‐alpha acid n Bitter isomerization product of an alpha acid.
isoelectric point n pH at which the electric charge on a molecule is, on aver
age, neutral.
isohumulone n Bitter, soluble isomer of humulone formed during boiling.
isomer n One of a set of compounds with the same number of each type of
atom and distinguished by differences in structure or geometry.
isomerize v Change the form or structure of a molecule without adding or
removing any atoms.
isomerized kettle extract n Hop extract that has been pre‐isomerized intended
for addition to the boiling kettle to adjust bitterness. Abbrev: IKE.
isotope n Version of an element with a particular number of neutrons.
jockey box n Temporary beer dispense system in which beer is driven from a
keg by gas pressure and through a heat exchanger in a box of ice water.
joule n SI unit of energy equal to kg∙m2∙s−2.
keg n Metal cylinder for transporting and serving beer. Has one opening and
a dip tube.
GLOSSARY 523
keg coupling n Valve to connect a keg to beer dispensing lines and a source
of gas.
ketone n Compound with a carbonyl group attached to two carbon atoms
(and no hydrogen).
ketose n Monosaccharide originating as a ketone.
kettle n Vessel for boiling wort, also called copper.
keystone n Fitting for the hole on the end of a cask to accept a valve.
kieselguhr n Diatomaceous earth.
kilderkin n Unit of volume equal to 81.83 L = 18 imp gal. Used for casks.
kiln 1. n Furnace or oven. 2. v Heat a material in a kiln (1).
knock out 1. v Transfer wort from the kettle at the end of boiling. 2. v Eliminate
or deactivate a specific gene. 3. n (loosely) Procedures after boiling and
before fermentation.
koji n Mold: Aspergillus oryzae. Used to provide amylases to hydrolyze rice
starch for sake and similar beverages.
Kolbach index n S/T ratio.
kosher adj Compatible with Jewish dietary laws.
krausen n The rocky heads of foam produced during fermentation. 2. v Add
actively fermenting wort, rich in active yeast, to another fermentation such
as before bottling to aid in carbonation [Ger. ruffle].
krausen ring n Brandhefe.
kvass n Eastern European beer made from bread.
lacing n Fragments of beer foam adhering to the sides of a glass after the beer
is consumed.
lager 1. v To condition beer at low temperature for several weeks or months.
2. n Lager beer.
lag phase n First stage of a microbial growth curve where yeast or bacteria
assimilate nutrients and prepare for cell division. There is no change in cell
number during this stage.
lager beer n Beer fermented at temperatures below 60 °F (15 °C) typically
with Saccharomyces pastorianus.
lambic n Belgian style of ale made with naturally occurring bacteria and
yeast.
lamella n A thin layer or membrane that is part of the endosperm cell wall. In
barley, the outer layer is rich in hemicellulose, beta‐glucan, and ferulic acid
with a middle layer rich in proteins.
laminar adj Occurring in parallel layers. Said of fluid flow. See turbulent.
Laplace law n Law of physics that the pressure inside a bubble or droplet is
higher than that on the outside by a factor proportional to the reciprocal
of the radius of the bubble or droplet. Because of the very high pressure
524 GLOSSARY
inside a very small bubble, bubbles form only with difficulty without a
nucleation site. Also called Young–Laplace equation.
latent heat n Heat absorbed or released at constant temperature as a result of
a phase change.
lauter 1. adj For the purpose of or having been subjected to the lauter process.
2. n (informal) Lauter tun. 3. v Subject to the lauter process.
lauter process n Method of wort separation using the grain as a filter medium.
lauter tun n Vessel for the lauter process.
leaf hops n Dried whole hop strobiles. Also called cone hops and flower hops.
Le Chatelier’s principle n When a system at equilibrium is subjected to a
change, like a change in pressure, temperature, or concentration, the sys
tem will shift to a new equilibrium that partly offsets the change.
Lewis structure n Structural formula for a compound showing atoms with
their symbols and shared pairs of valence electrons as lines. Unshared
valence electrons may be shown as dots.
ligand 1. n Ion or molecule that provides an unshared pair of electrons form
ing a covalent bond to a metal atom forming a complex ion or coordina
tion compound. 2. n A small molecule that binds to a protein, usually by
intermolecular (noncovalent) interaction.
light beer n Beer brewed to have a low concentration of carbohydrate after
fermentation but with the same or slightly lower ethanol content than
standard beer.
lightstruck adj Off‐flavor in beer resulting from exposure to light. Also called
skunked.
limit dextrinase n Enzyme that catalyzes the hydrolysis of alpha(1→6)
glycosidic bonds. Also called pullulanase.
linear 1. adj Forming a straight line. 2. adj Providing an output or response
that can be related to the input by the equation of a line.
lipid n Family of biological compounds whose molecules are at least partly
hydrophobic.
lipid bilayer n Filmlike structure comprising two layers of molecules with
polar heads and nonpolar tails. The molecules in each layer are organized
with nonpolar regions pointed to the other layer and polar regions directed
away from the other layer. Lipid bilayers are the main structural element
in membranes.
lipid raft n Region of a membrane with a high concentration of sterols. Serves
as an anchor point for proteins.
lipoxygenase n Type of enzyme that causes an unsaturated fat to react with
oxygen.
liquefaction n Hydrolysis of starch into water‐soluble molecules. Also called
liquefication.
GLOSSARY 525
liquor n Water for mashing and sparging.

liter n Unit of volume equal to 0.001 cubic meters. Symbol: L. Sometimes
called “cubic decimeter.”
load cell n Transducer for measuring force. Often used to measure the mass
of the contents of a vessel.
lock out v Secure a device to prevent unwanted actuation or release of stored
energy to allow safe maintenance or repair.
lockout 1. n Mechanism to deny access to the controls of a device that has
been locked out. Normally the key to the lockout is held by the person
performing the service for which locking out was occasioned. 2. n Status of
having been locked out, as “the mill is on lockout.”
log phase n Exponential phase.
lone pair n Unshared pair.
Lovibond n Color scale used for beer and other foods.
luminometer n Instrument for measuring ATP bioluminescence.
lupulin n Sticky yellow powder produced by hop strobiles. Source of beer
flavor compounds.
lupulone 1. n A specific beta acid, C26H38O4. 2. n Any beta acid.
lysosome n Organelle containing hydrolysis enzymes that degrade a variety
of biopolymers.
macromolecule 1. n Molecule with many atoms. 2. n (informal) Substance or
material composed of macromolecules (1).
Maillard reaction n Reaction starting with the formation of a Schiff base from
a sugar and an amino acid. Can form large highly colored melanoidin
molecules or smaller highly flavored molecules.
main group n Any of the eight columns of the periodic table comprising the
first two and the last six columns.
maize n Zea mays, a grain called “corn” in the United States.
malt 1. n Sprouted and dried grain. 2. v Prepare malt (1) from grain.
malt extract n Solid or syrup obtained by concentrating wort prepared from
grain malt.
malt liquor n Beer brewed to have a low concentration of carbohydrate
after fermentation and with slightly higher ethanol content than standard
beer.
maltodextrin n Unfermentable additive of hydrolyzed starch consisting
mostly of short polymers of alpha(1→4) linked glucose.
maltose n Sugar made of two glucose units connected by an alpha(1→4) link.
maltotriose n Sugar made of three glucose units connected by alpha(1→4)
links.
maltster n Person or institution that makes malt.
526 GLOSSARY
manifold n System of pipes, tubes, or other conduits in which one main con
duit is connected to two or more secondary conduits.
mannose n A six‐carbon aldose in a specific form.
manometer n Device that measures pressure by the height of a column of
liquid.
manway n Large enough opening to admit a person to the interior of a vessel.
See confined space.
mash 1. v Treat milled malt and other starchy materials with hot water to
allow enzymes to hydrolyze the starch to sugar. 2. n Slurry of water and
milled grain.
mash conversion vessel n Vessel for mashing. Abbrev: MCV.
masher n Premasher.
mash filter n Device for wort separation by driving the wort through filters.
mash in v Mix water with grist to begin mashing.
mash‐in temperature n Temperature of mash (2) after mashing in. See striking
temperature.
mash thickness 1. n Ratio of mass of water to mass of grist in mashing. This is
the preferred definition in commercial brewing. 2. n Ratio of mass of grist
to volume of water in mashing.
mash tun 1. n Mash conversion vessel. 2. n (chiefly British) Mash conversion
vessel specifically with a false bottom so it can also be used for the lauter
process.
mass fraction n Mass of a component divided by the mass of the entire s ample.
Can be applied to the elements in a compound or to the components of a
mixture.
MBT n 3‐Methylbut‐2‐ene‐1‐thiol. Gives lightstruck beer a skunky flavor.
MCV n Mash conversion vessel.
mead n Alcoholic beverage made from fermented honey.
mealy adj Made porous by modification. Said of malt kernels. See glassy.
mean n Average.
mechanism 1. n Sequence of elementary steps accounting for a chemical
reaction. 2. n Scientific doctrine holding that life processes can be accounted
for by the normal laws of physics and chemistry. See vitalism.
medium 1. n Growth medium. 2. n Filtration medium. pl media.
melanoidin n Highly colored compounds made up of large polymers pro
duced from sugars and amino acids by the Maillard reaction.
membrane 1. n Thin film. 2. n Thin film surrounding a cell or structure
within a cell consisting of a lipid bilayer with attached protein
molecules.
GLOSSARY 527
membrane filter n Filtration medium consisting of a thin plastic film with

pores of a controlled size. Used to clarify samples before measurement of
light transmittance and to remove or collect microbes from a fluid.
meniscus 1. n Curved surface made by a liquid climbing up a surface with
which it is in contact. 2. n Something with a crescent shape.
metal n Element with loosely held electrons. Typically has luster and high
electrical and thermal conductivity and can often be bent or shaped with
out cracking. Metals often react by losing electrons to give positive ions.
metallic luster n Shininess in metals.
metalloid n Element with some properties characteristic of metals and some
properties characteristic of nonmetals.
methylene blue n Blue dye used to assess viability of yeast cells. Live cells
decolor the dye; dead cells remain blue.
microbe n Microscopic organism such as bacteria or yeast.
microbial filtration n Filtration to remove live microbes.
micropyle n Small opening in a seed or other structure.
microRNA n Type of small regulatory RNA with about 22 nucleotides
arranged in a hairpin conformation. Abbrev: miRNA.
microscope n Instrument to visualize very small objects.
mill 1. n Device to crush or grind a material. 2. v Mechanically grind or crush
a material.
miRNA n MicroRNA.
mitochondrion n Organelle responsible for production of ATP by aerobic
respiration. pl mitochondria.
mixture n Material with two or more substances not chemically bound to one
another.
modification n Changes that a grain undergoes during malting.
molar concentration n Number of moles of a component of a solution divided
by the volume of the solution in liters. Also called molarity.
molar heat capacity n Energy needed to raise the temperature of one mole of
a pure substance by 1 °C.
molarity n Molar concentration.
molar mass n Mass of one mole of an element or compound.
mole n Amount of a substance containing 6.022 05 × 1023 particles or formula units.
molecule n Group of atoms that are much more tightly bound to one another
than to any other atoms. As a result, they travel together as one dis
tinguishable particle.
monomer n One of many structurally related units that are or can be
connected to make a large molecule. See polymer.
528 GLOSSARY
monosaccharide n Simple sugar. Aldehyde or ketone with three or more

carbon atoms and an ─OH group on all non‐carbonyl carbons or
the hemiacetal or hemiketal resulting from internal addition of one of the
─OH groups across the C═O bond.
montejus n Hop back.
morphology n Shape of an organism.
mouth feel n Component of flavor resulting from heat, cold, texture, or irrita
tion of sensory cells in the mouth.
mRNA n RNA that serves as a template for synthesis of proteins and other
polypeptides. For messenger RNA.
must n Fruit juice, especially grape juice, intended for fermentation into wine.
mutation n Change in a DNA or RNA sequence in which one or more nucle-
otides are substituted, deleted, or added.
mycotoxin n Toxic substance produced by fungus. Potential contaminant in
grain.
NAD n see nicotinamide adenosine dinucleotide.
NADH n see nicotinamide adenosine dinucleotide.
near infrared n Light whose wavelength is slightly longer than what can be
seen with the eyes.
Neck n Sort tube attached to the outside of the opening of a keg to accom
modate the spear.
needle valve n Valve with a small orifice and an extremely narrow and tapered
plug to give a high degree of control of the flow rate.
nephelometer n Instrument to quantify turbidity by measuring light scattered
at an angle, usually 90° from the incident light.
neuron n Nerve cell.
neurotransmitter n Compound that carries signals to or from neurons.
neutral 1. adj Without net positive or negative electrical charge. 2. adj Neither
acidic nor basic.
neutron n Electrically neutral elementary subatomic particle. Found in atomic
nucleus.
newton n SI unit of force = kg∙m∙s−2. Symbol: N.
nicotinamide adenosine dinucleotide (NAD) n Molecule involved in redox
reactions, such as fermentation, by which an electron is carried from one reac-
tion to another, found in two forms; NAD+ is oxidized and NADH is reduced.
nip point n Location where a rotating part of a machine can trap and injure a
body part.
nitrogenated adj Containing dissolved nitrogen (typically about 20 mg/L for
nitrogenated beer). Also called nitrogenized.
GLOSSARY 529
nitrosamine n Compound containing the R2N─N═O group. Carcinogen that

sometimes occurs in malt.
noble gas n Chemical element in group 8A.
node n Joint in a plant.
nonmetal n Element that holds its electrons tightly. Nonmetals often react by
gaining electrons to give negative ions or by forming covalent bonds.
normal distribution n Mathematical function describing the outcomes of
many processes such as fabrication, filling, and measurement in which the
outcome is continuous, that is, it can take any value. Characterized by a
bell‐shaped curve. Also called the Gaussian distribution.
normally closed 1. adj Of a valve: allows flow when electric current or air
pressure is applied to the actuator. Blocks flow otherwise. 2. adj Of a relay:
blocks flow of electric current in the main circuit when current is applied
to the control circuit. Allows current otherwise.
normally open 1. adj Of a valve: blocks flow when electric current or air
pressure is applied to the actuator. Allows flow otherwise. 2. adj Of a relay:
allows flow of electric current in the main circuit when current is applied
to the control circuit. Blocks current otherwise.
NPT 1. n American National Pipe Thread system of standards for tapered
threading on pipes and fittings. 2. adj Following the NPT (1) standards.
nuclear envelope n Membrane surrounding the nucleus in a eukaryote.
nuclear pore complex n Proteins that form channels in the nuclear
envelope.
nucleate boiling n Mode of boiling in which individual bubbles form on and
break away from the surface. See film boiling.
nucleation site n Particle or other feature that attracts dissolved molecules
and allows them to come out of solution.
nucleobase n One of the nitrogen‐ and oxygen‐containing cyclic com
pounds – adenine, cytosine, guanine, thymine, or uracil – that occur in
DNA or RNA. Also called “base” or “nitrogenous base.”
nucleolus n Structure within the nucleus in which ribosomes are made.
nucleotide n Compound with a ribose or deoxyribose phosphate ester in
which one of the ribose hydroxyl groups has been replaced with a bond to
a nitrogen atom on a platelike molecule called a nucleobase.
nucleus 1. n Positively charged particle at the center of an atom. 2. Nucleation
site. 3. n Membrane‐enclosed region of certain cells containing genetic
material.
null hypothesis n Assumption that measurements or observations do not dif
fer significantly from the reference population. If the null hypothesis can
be shown to have a sufficiently low probability, it is rejected.
530 GLOSSARY
numerical aperture n Measure of the light‐gathering power of a microscope

objective lens.
nutrient media n General purpose broth or agar that contains sufficient
nutrients to support growth of a wide range of microorganisms.
oast n Kiln for drying hops.
objective n Microscope lens nearest the sample.
obligate adj Of necessity, said of aerobic and anaerobic microbes. See
facultative.
OE n Original extract.
off‐flavor n Undesired flavor.
off‐line adj Requiring samples to be carried to a laboratory away from the
process location. Said of an analytical instrument or procedure.
OG n Original gravity.
olfactory adj Related to the sense of smell.
olfactory bulb n Part of the brain that processes aroma sensations.
oligosaccharide n A molecule with 3–10 sugar units connected by glycosidic
links, usually without branches.
on‐line adj Located and installed to allow process operators to make frequent
measurements near the process location. Said of an analytical instrument
or procedure.
opaque beer n African family of beer styles often made with sorghum and
consumed during active fermentation.
optical axis n Imaginary line passing through the centers of the lenses of an
optical device.
OPV n Overpressure valve. See relief valve.
organelle 1. n Membrane‐bound functional structure within a cell. 2. n Any
specialized functional structure within a cell.
organic 1. adj Having carbon–carbon or carbon–hydrogen bonds. 2. adj
Prepared without artificial fertilizers, pesticides, additives, or ingredients.
Said of food.
organic chemistry n Behavior, synthesis, and study of organic (1) compounds.
organoleptic adj Involving qualities that make use of the sense organs (eyes,
ears, tongue, skin, and nose).
original extract n Mass percent solids in wort before fermentation.
original gravity n Specific gravity of wort before fermentation.
oscillating density meter n Instrument used for the measurement of density,
particularly for wort, which consists of a U‐shaped tube filled with sample.
The tube is made to vibrate, and the resonant frequency is measured.
The vibrational frequency depends on the sample mass and can be used to
infer density.
GLOSSARY 531
osmosis n The transfer of molecules through the pores of a membrane that

can allow some molecules to pass but blocks others. See reverse osmosis.
osmotic pressure n Magnitude of pressure that stops flow through a
semipermeable membrane.
osmotic stress n Physiological problems in a cell caused by a change in the
concentration of dissolved substances outside the cell membrane.
oxidase n Enzyme that catalyzes oxidation reactions. The presence or absence
of cytochrome C oxidase is used to characterize bacteria and their ability
to undergo aerobic respiration.
oxidation n Chemical reaction in which electrons are a product.
oxidation number n Fictive electric charge determined by allocating all
electrons shared by two atoms to the more electronegative of the pair.
If the atoms are of the same element, the shared electrons are divided
evenly.
oxidized adj Having given up electrons.
oxidizer n Substance that accepts electrons, causing another substance to
become oxidized. Also called oxidizing agent.
oxonium ion n Ion with the formula R3O+, where the R’s can be hydrogen
atoms, alkyl groups, or a combination of both.
oxyacid n Inorganic acid containing oxygen. Usually the acidic hydrogen
atoms are in hydroxyl groups.
packing 1. n Part of a valve that prevents escape of fluid through the stem. 2.
n Powder used as a stationary phase in chromatography.
pallet n Flat structure with an upper and lower deck for supporting and trans
porting boxes, barrels, or other freestanding containers. Often handled
with a fork truck. See skid.
papain [pa PAY en] n Protein‐hydrolyzing enzyme from papaya fruit. Used as
a fining.
Paraflow n (chiefly British) Plate heat exchanger; a trade name.
partial pressure n Pressure that a component of a gas mixture would exert if
it were the only gas in the container.
particle size distribution n Fraction of material whose particle diameters fall
into each of a series of ranges.
pasteurization unit n Unit of intensity of pasteurization equivalent to the
lethality of one minute of treatment at 60 °C. The application of the
term is complicated because different microbes have different sensitivi
ties to pasteurization, and the degree of lethality is not linear with
temperature.
pasteurize v Preserve foods by heating (typically to about 63 °C = 145 °F) to
kill microbes. See flash pasteurization.
pathogenic adj Causing disease.
532 GLOSSARY
PBS n Phosphate‐buffered saline. Saline solution with fixed pH used for

diluting cell cultures.
PCR n Polymerase chain reaction. Process to amplify pieces of DNA of a
specific sequence as defined by a set of primers (short sequences comple
mentary to the target). See thermal cycler.
pellicle n Thin film produced by bacteria on top of a fermenting liquid.
pentosan n Structural polysaccharide made up of pentoses. Typically found in
plants.
pentose n Monosaccharide with five carbon atoms.
peptidase n Enzyme that breaks the chains of protein molecules.
peptide n Polymer of 50 or fewer amino acids.
period 1. n Row of the periodic table. 2. n Accessible energy states for elements
in a row of the periodic table. 3. n Amount of time required for an oscilla
tor or a wave to make one complete oscillation.
periodic table n Chart of chemical elements in order of atomic number and
organized in columns by the number of valence electrons.
perlite n Filter medium prepared from hydrated volcanic glass.
permanent hardness n Hardness in water that is not removed by boiling.
permeability n Measure of the extent to which an object can transmit fluids.
permeation n Penetration of a solid barrier by a gas or liquid.
peroxide n Compound with ─O─O─ functionality.
peroxisome n Organelle involved in breaking down lipids and reduction of
reactive oxygen species.
personal protective equipment n Items worn by an individual to provide
protection against workplace hazards. Some examples common in brew-
ing are eye and face protection, gloves, hearing protection, hard hats, and
protective shoes. Abbrev: PPE.
Petri dish n Shallow flat bowl used to culture microbes.
PGA n Propylene glycol alginate.
pH n Measure of the acidity or basicity of a solution. More acidity gives a
lower pH, more basicity gives a higher pH.
phase n Region of a sample with a particular composition and properties.
phase diagram n Chart showing points at which phases of pure materials or
mixtures exist at equilibrium. When there are many such points, they
form lines or surfaces called phase boundaries. Phase diagrams for pure
substances conventionally have the temperature on the horizontal axis
and pressure on the vertical axis.
pH electrode n Glass electrode.
phenol 1. n Compound C6H5OH. 2. n Family of compounds with an ─OH
group directly attached to an aromatic ring.
GLOSSARY 533
pH meter n Electrochemical device to measure pH in water solutions.

phosphate 1. n PO43− ion. 2. n Compound containing the ─OPO(OH)2 group
or one if its ions.
phospholipid n Biological compound whose molecules include a phosphorus‐
containing group to which two hydrophobic hydrocarbon chains are
attached.
photon n Smallest unit of light.
pH paper n Paper impregnated with pH indicators. Compared to a color scale
to estimate pH.
PIKE n Isomerized hop extract that has been neutralized with potassium
hydroxide (KOH) to improve solubility.
pin n Unit of volume equal to 20.46 L = 4.5 imp. gal. Used for casks.
pipe n Rigid, hollow, cylindrical tube of standardized inside and outside diam
eter used to convey fluids. The nominal size of pipe is the inside diameter.
See tubing.
pipe fitting n Threaded connector that makes a joint between parts of a fluid
handling system. The seal is made by driving the threads together, some
times with a flexible sealing material between the outside and inside threads.
pipe scale n Hard deposits adhering to the insides of conduits and vessels.
pitch 1. v Add yeast to wort to begin fermentation. 2. n Mixture of wood r esins,
sometimes including artificial materials, used to line barrels. 3. v Line with
or apply pitch (2).
pitch rate n Number of yeast cells pitched per volume of beer. Also called
pitching rate.
plasma membrane n Cell membrane.
plate v Apply a sample to a medium as a test for microbes.
Plato See degree Plato.
pleomorphic adj Having variability is size or shape.
plump adj Retained by a certain size screen, usually 2.5 mm (6/64 in. = 2.38 mm
in North America) for barley.
points n Measure of specific gravity equal 1000 × (SG − 1). For example, a spe
cific gravity of 1.044 is equivalent to 44 points. Four points is equivalent to
about 1% dissolved sugar. Also called degrees Oeschle.
polar adj Having a positively charged end and a negatively charged end.
pollutant n Undesired component of a mixture.
polyatomic ion n Collection of two or more atoms with an electric charge,
e.g. carbonate ion.
polymer 1. n Substance made of molecules produced from subunits connected
by covalent bonds. 2. n (informal) Polymeric macromolecule (1). See
monomer.
534 GLOSSARY
polypeptide n Polymer of amino acids. See protein.

polyphenol n Loosely defined group of natural products from plants having
multiple conjugated rings and many phenolic groups. Polyphenols are
moderately soluble in water, more so at high pH.
polysaccharide n Carbohydrate consisting of many monosaccharide units
connected with glycosidic links.
polyvinylpolypyrrolidone n PVPP.
porosity 1. n Condition or state of having pores. 2. n Volume fraction of a
material that is pores.
posttranslational modification n Reactions involving making and breaking
bonds in protein molecules after they have been synthesized by a ribo-
some. These can include cleaving the protein chain, attaching phosphate or
lipid, forming disulfide bonds, etc.
potential n Electrical potential.
potential alcohol n Concentration of ethanol that could result from complete,
ideal fermentation of a sample of wort or must.
power n Rate at which energy is transferred. Sometimes called “wattage.”
precipitate 1. v Come out of solution, especially as a solid. 2. n Solid that
comes out of solution.
precoat n Filtration medium applied to the filter cloth or screen before filtra
tion begins. See body feed.
premasher n Device to mix grist with strike water before they are added to
the mash tun.
prerun tank n Vessel to hold wort from the wort separation vessel before it is
transferred to the kettle.
pressure n Force divided by area.
pressure relief valve n Relief valve. Abbrev: PRV.
primary cooling system n Device that uses energy to extract heat from a cold
system and release it to a warm system. Usually used to cool a secondary
cooling system. Also called a refrigeration system.
primary structure n Sequence of amino acids in a protein.
primer n Short segment of DNA or RNA to which nucleotides are added to
make a new DNA strand.
processed malt n Malt treated to introduce flavors or other properties that do
not derive from the malting process. For example, smoked malt.
process steam n Hot water vapor of a quality suitable for application of heat
and pressure, but not for direct contact with food. See culinary steam.
product n Material formed in a chemical reaction.
prohibition n Laws against manufacture, sale, or use of alcoholic beverages or
other substances. Specifically, national prohibition on alcohol in the United
States from 1919 to 1933.
GLOSSARY 535
prokaryote n Single‐cell organism with no nucleus.

propagator n Vessel used to encourage yeast cells to reproduce to provide
yeast for fermentation.
propylene glycol alginate n Copolymer of mannuronic acid and guluronic acid
esterified with propylene glycol. Used as a foam enhancer. Abbrev: PGA.
protease n Enzyme that catalyzes hydrolysis of protein.
proteasome n Protein complex that hydrolyzes proteins that have been
tagged with ubiquitin.
protein n Polymer of 50 or more amino acids.
proton n Positively charged elementary subatomic particle. Found in atomic
nucleus.
psi n Pounds per square inch. A unit of pressure equal to 0.068 95 bar.
psychoactive adj Causes changes in brain function.
pub n Bar (2).
pullulanase n Limit dextrinase.
pump 1. n Device to drive a fluid from place to place. 2. n Protein structure
extending through a membrane to drive specific ions or molecules from
regions of lower concentration to regions of higher concentration.
punt n Indentation in the bottom of a bottle.
purification n Removal of undesired components from a mixture.
PVPP n Polymer, polyvinylpolypyrrolidone, used as a fining. Cross‐linked,
insoluble version of polyvinylpyrrolidone.
pycnometer n Instrument that can be filled with a precisely reproducible
volume of a fluid. Used to determine density.
PYF n Premature yeast flocculation. Sedimentation of yeast before fermen-
tation is complete.
pyruvic acid n CH3COCOOH, an intermediate compound in respiration and
fermentation.
python n Bundle of beverage lines refrigerated by two or more tubes carrying
cold fluid to and from a chiller. The bundle is encased in insulation to mini
mize heat leakage and to prevent condensation.
quality 1. n Characteristic of freedom from defects. 2. n Characteristic of
meeting end user’s requirements or expectations. 3. n Fraction (of steam)
that is vapor.
quality management n Policies and procedures to enhance quality.
quaternary ammonium ion n Ion with the formula NR4+. Used in sanitizing
solutions.
quaternary structure n Resulting three‐dimensional shape of several interact
ing proteins, distinct polypeptides that interact through non‐covalent
bonds to form one functional complex.
536 GLOSSARY
rack v Transfer beer from one vessel to another, especially to a keg or cask.
reactant n Material that is consumed by a chemical reaction.
reaction n Process in which one or more substances, the reactant(s), are
converted to one or more other substances, the product(s).
reaction quotient n Number representing the extent or completeness of a
chemical reaction.
reactive oxygen species n Molecules, ions, or free radicals containing oxygen
in a form that reacts more easily than oxygen molecules.
real ale n Ale that meets the production and serving standards of the
Campaign for Real Ale.
real attenuation n Original extract minus real extract, sometimes expressed
as a fraction or percent of the original extract.
real degree of fermentation n Degree of fermentation. See apparent degree
of fermentation. Abbrev: RDF.
real extract n Mass percent solids in decarbonated beer after fermentation.
Also called final extract. Abbrev: RE. See apparent extract.
receptor n Protein structure that selectively binds certain molecules or ions
and causes a response inside a cell.
redox adj Involving an oxidation and a reduction.
reducing end n End of a polysaccharide molecule that has a free ─OH group
(not bound by a glycosidic link) on the anomeric carbon.
reducing sugar n Sugar with a free ─OH group (not bound by a glycosidic
link) on the anomeric carbon.
reduction n Chemical reaction in which electrons are a reactant.
reference electrode n Electrode kept in electrical contact with a sample to
complete the circuit for electrochemical measurements like pH.
reflux v Allow some or all of the condensed vapor in a still to return to the
boiler.
reflux ratio n Fraction of liquid condensed in a still that is returned to the
boiler.
refraction n Bending of a beam of light resulting from passing through mate
rials with different refractive indices.
refractive index n Ratio of the speed of light in vacuum to that in the
sample.
refractometer n Instrument to measure refractive index. Can be used to
determine sugar content in wort, fruit juice, and honey.
regulator n Valve that controls the delivery pressure of a fluid despite varia
tions in the inlet pressure.
Reinheitsgebot n Former Bavarian law restricting beer ingredients to water,
barley, and hops.
GLOSSARY 537
relay n Electrical device that switches a main circuit on or off in response to

the application or withdrawal of current in a control circuit. The relay
allows a low power in the control circuit to control a much higher power in
the main circuit.
relief valve n Valve that is set to open when the pressure exceeds a set value.
Also called a safety valve or an overpressure valve. Abbrev: PRV or OPV.
repel v Exert a force driving something away.
replication n Process through which DNA makes an identical copy of itself
during cell division.
resistance n Opposition to the flow of electrical current. Ratio of electrical
potential to current.
resistance temperature detector n Temperature sensor consisting of a metal-
lic conductor, often platinum, whose resistance varies in a predictable way
with temperature. Abbrev: RTD.
resonance n Delocalization of electrons represented as the average of alter
native forms of a molecule differing only by the placement of the valence
electrons.
respiration n Oxidation of food by an electron acceptor. Releases energy. In
aerobic respiration the acceptor is oxygen and the products are carbon
dioxide and water.
rest n Time interval during which temperature is held constant to allow some
chemical or biological process to occur.
reverse osmosis n Method of purification by forcing a liquid through a semi-
permeable membrane from the impure side to the pure side.
R‐group 1. n Any group of atoms attached to a molecule, especially one
attached through a carbon atom or hydrogen atom. 2. n Variable side chain
on an amino acid.
ribes n Catty flavor in beer.
ribose n Specific five‐carbon aldose. Building block of RNA. A dehydroxy
lated form is in DNA.
ribosome n Protein–RNA complex that synthesizes proteins from amino
acids carried by tRNA according to a template provided by mRNA.
RNA n Ribonucleic acid. Nucleotide polymer often involved in biological
protein synthesis.
roasted malt n Class of malt heat treated after curing to produce color and
flavor.
rotameter n Instrument to measure the flow rate of a fluid. Comprises a
tube with a tapered interior with the larger bore at the top. A ball rises in
tube until the force produced by the flow balances the mass of the ball.
The position of the ball is a measure of the flow rate.
538 GLOSSARY
rotation n Motion of a molecule involving turning about an axis.

rouse v Stir the contents of a fermenter to resuspend the yeast.
rRNA n Ribosomal ribonucleic acid, a component of the r ibosome, respon
sible for translation and protein synthesis.
RTD n Resistance temperature detector.
ruh beer n Green beer.
saccharify v Catalytically hydrolyze starch to sugar.
Saccharomyces cerevisiae n Top fermenting yeast used to make ale and bread.
Saccharomyces pastorianus n Cold tolerant bottom fermenting yeast used to
make lager beer. Formerly called Saccharomyces carlsbergensis.
sake n Unhopped rice beer from Japan. Also called rice wine. See koji.
sales gravity n Hypothetical initial gravity that unfermented wort used for
high‐gravity brewing would have had if dilution had occurred before rather
than after fermentation.
saloon n Bar (2), usually with tables and chairs.
sanitary fitting n Temporary plumbing connection without any crevices and in
which all surfaces in contact with the fluid are food compatible. The parts to
be connected usually have flanges that are connected by a gasket. The flanges
are tightened to the gasket by various mechanisms such as clamps or screws.
sanitize v Treat to reduce number of microbes to an acceptable level.
sanitizer n Substance used to sanitize surfaces.
saturated 1. adj Of a mixture: having the maximum amount of dissolved mate
rial at a particular pressure and temperature. 2. adj Of an organic com
pound: having no double or triple carbon–carbon bonds. 3. adj Of steam:
having pressure equal to the vapor pressure of water at the steam
temperature.
screw conveyor n Device that uses a spiral band to move material along a
tube or channel.
scutellum n Separator between the endosperm and embryo compartment in
a seed.
seam 1. n Closure on a can. 2. v Seal the lid on a can.
seamer n Device to seam a can.
secondary cooling system n System of heat exchangers and plumbing to carry
heat from devices, like fermenters, and deliver it to a primary cooling
system.
secondary fermentation n Any additional fermentation or aging period that
occurs in beer after terminal gravity is reached.
secondary structure n Shape within a protein that comprises helices or sheets.
GLOSSARY 539
sediment 1. v Fall to the bottom of a container. 2. n Material that has fallen to

the bottom of a container.
seed coat n Waxy covering for a seed beneath the hull. Also called testa.
selective media n Microbiological medium that encourages the growth of
some microorganisms while preventing the growth of others through the
addition of chemicals.
selectivity n Ability to cause a particular reaction to a greater extent than
other reactions that are possible with the same reactants. Said of a catalyst.
See specificity.
semimetal n Metalloid.
semipermeable membrane n A membrane through which certain molecules
or ions can pass, but not others.
sequestrant 1. n Compound that binds to ions in solution, lowering their
effective concentration. Used in detergent formulations to minimize the
effect of hardness, and in foods to prevent the formation of reactive
oxygen species. 2. n Any compound that prevents the formation of
precipitates from hardness ions.
shape n Spatial arrangement of atoms in a molecule not including unshared
electron pairs.
shared pair n Bonding pair.
shear n Force in a direction that tends to make the layers of an object slide
past one another.
shell n Energy level.
shive n Stopper for a cask to close the opening in the side.
SI 1. adj According to the International System of Units based on the kilo
gram, meter, second, ampere, kelvin, mole, and candela. 2. n International
System of Units (for Système International d’Unités).
sieve n Device with a screen or plate with openings of a specific size. Used to
remove undesired particles or to measure particle size distribution.
sight glass n Transparent part of a liquid handling system allowing the appear
ance or quantity of the contents to be seen and evaluated.
signal sequence n Short portion at the end of a protein molecule indicating
the destination of the molecule.
silica gel n Porous silicon dioxide with bound water. Used as a fining.
silo n Structure for storing unpackaged material, especially grain in the
context of brewing.
Sinner circle n Four factors required for effective cleaning: chemical, mechan
ical, temperature, and time. Less of any of these factors must be made up
by more of another.
540 GLOSSARY
siphon 1. n Tube to transfer a liquid over a barrier from a higher to a lower

level. 2. v Transfer liquid with a siphon (1).
six‐row barley n Variety of barley in which all three flowers in each group are
fertile.
skeletal structure n Representation of a molecule in which carbon atoms are
shown as the ends of line segments and the hydrogen atoms attached to
carbon atoms are omitted.
skid n Pallet without a lower deck.
slack adj High in moisture. Said of malt.
slant n Solidified growth medium with a slanting surface in a test tube with a
cap. Used to prepare and store pure cultures of microbes.
slurry n Mixture with solid particles suspended in a liquid.
small pack n Can or bottle sold for consumer use at home.
small regulatory RNA n Short noncoding RNA molecules that control gene
expression. Also called small RNA. Abbrev: sRNA.
snift v Release counterpressure after filling a bottle or can.
soda lime glass n Glass prepared from sand with sodium carbonate and
calcium carbonate used as a flux.
soft water n Water with low concentrations of calcium ions and magnesium
ions.
soluble protein n Percent protein in malt that can be extracted by mashing
using a standard procedure.
solute n Minor component of a solution.
solution n Mixture with the same composition throughout.
solvent n Component that makes up the majority of a solution.
sparge v Wash wort from a bed of grain with hot water.
sparge arm n Rotating pipe in a wort separation vessel to spray water for
sparging.
spear n Tube that goes from the opening to the bottom of a keg.
specific gravity n Mass of the volume of a material that has the same volume
of one mass unit of water. Equivalently, the ratio of the density of a sample
to the density of water. Used as a measure of the concentration of dissolved
carbohydrates in wort and beer.
specific heat capacity n Amount of energy to increase the temperature of one
gram of a substance or solution by 1 °C. See heat capacity, molar heat
capacity.
specificity n Property of an enzyme (or other catalyst) to cause a reaction in a
certain compound more than in other potential reactants. See selectivity.
spigot n Valve for liquid.
GLOSSARY 541
spile n Peg driven into the shive of a cask to control the internal pressure.
spirit n Alcoholic beverage prepared by distillation to concentrate the
ethanol.
spoilage n Flavor deterioration that takes place over time. Also called staling.
See aging.
spond v Seal a vessel before fermentation is complete to allow pressure to
build up.
spore n Cell that can develop into a new organism without merging with
another cell.
spray ball n Device to apply a spray of cleaning solution to the interior
surfaces of a vessel. Part of a CIP system.
spray jet n Device to deliver cleaning solution at high impact to the interior
surfaces of a vessel. Part of a CIP system.
SRM n Standard Reference Method.
sRNA n Small regulatory RNA.
stacking force n Force of attraction between flat, ring‐shaped molecules.
stage n Part of a microscope that positions the sample.
stain n Pigment applied to a sample to enhance contrast in a microscope.
stainless steel n Alloy of steel with a substantial fraction of chromium and
often other elements such as nickel or manganese.
staling n Spoilage.
standard deviation n Measure of the scatter in a series of measured
quantities.
Standard Reference Method n Standard method for beer color of the
American Society of Brewing Chemists (ASBC). Abbrev: SRM. Officially
ASBC Methods of Analysis, Beer 10.
staphilo– adj Prefix: occurring in clusters. Said of bacteria.
starch n Long chain of sugar molecules in a form that is readily hydrolyzed.
Usually the links are mainly alpha(1→4).
starter n Culture of yeast grown in a small batch of wort used to initiate
fermentation.
stationary phase n Third stage of a microbial growth curve in which cell death
is equal to cell growth.
stave n One of the narrow wooden boards that make up the wall of a
barrel (1).
steam trap n Valve that automatically discharges condensed water from a
steam line.
steel n Alloy of iron with 0.002–2.1% carbon by weight.
Steel’s masher n Type of premasher.
542 GLOSSARY
steely adj Not made porous by modification. Said of malt kernels. Also called
glassy. See mealy.
steep v Soak seeds in water to initiate sprouting.
stereoisomer n One of a set of molecules with the same atoms bonded in the
same order but differing in the way they are directed in space.
sterile adj Free of microbes and spores.
sterile filtration n Process to remove microbes from a fluid by passing it
through a membrane filter.
sterilize v Kill or remove all microbes and spores in a material or on an object.
steroid n Member of a family of compounds with a molecular plate consisting
of four fused rings. Steroids are considered to be lipids.
sterol n Steroid with an ─OH group bound to one of the rings.
stew v Heat (grain kernel) under high humidity during malt processing.
still 1. n Device to vaporize a liquid and condense and collect the vapor. If the
condensed vapor is allowed to return to the original container, it is called
a reflux still. 2. adj Not carbonated.
stillage n Platform or cart to keep goods, such as casks of beer, above the floor.
strain 1. n Deformation of an object in response to an applied force. 2. n
Particular variety of a biological species.
strain gauge n Device whose electrical properties vary with extension,
compression, or bending. Used in measuring instruments.
stratification n Formation of layers, especially in a fermenter, as a result of
drauflassen or topping up a fermentation.
S/T ratio n Ratio of soluble protein to total protein in malt. Also called
Kolbach index.
streak v Apply a microbial sample to the surface of a solid or gel growth
medium with a series of dilutions to produce isolated colonies.
Strecker degradation n Oxidation of an amino acid to carbon dioxide and an
aldehyde.
strepto– adj Prefix: occurring in long chains. Said of bacteria.
strike water n Water added to grist to begin mashing.
striking temperature n Temperature of water added to grist to begin mashing.
See mash‐in temperature.
strobile n Cone‐like seed‐bearing fruit of certain plants, like the hop.
structural formula n Representation of a molecule showing the atoms and the
covalent bonds connecting them.
Student’s T‐test n Statistical method to determine, without knowledge of
the standard deviation of the population, whether differences in means are
significant.
GLOSSARY 543
stupor n Lowered level of consciousness and response.

substituent n Atom or functional group that replaces a hydrogen atom in an
organic compound. The substituent is of lower priority than the principal
functional group of the molecule.
substrate n Reactant in an enzyme‐catalyzed reaction.
sugar n Monosaccharide or disaccharide.
supercritical fluid n Substance above its critical pressure and its critical
temperature. Abbrev: SCF. see Critical point.
superheated adj Having a pressure lower than the vapor pressure of the
substance.
super sack n Large container made of woven material designed for the trans
portation and storage of dry, freely flowing material, like grain. Capacity
typically about 0.5–1 metric tonne (1000–2000 lb). Usually equipped with
straps for handling by fork lift and often with a discharge spout at the
bottom for delivery of the contents. Officially called a flexible intermediate
bulk container (FIBC).
surface n Boundary where phases meet.
surface n Interface between a solid or liquid and a gas or vacuum.
surface energy n Energy to overcome cohesive forces and pull a material into
parts, making surface.
surface tension n Energy needed to make a unit area of surface. See interfacial
tension.
surfactant n Substance that lowers surface tension.
swab 1. n Tool to take a sample for microbe testing. 2. v Take a sample with a
swab (1).
swing panel n Device in which pipes to different vessels and equipment
are arranged, each with a valve. The pipes can be connected in pairs by
U‐shaped pieces of pipe that are connected to the valves with sanitary
fittings. Also called distribution panel, flow panel, transfer panel, and swing
bend panel.
tail piece n Fitting that can be inserted into a piece of tubing to make a con
nection. Also called hose barb or hose nipple.
tannin n Member of a family of polyphenols that can form stable complexes
with proteins.
tap 1. n Spigot or fitting to take beer from a cask or keg. 2. v To install a
tap (1).
tare n Weight of a container; must be subtracted from the total weight to get
the weight of the contents.
taste n Sense that responds to dissolved materials.
taste bud n Organ containing cells responsible for the sense of taste.
544 GLOSSARY
tautomerism n Shift of a hydrogen atom resulting in the exchange of a double

bond with an adjacent single bond.
tavern n Shop for purchase and consumption of alcoholic beverages and
usually food on the premises. Some also provide lodging.
temperance movement n Social movement urging reduced consumption of
alcoholic beverages. Followers advocated diverse programs ranging from
voluntary moderation of consumption to enforced prohibition.
temperature n The property of an object such that heat flows spontaneously
from a higher temperature to a lower temperature. The temperature is the
same in bodies at thermal equilibrium. An intensive property, not to be
confused with heat.
temperature controller n Device that operates a switch or valve controlling
the application or removal of heat to control the temperature of a
material.
temporary hardness n Water hardness that is removed by boiling, indicating
that the negative ion is carbonate.
tension n Force that tends to increase the length or volume of an object; pull.
See compression.
termination n Final step of transcription or translation. New chain and
template dissociate from assembly mechanism.
terpene n Any member of a family of naturally occurring hydrocarbons with
one or more double bonds.
terpenoid n Any member of a family of terpenes and modified terpenes con
taining oxygen, phosphorus, sulfur, etc.
tertiary structure n Entire three‐dimensional shape of a protein that results
from covalent and non‐covalent interactions within the polypeptide.
testa n Seed coat inner layer.
tetrad n Grouping of four bacterial cells.
tetrahedral adj Three‐dimensional geometry with four electron groups
arranged at roughly 109.5° angles about a central atom.
thermal conductivity n Measure of the ability of a material to transmit heat.
thermal cycler n Automatic device to repeatedly raise and lower the tempera-
ture of a reaction mixture undergoing PCR.
thermistor n Electronic component whose resistance changes substan
tially with temperature. Used as the sensing element in electronic
thermometers.
thermocouple n Junction of dissimilar metals that produces an electrical
potential that can be used to measure temperature.
thermometer n Instrument to measure temperature.
GLOSSARY 545
thiol n Compound whose principal functional group is the ─SH group.

thousand corn weight n 1000 kernel weight.
thresh v Remove seeds of grain from the plant.
threshold, flavor n Lowest concentration of a flavor compound that can be
detected by the average taster.
threshold potential n Electrical potential in a cell that causes channels to
admit positive ions generating an electrical signal.
threshold sequestrant n Compound that modifies a surface to prevent pre-
cipitation of hardness ions.
thru adj Passing through a certain size screen, usually 5/64 in. for barley
seeds.
titrate v Analyze by carefully mixing the analyte with a reactant of known
composition, stopping when the amount of reactant is chemically equiva
lent to the amount of analyte. See back‐titrate.
toast n Benediction recited over an alcoholic beverage.
Tollens’ reagent n Basic solution of diammine silver ion, Ag(NH3)2+, in water
used to test for reducing sugars.
ton 1. n Unit of mass equal to 907.2 kilograms (2000 lb). 2. n Measure of refrig
eration power equal to 3.52 kilowatts.
tonne n Unit of mass equal to 1000 kilograms. Also called a metric ton or a
megagram.
top fermenting adj Rising to the top of the fermenter during fermentation.
Said of yeast. Also called top cropping.
topoisomerase n Enzyme responsible for unwinding the double‐helix of
DNA.
total protein n Percent protein in a solid sample of grain, malt, or adjunct. See
soluble protein. See S/T ratio.
tough adj Resistant to cracking and shattering.
trans‐2‐nonenal n Compound CH3(CH2)5CH═CHCHO that gives a card
board flavor to stale beer.
transcription n Synthesis of a strand of mRNA from nucleotides according to
genetic code on a strand of DNA.
transcription factor n Protein that binds to a DNA site to enhance or inhibit
gene expression.
transducer n Device whose electrical properties change in response to a con
dition to be measured. An example is a thermistor, whose resistance is
used to measure temperature.
transduction n Process in which a stimulus to a cell causes a signal that can be
transmitted to another cell.
546 GLOSSARY
transition state n Configuration in the progress of a chemical reaction at

which the potential energy is highest.
translation 1. n Synthesis of a polypeptide from amino acids according to
genetic code on a strand of mRNA. 2. n Motion of molecules in which the
whole molecule moves from place to place.
transmittance n Fraction or percentage of light entering a sample that emerges
from the other side.
trehalose n Disaccharide consisting of two glucose molecules connected by
an alpha(1→1)alpha glycosidic link.
triacylglycerol n Ester of glycerol with three fatty acid molecules.
trier n Device to gather a sample of seeds from a bin, bag, silo, or other con
tainer. Also called a grain thief.
triglyceride n Triacylglycerol.
trigonal planar adj Geometry with three electron groups all in the same plane
arranged at roughly 120° angles about a central atom.
triple bond n Covalent bond formed by sharing three pairs of electrons.
triple point n Temperature and pressure at which solid, liquid, and vapor are
all present. Equivalent to the freezing point of a pure substance under its
own vapor pressure. Not to be mistaken for critical point.
trisaccharide n Carbohydrate with three simple sugar units.
tRNA n RNA molecule that carries an amino acid corresponding to its
anticodon. For transfer RNA.
trub [troob] n Sediment from wort or beer that precipitates at various stages
of brewing. It could include coagulated proteins, bits of hops, inactive
yeast, and fatty solids. See cold break, hot break.
tubing n Hollow, often flexible cylindrical tube used to convey fluid. Tubing
dimensions are based on the outside diameter. See pipe.
tun n Brewhouse vessel.
turbidity n Tendency for a material to scatter light. Cloudiness or haze.
turbulent adj Characterized by flow in which the velocity and direction of flow
at any point varies in a chaotic manner, leading to good mixing. See laminar.
two‐row barley n Variety of barley in which only the central flower in each
group of three is fertile.
ubiquitin n Small regulatory protein with which cells tag proteins. The
ubiquitin‐tagged proteins may be destroyed by hydrolysis, transported to
another part of the cell, or subjected to other processes depending on the
location and number of tags.
ullage 1. n Difference between the total volume capacity of a container and the
volume to which it has actually been filled. See headspace. 2. n Volume of
product left in a container after as much has been dispensed as is practical.
GLOSSARY 547
ultraviolet adj Having a wavelength in the range of 400–10 nm. Said of light.

underback n Grant.
underlet v Pump water into a vessel by way of openings in the bottom.
underlying geometry n Spatial arrangement of electron groups, including the
unshared electron pairs, in a molecule.
unfermentable dextrin n Short branched starch polymers that typically con
sist of at least one 1→6 branches and thus are unfermentable by traditional
brewer’s yeast. Contributes to the body of a beer.
unit 1. n Standard quantity of measure, like a kilogram (unit of mass). 2. n One
of a series of connected or related items, like a glucose unit in starch. 3. n
Device with a specific function, like a refrigeration unit.
unsaturated 1. adj Of a mixture: having less than the maximum amount of
dissolved material at a particular pressure and temperature. Also called
undersaturated. 2. adj Of an organic compound: having one or more double
or triple carbon–carbon bonds.
unshared pair n Pair of electrons localized on a single atom. Also called a
lone pair.
utilization 1. n Action of making use of something. 2. n Rate or efficiency with
which something is converted to a usedful form. Often said of the ability of
yeast to metabolize specific sugars or of the efficiency of isomerization of
hop alpha acids during the brewing process.
vacuole n Fluid‐filled, membrane‐enclosed structure within the cell responsi
ble for storage and digestion of waste products.
valence adj Relating to the highest occupied energy level in an atom.
valence electron n One of the electrons in the highest occupied energy level
of an atom.
valency n Normal number of covalent bonds that an atom forms in neutral
molecules.
valve n Mechanical device to provide a variable obstruction in the path of a
fluid or of flowing particles to regulate flow.
vapor n Gas at a low enough temperature that it can be liquefied.
vapor pressure n Pressure at which a vapor is in equilibrium with its liquid at
a specified temperature.
VDK n Vicinal diketone.
vegan 1. adj Free of materials derived from animal sources. 2. n Person who
consumes or uses only vegan (1) materials.
venturi device n A pipe with a narrow restriction where a gas is introduced
into a flowing liquid. High flow rate in the narrow section lowers the pres-
sure, drawing the gas in and facilitating mixing. Often used to introduce
oxygen to beer wort before fermentation.
548 GLOSSARY
vesicle n Large liquid‐filled organelle.

viability n Fraction of a sample of cells or seeds that are alive.
viable adj Alive.
vibration n Motion of molecules in which bonds bend or stretch.
vicinal diketone n Collective term for diacetyl and 2,3‐pentanedione.
viscosity n Resistance to flow in a fluid.
vitalism n Scientific doctrine that holds that processes in living organisms
cannot be explained solely by the laws of chemistry and physics. Today,
vitalism is rejected by mainstream science. See mechanism (2).
vitality n Metabolic state characteristic of the ability to thrive under stress.
volatile [VOLL it’l or chiefly British VOLE it tile] adj Easily evaporated or
boiled.
Volstead Act n Former US law adopted in 1919 providing for the enforcement
of national prohibition of alcohol.
voltage n Electrical potential.
voltage‐gated channel n Channel in a cell membrane that opens in response
to the electrical potential being less negative than the threshold potential
allowing particular positive ions to cross the membrane.
vorlauf n Recirculate wort from the lauter or mash tun through the bed of
grain to clarify the wort.
water sensitive adj Having the property of germinating in a moderate amount
of water, but not in excess water. Said of grain seeds.
water softener n Ion exchange device that replaces undesired ions with
sodium and chloride ions.
wavelength n Nearest distance between equivalent points on an electromag
netic wave.
weigh 1. v Determine the mass of something. 2. v To have a certain mass.
weight 1. n Force upon an object exerted by gravity. 2. n (informal) Mass.
well plate n Flat piece of plastic or ceramic with evenly‐spaced holes part‐way
through to hold samples for analysis. Also called a microplate.
wet hops n Fresh hops.
whirlpool n Tank in which beer wort is made to flow in a circle, causing sus
pended solids to settle in the center.
widget n Hollow insert in packaged nitrogenated beer to raise foam.
wine 1. n Alcoholic beverage prepared from fermented fruit juice, especially
grape juice. 2. n Loosely, any strong fermented beverage that has not been
distilled.
worm 1. n Screw conveyor. 2. n Tubular heat exchanger used to condense
vapors in a spirit still.
GLOSSARY 549
wort [wert] n Sugar solution extracted from grain by mashing.

wort chiller n Device to remove heat from wort after boiling.
wort separation n Process to separate wort from spent grain after mashing.
wort strength n Fraction or concentration of solids in wort.
xylose n Specific five‐carbon aldose.
yeast n Single‐cell fungus, certain species of which are used to make beer,
wine, and bread.
yeast assimilable nitrogen n Concentration of nitrogen that can be taken up
and used by yeast. This includes amino acids other than proline, as well as
ammonia and inorganic ammonium compounds. Abbrev: YAN.
yeast brink n Brink.
yeast propagation vessel n Propagator.
zentner n Unit of mass equal to 50 kilograms when referring to hops. Abbrev:
Znt.
zwickel [zvik’l] n Spigot in a fermenter for sampling the beer.
zymurgy n Science of fermentation.
Index
Absorptivity 397 Acrospire 131
Accumulation 360 Activated carbon 115
Acetaldehyde 275, pores 115
278, 437 Active site 190
hydrogenation 189 Addition 60
off‐flavor 382 Adenine 88
Acetic acid 434 Adenosine triphosphate 279
Acetic acid bacteria 324 Adhumulone 151
Acetylation 100, 103 Adjuncts 6, 209, 213, 316
Acid 109, 478 FAN 142
dissociation 64 gelatinization 207
equilibrium 110 starch 209
foods 440 starchy 134
phosphoric 485 sugar 210
rest 204 Admix 316
sour 370 Agar 450
strong or weak 109 preparation 455
tolerant 438 Aging 323
Acid‐base equilibrium 111 accelerated 415
Acidity, excessive 428 microbes 323

551
552 Index
Air Amino group 142

contamination 450 Amphiphilic 409
quality 178 Amylase 83, 86, 188, 249
Alcohol 60–61 mechanism 192
content 428 selectivity 197
dehydrogenase 189, 275 Amylopectin 77
fusel 61, 381 Amylose 77, 187
tolerant 437 Anabolism 70
by volume 28 Anaerobic
Alcoholic beverage 1 chamber 453
Aldehyde 62, 72 jar 453
Aldose 74, 277 methods 453
Ale Analyzers, in‐line, on‐line,
cask‐conditioned 336 off‐line 270
vs. lager 13 Anomeric 75
wheat 61 carbon 74, 188
Aleurone layer 382 Anti‐foam 486
Alginic acid 410 Arabinose 77, 79
Alkalinity 112, 200 Aroma 30, 369, 371
adjustment 200 compounds 371
and beer styles 137 Aromatic 60–61
dark malt 113 Aromatic compound 60
Alkane 60 Aseptic technique 446
Alkene 60 Aspergillus niger 83
Alkyne 60 ASTM 184
Alpha‐acetolactate decarboxylase 313 Astringency 373
Alpha acids 151, 231, 445 Astringent 177–178, 379
configuration 248 Asymmetric 72
content in hops 152 Atom 38
iso 152 diagram 38–39
isomerization 152 implied 58
isomerize 247 size 38
loss 152 structure 38
Alpha amylase 197, 212 Atomic number 38, 42
structure 191 ATP 22, 279
Alpha‐glucan 75 from fermentation 275
Alpha helix 83 hydrolysis 279
Alpha terpineol 378 luminometer 361, 489
Aluminum 351 payoff 277
sodium hydroxide 485 ATP test, liquid 490
Amadori rearrangement 400 Attenuation 213, 270, 309, 428
Amide 62 apparant 274
Amino acid 70, 82, 94, 372 Autoclave 455
code 83 Axon 373
polymer 83
properties 83 Bacilli 436
R‐group 83 Bacillus 431, 438
Index 553
Bacteria 69, 77, 181, 456 Beta amylase 197

acetic acid 434 Beta glucan 3, 71, 78, 75,
gram negative 92 145, 146, 196, 213,
identification 428, 431–432 416, 419
lactic acid 432 degradation 196
pathogenic 440 hydrogen bonding 78
size 431 Beta‐glucanase 213
spoilage 432 Beta pleated sheet 83
Bacteriostatic 440 Bicarbonate 200
Bag, opening 169 Bill of lading 168
Barley 2, 69, 71, 75, 77 Binding site 190
lipid content 80 aroma 372
Barrel 324, 439 Biofilm 77, 489
maintenence 325 Biology 69
oxygen 435 Biopolymer 70, 82
purge 436 Bits 28, 31, 415
sampling 325 Bitter 370–371, 375
Base 109, 478 harsh 152
Base pair 55, 90 receptor 371
Batch identification 358 Bitterness
Beckman 110 astringent 375
Beer dry hopping 249
definition 1 units 375
faucet 345 Bleach 487–488
as food 28 Bock 376
gas 339 Body feed 316
gluten‐free 136 Boil 86, 231
history 18 Boiler 233
hopped 445 Boiling 3, 6, 10, 233, 428
legal definition 445 calandria 241
pump 344 coagulation 10
quality 27 continuous 243
safety 440 copper 10
stone 113, 489 direct fire 239
styles 113, 137, 374 duration 10
Beer judge certification program 374 evaporation 10
Beer line maintenance 361 film 239
Beer’s law 397 hops 10
Beetle 175 isomerization 10
Bell‐shaped curve 462 kettle 10
Benzene 61 Merlin 242
Berliner Weisse 371 microbes 10
Berzelius, Jacob 20 nucleate 239
Beta acids 152 off‐flavors 10
conversion 152 point 237
hulupone 152 steam injection 243
oxidation 152 Boilover 236
554 Index
Bond 44, 69 Calibration 171

angle 53 cAMP 372
water 108 Campaign for real ale 336
covalent 47, 70 Can 351
double 59–60 body 353
hydrogen 55, 57, 61 body flange 358
implied 58 flange 353
intermolecular 77 hook 353
ionic 44, 50 lid 357
multiple 47 lid hook 358
polar 50 market trend 351
Bottle 350 minimum order 352, 359
cap 350 parts 353
defect 354 ring 359
inspection 354 sealing compound 353
plastic 350 seaming 357
returned 354 tear down 366
size 350 top 353
Bottom fermenting 13 Candi sugar 210–211
Boundary layer 235 Cap 5, 97
Brain 370 lining 350
Branch point 77 seal 350
Brandhefe 489 Capper 356
Brand values 32 Caproic acid 437
Brettanomyces 4, 439 Carbohydrate 70, 373
Brewer’s Clarex® 419 in membrane 92
Brew house 6 Carbon 59
Brewing anomeric 75
high gravity 209 asymmetric 72, 247
overview 4 chain 59
Brewpub 427 ring 59
Bright beer tank 362 Carbonation 64, 309, 319, 331, 349, 373
Brown sugar 210 analysis 388
Brut IPA 213 equation 320
Bubble 403 measurement 362
pressure 403 pressure 321
Buchner, Eduard 21 table 320, 340
Bung hole 335 volumes 339
Butanedione 310 Carbon dioxide 69, 319, 336, 338
Buttery 383, 432 alarm 348
Buttery flavor 310 food‐grade 347
Butyric acid 437 liquid 346
measurement 362
Cacao nibs 442 monitor 348
Cagniard‐Latour, Charles 20 mouth feel 373
Calandria 241 reaction 484
Calcium 191 supercritical 158
Calcium channel 372 threshold 319
Index 555
Carbonyl 61, 70 Chilling 6, 11, 233, 250

Carboxylic acid 62 coolship 11
Carrageenan 232, 418 Chime 335
Caryophyllene 154 Chirality 72
Case, bottles 359 Chit 130
Cask 335 Chlorine 487, 489
air entry 336 Chlorine dioxide 488
breather 336 Chlorophenol 379
filling 336 Choker 342
keystone 336 CIP. See Clean in place (CIP)
shive 335 Clarification 313
spile 336 Clarifier 231
tut 336 Clarity 29, 31
Cask Marque 336 Cleaning 428, 477–478
Catabolism 70 chemicals 478, 484
Catabolite repression 213 cycle 480
Catalase test 428 exterior 480
Catalyst 64, 70, 82, 188–189 mechanical 478
Caustic 234, 484 out of place 483
Celiac disease 419 pipes and hoses 483
Cell 71 temperature 478
membrane 92–93 Clean in place (CIP) 283, 428, 480, 489
size 445 Clean out of place (COP) 483
Cellar 12 automation 481
Cellular division 101 jet 480
Cellulose 71, 75, 77, 92 sprayer 480
break‐down 77 steps 480
Cell wall 71, 77, 92, 196 Coagulation 236
endosperm 78 Coccus 431
Central dogma 95 Coefficient 63–64
Centrifuge 314, 445 Coferment 22
CGA. See Compressed gas association Cohumulone 151
(CGA) Cold break 251
Channeling 170 removal 251
Charge 37, 52 Colloidal stability 416
Charge balance 45 Colony forming unit 451
Chart Color 29, 231–232, 396
control lines 467 ASBC 402
CUSUM 468 chart 402
warning lines 467 CIE LAB 402
x‐bar 467 EBC 402
Chemical Lovibond 402
reaction 37 malt 147
sense 370 measurement 401
Chiller 11, 231, 250, 380 melanoidins 400
contamination 250 perceived 397
countercurrent 11 SRM 402
Chill haze 416 Complementary 90, 97
556 Index
Complexing agent 478 Counting technique 451

Component 44 Craft brewery, dispensing 341
Composition 51 Cranial nerve 370
elemental 44 Crashing 286
Compound 38, 44 Crimp tester 365
flavor 373 Critical angle 273
good and evil 153 Crown cap 350, 356
ionic 45 Crystal 45
ionic liquid 45 Culms 131
organic 49, 69 removal 132
Compressed gas association Custer effect 439
(CGA) 346 Cyclic adenosine monophosphate 372
Compressor 349 Cylinder
Concentration 52, 397 moving 347
molar 52 restraint 347
Condensation 70, 381 valve 347
Conditioning 12, 286, 309 Cylindrico‐conical 314
Conduction 42 Cytoplasm 97
Configuration, absolute 73, 248 Cytosine 88
Conjugated 60 Cytosol 93
Consistency 27, 463
Contamination, results 428 Dalton, John 19
Control Dalton’s law 339
chart 466 Darcy’s law 226, 316
criteria 468 Decoction 380
engineering 181 Decoction temperature,
point 182 calculation 208
Conveyor 172–173, 360 Degassing 326
aeromechanical 174 Dekkera 439
auger 173 Denk ring 246
belt 173 Density 270
bucket 174 Deoxyribonucleic acid 88
drag 174 Depalletizing 353
energy 175 Depolarization 373
pneumatic 175 Depolarize 372
safety 173 Detergent, foam inhibitor 409
screw 173 Dextrin 135, 187, 196, 373, 440
worm 173 Dextrinizing unit 147
Cooling loop 287 Diacetyl 310, 383, 432, 434, 437
Coolship 250 analysis 327
COP. See Clean out of place (COP) chromatography 328
Copacabana method 452 colorimetric method 328
Copper 40 enzyme 313
Corn lager 311
sugar 210 rest 312
syrup 210 threshold 310
Corrosion 64, 488 valine 313
Index 557
Diastase 20 EDTA. See Ethylenediaminetetraacetate

Diastatic power 133 (EDTA)
Diastaticus 439 Efficiency
Diastereomer 72 energy 236
Diatomaceous earth 317, 319, 419 élan vital 20, 22
Dilution, flavor 374 Electrochemical sensor 363
Dimethyl sulfide (DMS) 134, 249–250, Electrons 38
380, 437 allocation 281
Dimethyl sulfoxide 380 bonding pair 48
Dipole‐dipole interaction 57, 108 capture 328
Direct‐draw 341 core 40
Disaccharide 8, 75 delocalization 60
table 76 group 52
Dispense lone pair 48
contamination 361 metals 42
hygiene 360 repulsion 52
off‐flavor 361 shared 48
quality 360 unshared pair 48
safety 360 valence 38, 40, 42
Dispense system 331, 341 Electronegativity 50, 55,
design 344 108, 280
Dispersant 486 Electrostatic 85
Disulfide 85 Element 38
Disulfide bond 100 symbol 38
DMS. See dimethyl sulfide (DMS) valency 47
DNA 55, 61, 70, 88, 95, 456 Elemental symbol 42
polymerase 456 Elevator 174
polymerase I 96 Embden, Gustav Georg 22
polymerase III 96 Emden‐Meyerhof‐Parnas
replication 456 pathway 275
sequence 101 Enantiomer 73–74
Dot diagram 48 Endosperm 177, 179, 196
Double bond 80, 91 Endospore 438
reaction 60 Energy 37, 57, 70–71, 74–75, 278
Draff 9, 180, 221 bond 44
Draft system conservation law 278
hand pump 341 currency 22
temporary 341 efficiency 236
direct draw 341 from fermentation 275
long draw 343 kinetic 54
Dry hopping 152, 248, 312, 375 potential 44
aroma 248 recovery 233, 236, 243
overattenuation 249 Energy level 39
Dust 170, 174, 178–179, 181, 428 capacity 39
valence 47
EBC. See European brewing convention Enol 278
(EBC) Enterobacteriaceae 436
558 Index
Enzymes 3, 7, 20, 65, 70, 77, 82, 96, 177, Fatty acid 80
188, 189, 209–210, 231, 275, 416, 418 in membrane 91
active site 372 Faucet 336, 345
cofactor 191 Fermentability 8, 188, 198
denature 194 Fermentation 4, 12, 63, 69, 74, 255
hydrolysis 133 cell free 20, 21
hydrolysis target 213 cooling 286
optimal pH 194 degree 270, 273
pH 110 flavor 13
processing aid 212 heat 13, 283, 286
specificity 190 products 275
temperature 194 rate 64
Epoxy 352 reaction 12, 275
Equation, chemical 63 spontaneous 434
Equatorial 74 stall 438
Equilibrium 63–65, 111, 237, 350, temperature 11, 13, 287
362–363, 443 vessel 282
constant 64 Fermenter 282
Ergosterol 91 cooling 13
Error 26–27, 199, 208, 273, 390, 466 cylindrico‐conical 283
Erythrose 73 open 285
Ester 62, 80, 376, 381 Yorkshire square 285
Ethanol 69 Ferulic acid 79, 213, 382
analysis 326 Filler 354
elemetal composition 51 counter‐presure 355
foam 409 head 354
sensitive 437 tube 355
synthesis 278 Fill height 355
tolerant 434, 438 Filling 353
Ethylenediaminetetraacetate Filter 226, 402, 417
(EDTA) 486 aid 419
Ethylene glycol 250 candle 317
Ethylguaiacol 382 clogging 445
Eukaryote 90, 93, 95, 373 membrane 444
European brewing convention plate and frame 317
(EBC) 184 pressure leaf 318
Exopolysaccharide 434 sheet 317
Experiment 23 Filtration 177, 213, 217, 316, 336, 420, 440
Experimental control 24 depth 316
Extract 182, 198 membrane 316, 451
apparant 274 Final gravity 271
final 274 Finings 232, 314, 336, 410, 415–416
Firkin 335
False bottom 204, 219 Fischer projection 72
FAN. See Free amino nitrogen (FAN) Fitting, sanitary 479
Farbebier 212 Flavor 12, 30, 231, 255, 369
Fat 80 compounds 373, 374, 400
hydrolysis 484 map 391
Index 559
parsnip 437 Forced wort test 450

stability 30 Foremasher 201
threshold 374, 387 Fork lift 353
training 391 Formula 44
unit 374–375, 382 molecular 51
wheel 376, 391 structural 57
Flocculation 314 Foundation water 203
premature 428 Free amino nitrogen (FAN) 31, 86,
Flow 225 210, 213
rate 226 Free radical 384
resistance 226 Friability 145
Fluid dynamics 225 Fructose 71
Fluidity, membrane 91 Fructose diphosphate 277
Fluorescence quenching 363 Fructose phosphate 275
Foam 30, 322, 403, 479 Fruit 437
analysis 412 Fungus 4, 12
coalescence 406
collapse 404–405 Galactose 72, 74, 77, 418
constant method 412 Gas
deterioration 404 blender 344
diffusion 406 compressed 346
disproportionation 405 constant 338
draining 405 cylinder 346
flash foam method 413 law 337
formation 404 leak 361
inhibitor 409 mixing 343
NIBEM method 413 mixture 339, 347
persistence 404 monitor 348
quality 407 purging 322
Rudin method 413 regulator 346
shake method 412 safety 347
sigma‐value 413 Gas chromatograph 326
stability 400 Gas chromatography/mass
stabilization 109, 407 spectroscopy 388
suppression 403 Gauge pressure 342
Foamability 407 elevation adjustment 342
Foam‐on‐beer (FOB) detector 343–344 Gaussian 462
Foeder 324 Gay‐Lussac, Joseph 19
Food and drug administration 28 Gelatin 336, 417
Food safety modernization act 28 Gelatinization 196
Force temperature 197
dipole‐dipole 55 Gelatinize 209
dispersion 56 Gene 97, 373
intermolecular 54 expression 100, 103
ion‐dipole 55 regulation 101
ion‐ion 55 Genetic information 88
London 56 Germination 3, 196, 380
stacking 56 Gibberellic acid 132
560 Index
Glucoamylase 212, 440, 456 Gruit 28, 148

Gluconobacter 436 Guanine 88
Glucose 71, 74–75, 77 Gum 75, 78
anomers 74 Gushing 419, 428
fermentation 63
phosphate 275 Hammer mill 221, 379
structure 70 Hand pump 336
Glutamine 415 Hanseatic league 445
Gluten‐free 136 Harden, Arthur 22
Gluten sensitivity 419 Hardness 200
Glycerol 80, 373 calcium 113
Glyceroyl phosphate 277 pipe scale 114
Glycogen 74, 77 temporary 116
Glycol 250, 344 Hazard
Glycolysis 74, 275 explosion 178
history 22 inhalation 181
Glycosidic 75 nip point 173
Glycosidic link 75, 187 Hazard analysis and critical control
Glycosylation 100, 103 points 28
Godin Tepe 18 Haze 28–29, 313, 398, 402,
Golgi apparatus 94 414, 428
Good manufacturing practices 28 chill 29
G protein‐coupled receptor 372 invisible 419
Grain 137, 220 protein polyphenol 415
cleaning 3 yeast 420
conditioning 178 Head retention 315, 405
conveyor 173 Heat 64, 283
desiccant 137 rate 233
drying 137 tolerant 438
herbicides 137 transfer 233
hulls 217 Heat exchanger 231, 233, 241, 250
moisture 137 efficiency 250
quality 137 plate 11, 250
spent 220 types 234
storage 137 HEDP. See 1‐Hydroxyethane
thief 140 diphosphonic acid (HEDP)
trier 168 Helicase 96
Gram stain 428 Helix, DNA 90, 95, 97
Grist 6, 179 Hemicellulose 77, 92
addition 201 degradation 78
case 201 Hemocytometer 473
evaluation 183 Henderson‐Hasselbalch equation 112
fractions 178 Henry’s law 340, 362, 388
sample 183 HEPA filter 446
storage 178 Heteroatom 58, 60
Group 40 Hexahydroisohumulone 160
carbonyl 61 Hexose 70
functional 59 High‐alcohol beer 388
Index 561
High gravity beer 115 terpenes 154

High gravity fermentation, tolerance 436
foam 411 tolerant 438
High performance liquid toxicity mechanism 445
chromatography 388 utilization 155, 158
Histogram 461 water content 156
Homofermentative 434 Hop acid
Honey 210 isomerize 247
Hops 3, 27, 69, 90, 157, 375 isomerized 384
addition 10 Hop back 245
alpha acids 151 DMS 380
alpha acid isomerization 152 Hop bitter acid, analysis 389
apparant bulk density 157 Hop bitter compounds 54
aroma 158 Hopper 170
aroma compounds 153, 376 Hose
bacteriostatic 445 deterioration 483
beta acids 152 inspection 450
bitterness 151 Hot break 10, 86, 100, 245
bulk density 156 Hot liquor tank 201
creep 249, 312 Hot side 6
doser 248 Hull 177
drying 156 Hulupone 152, 375
ester 376 Humilinone 152
extract 157 Humulene 154
flavor chemistry 151 Humulinone 249, 375
fresh 156 Humulone 151, 247
function 148 Hydrochlorofluorocarbons
history 148, 445 (HCFCs) 250
hop oil 153 Hydrogen 42
hydrogenated products 159 bond 83, 85
introduction 248 bonding 57, 90, 108
isomerization 151 ion 445
isomerized extract 159 peroxide 48, 488
isomerized kettle extract 158 sulfide 437
isomerized pellets 158 Hydrognenated hop acid 384
leaf 156, 245 Hydrolysis 70, 187
lupulone 152 Hydrolyze 3
malt beverage 148 Hydrometer 18, 270
noble 153 Hydronium ion 109
packaging 157 Hydroperoxyl radical 81
pellets 156, 245 Hydrophilic 82–83, 91, 109, 408
products 3, 248 Hydrophobic 79, 82–83, 91,
removal 157 109, 408
resistance 434 Hydroxide ion 109
resistant 437 1‐Hydroxyethane diphosphonic acid
sensitive 438 (HEDP) 486
stabilized pellets 158 Hydroxyl group 80
storage 156, 158 Hypothesis 23
562 Index
IBU. See International bitterness Jacket, cooling 283

units (IBU) Jet 481
Ideal gas law 338 scouring 481
limitations 338 Jockey box 341
Image analysis 366
Imhoff cone 251 Keg 332
Independent variable 24 cleaning 333–334, 336
Induced fit 190 dimensions 333
Infestation 168, 480 filling 334, 336
Insect 175, 428 Golden Gate 332
life cycle 175 Hoff‐Stevens 332
limits 176 neck 334
Interface 398, 403 retaining ring 333
Interfacial tension 486 sanitize 337
Intermolecular force, water 108 Sankey 332, 334
International bitterness units (IBU) servicing 333
375, 389 spear 332
Invertase 190 valves 332
Iodine test 203 weight 332
Iodophor 487 Keg coupling 333–334, 337
Ion 43 probe 333
brewing 114, 126 types 334
formation 43 Keg spear, valves 334
hydration 112 Ketone 62, 72
in water 112 Ketose 277
Ion exchange 116 Kettle 223, 231
regeneration 116 finings 418
Irish moss 232, 418 fouling 239
Iron 40 internally heated 241
Irritation 181 jacketed 240
Isinglass 315, 336, 415, 417 Keystone hole 335–336
Iso‐alpha acids 375, 445 Kieselguhr 319
bitter 371 Kilderkin 335
configuration 247 Kiln 3
degradation 248 Kilning 196
Isobutyl isobutyrate 154 Koji 189
Isocohumulone, harshness 152 Kolbach index 142
Isohumulone 375 Kosher 315
Isomer 57, 73–74 Kützing, Friedrich Traugott 20
geometric 59
stereo 72 Label 358
stereoisomer 59 can 352
structural 59, 71 Labeler 358
Isomerization types 358
alpha acid 247 Laboratory 182
rate 248 Lacing 406
Isoprene 376 analysis 413
Isotope 39 Lactic acid 434
Index 563
bacteria 432 Lipid transfer protein (LTP1) 408

sour 371 Lipoxygenase 178
Lactobacillus 93 Liquefaction 197
Lager beer, diacetyl 311 Liquor‐to‐grist ratio 203
Lager, vs. ale 13 Load cell 171
Lambic 371, 434 Local viscosity 410
Laminar flow cabinet 446 Lock and key 190
Laser 420 Lockout 181
Lauter 177, 179, 182, 375 Long‐draw 343
process 9 Lovibond 402
slow 78 Low alcohol 438
tun 9 LTP1. See Lipid transfer protein (LTP1)
Lautering 213 Luciferase 489
Lauter process, disadvantages 220 Luciferin 489
Lauter tun 204, 243 Luminescence 489
knives 219 Lung problems 181
Lavoisier, Antoine 19 Lupulin 69, 151, 156, 376
Le Châtelier’s principle 64, 110 Lupulone 152
Leuconostoc 434
Leuwenhoek, Antonie von 18 Macromolecule 69–70, 95
Lewis Magnesium 191
diagram 47 Magnet 181
structure 280 Maillard reactions 136, 232, 400
Liebig, Justus von 20 Maize 3, 134, 209–210
Light 395 Malt 2, 128, 428
absorption 396 amylase 147
amplitude 395 analysis 138, 144
color 397 bags 168
energy 396 base 133
frequency 395 caramel 135
scatttering 398 color 147
types 396 crystal 133, 135
wave 395 curing 132
wavelength 395 delivery 167
Light beer 213 diastatic power 146
Light scattering 419 distiller’s 134
Lightstruck 159, 374, 384, 401 drying 132
control 384 extract 143–144
Limit dextrinase 188, 212 FAN 142
Limonene 378 flavor 136
Linalool 378 float test 175
Linaool 154 floor 130
Linoleic acid 80 friability 145
Lintner 146 germination 130
Lipid 70, 79, 411 green 132
coagulation 236 infestation 168, 175–176
foam inhibitor 409 insect damage 175
number 80 inspection 168
564 Index
Malt (cont’d) infusion 206

oats 136 liquification 8
pH effect 137 pH 8
processed 135 purpose 7
quality 138 rest 204
roasted 133, 135 saccharification 8
rye 136 step 204
sampling 140 temperature 7, 198
slack 142 Mash‐in temperature 201
smoked 135 Mash‐lauter process 220
specialty 174 Mash‐out 78, 206
steeping 129 Mass
stewing 134 conservation 44
storage 168 fraction 51
transport 172 MBT. See 3‐Methylbut‐1‐thiol (MBT)
types 134 Mean 462
weighing 171 Mechanists 19
wheat 136 Media
Malt extract 210–211 enriched 454
Malting, loss 3, 131 growth 450, 454
Maltose 8, 75 nutrient 454
Maltotetraose 370 selection 454–455
Maltotriose 370 selective 454
Maltster 3 Medicinal 379
Malty 376 Medium, growth 450
Manganese ion 445 Megasphaera 437
Manifold 361 Melanoidins 136, 399, 409
Mannose 74, 77 color 400
Mannouronic acid 410 molar mass 400
Maple syrup 210 Membrane 80, 90, 372
Mash Meniscus 271
acid 200 Metal 42
buffering 200 Metal ion, foam 410
filter 243 Metallic luster 42
heating 203 Meter
mixing 203 pH 110, 124
test 143 TDS 124
thickness 203 Methylbutanal 388
tun 7, 178 3‐Methylbut‐1‐thiol (MBT) 159, 384
vessel 200 Methylene blue 453
Mash conversion vessel 7 Meura corporation 221
Mash filtration 9, 177, 180, 220 Meyerhof, Fritz 22
Nessie 221 Microbe 427
Mashing 3, 6–7, 77, 187, 217, 411 reduction 478
decoction 207 removal 316
double 207 Microbial
enzymes 197 contaminatiom 31
gelatinization 8 stabilization 440
Index 565
Microbiology 20 Monosodium glutamate 370

Microfiltration 117 Morphology 431–432
Microorganism 477 Mouth feel 369, 373, 379
contaminate 440 mRNA 97, 103
spoilage 440 synthesis 97
Micro RNA 103 Multi‐pack 359
Microscope 20 Mutation 96
Mill 201 rate 96
disk 182 Myloglucosidase 212
gap 178, 182 Myrcene 60, 154
hammer 177, 180
knife 182 NAD+ 22, 275, 277
laboratory 182 regeneration 278
maintenance 179, 181 NADH 277
multiple‐roller 178 oxidation 281
roller 177 Nanofiltration 117
speed 178 Negative control 25
two‐roller 178 Nessie 221
wet 178 Neuron 370
Milling 6, 177 Neutron 39
dry 178, 209 Nicotinamide adenosine
wet 210 dinucleotide 281
Mineral deposit 481 Ninhydrin 142
Mirror image 72 Nitric acid 485
Mixture 44, 51 Nitrogen 344
Modification 3, 131 liquid 322
Moisture Nitrogenated beer 322, 344,
after steeping 130 349, 411
in grain 129 faucet 349
malt 132, 142 Nitrogen generator 344, 348
Molarity 52 membrane 348
Molar mass 38, 51 Noble gas 42
Molasses 210 Nomenclature
Mold 170 ionic 46
Mole 50, 63 molecular compounds 49
Molecule 47, 50 nonsystematic 49
of element 48 Nonenal 81
energetic 279 Nonmetal 42
geometry 48, 52 bonding 47
motion 54 valency 47
polar 57 Non‐reducing end 198
rotation 54 Normal distribution 462
shape 53 Nuclear envelope 93
structure 57 Nuclear pore complex 93
translation 54 Nuclear regulatory commission 328
vibration 54 Nucleation sites 403
Monomer 70, 75 Nucleic acid 70
Monosaccharide 74 Nucleobase 61, 88
566 Index
Nucleolus 94 safety 251
Nucleotide 88, 97 solubility 251
sequence 96 yeast 251
Nucleus 38, 90, 93, 97 Ozone 488
size 38
Number prefix 49 Package
oxygen 353
Oat 2 rinse 354
Octet rule 43 Packaging 331, 350
Off‐flavors 231, 378, 384, 428, 446 line 360
alcohol 381 secondary 359
Olefin 60 steps 353
Olfactory 371 tertiary 359
Olfactory receptor 371 Packed bed 226
Olfactory receptor neuron 372 Pale ale, flavor 379
Optical rotation 20 Paleolithic 18
Organelle 90, 93 Pallet 359
Organic chemistry 59 Papain 418
Organic compound 49 free amino acid 418
Organoleptic 403 Paraffin 60
Original gravity 271 Parnas, Yakov Oskarovich 22
Oscillating density meter 272 Partial pressure 63, 341
Osmosis, reverse 117 Particle size distribution 182–184
Osmotic Pasteurization 316, 358, 418, 440–441
pressure 92 discovery 21
stress 210 flash 336, 442–443
Overcarbonation 344, 428, 437 flavor impact 444
Oxalate 113, 419 pressure 443
Oxidant 478 resistance 442
Oxidase test 428 tunnel 442
Oxidation 280, 387 unit 441
number 280 wort 441
Oxidizing agent 387 Pasteurized, flash 353
Oxonium ion 192 Pasteurizer, flash 233
Oxygen 31, 281 Pasteur, Louis 20, 441
aging 323 Path length 397
alarm 348 Pauling, Linus 50
dissolved 11, 362 Payen, Anselme 20
hammer 251 PCR. See Polymerase chain reaction
headspace 362 (PCR)
Henry’s law constant 340 Pearlite 419
meter 363 Pectinatus 438
moniter 348 Pediococcus 93, 434
as nutrient 11 Pentanedione 310
package 353, 383 Pentosan 78–79
reactive 81 Pentosanase 213
Index 567
Peracetic acid 487 Polar 50, 53

Period 40 Polarity
valence 40 bond 54
Periodic table 40, 371 molecule 54
hydrogen 42 Polarizability 56
table 41 Poly A tail 98
Periodic trends 42 Polyatomic ion 46
Perlite 317, 319 Polymer 69–70, 77, 88, 400
Permanent haze 416 Polymerase chain reaction (PCR) 456
Permeability 226 Polypeptide 83, 88, 418
Peroz, Jean 20 Polyphenols 178, 315, 379, 415–416
Personal protective equipment 181, 484 removal 232
Pfungstadt 184 Polysaccharide 75
PGA. See Propylene glycol alginate Polyvinylpolypyrrolidone 417
(PGA) Polyvinylpolypyrrolidone
pH 110, 371 (PVPP) 417
hardness effect 113 with silica gel 417
highest and lowest 111 Positive control 25
indicator 450 Post‐translational modification 100, 103
mash 199 Precoat 316
mashing 113 Premasher 201
meter 110 Press juice 22
Phase diagram 237 Pressure 54
Phenol 61 Pressure drop 226
Phenolic 177, 381 Pressure regulator 320
flavor 372 Pressure relief valve 346, 484
off‐flavor 439 Pressure swing adsorption 348
Phosphate 88 Primary structure 83
Phosphate ester 91 Primer 456
Phosphoenol pyruvate 278 RNA 96
Phospholipid 80, 91 Proanthocyanidin 315, 415
Phospholipid bilayer 93 Probability 462
Phosphoric acid 277 Probability distribution 461, 466
Phosphorylation 100, 103 Process, control 466
Piercing 362 Process gas, contamination 450
Pilsner 375 Processing aid 211
Pipe Product 44, 62
fitting 479 Prokaryote 93, 95, 431
layout 480 Proline 315, 415, 419
scale 114 Pro‐protein 100
Pitching 12 Propylene glycol 250, 287, 344
Plating 450 Propylene glycol alginate (PGA) 31,
Plato 64 410, 415
POF+ 439 Protease 94, 213
Points 144 Protease rest 205
Poisson distribution 466 Proteasome 103
568 Index
Proteins 3, 57, 70, 82–83, 142, 315, 416 Reaction quotient 63

chaperone 100 Reactive oxygen species 81
coagulate 86 Recall 337, 350
coagulation 236 Receptor 102
denature 86 olfactory 372
3‐D structure 83 taste 370–373
foam 213 Receptor protein 372
folding 100, 109 Reduced gluten 419
free amino nitrogen 142 Reducing end 188
function 86 Reduction 280
in membrane 92 Refraction 398
removal 232 Refractive index 270, 273, 398
sequence 96 Refractometer 273
transmembrane 372 Refrigerant 288
Protein Z 408 classes 290
Proteolysis 100, 103, 196 Refrigeration 12, 233, 289
Proton 39–40, 109–110 cycle 289
PVPP. See Polyvinylpolypyrrolidone Regulation 27
(PVPP) Regulator 347, 361
Pycnometer 272 gas seals 348
Pyruvic acid 278 thread tape 348
Python 343–344 Reinheitsgebot 27, 132, 189, 212
Replication 95–97
Quality 1–2 Resistance temperature detector
cleaning 489–490 (RTD) 291
color 401–403 Respiration 3, 74
conditioning 325–328 Rho isohumulone 160
definitions 27–32 Ribes 383
dispense 360–362 Riboflavin 399–400
flavor 388–391 Ribose 88
foam 412–414 Ribosome 100, 103
grain and malt 137–148 Rice 2, 134, 209
grist 182–185 Rice hulls 211
haze 420–423 Rinse, pH 490
hops 160–162 RNA 55, 70, 88, 95
mathematics 461–476 polymerase 97
microorganisms 446–457 primase 96
package 362–366 Rope 434
water 124–125 Rotten egg 438
Quality control, conditioning 325 RTD. See Resistance temperature
Quaternary structure 86 detector (RTD)
Ruh beer 309
Reactant 44, 62 Rye 2
Reaction 44, 62–63
addition 60 Saccharomyces
rate 64 S. cerevisiae 4, 13
temperature 54, 64 S. pastorianus 4, 13
Index 569
Safety 172 Second messenger 372

boiling 236–237 Sedimentation 10, 314, 336
consumer 28 Seed coat 7, 177
conveyor 173 Selective membrane 363
beer 440 Selectivity 65
beer pH 371 Semi‐conservative 95
diatomaceous earth 319 Sensory
dispense 361 bias 390
draff 228 laboratory 391
fork lift 353 panel 388
gas 347 tests 391
keg 332–333, 337 training 369
mill 181 Sequestrant 486
pasteurizer 443 threshold 486
pressure relief valve 284, 484 Serving 331
salt addition 122 Shank 346
Sake 189 Shelf life 309, 427
Salty 370–371 Shipping, cans 352
Sample Shive hole 335
point 447 Sieve 3, 156, 179, 183
representative 26 system 184
size 26 Signaling 82
Samples in groups 463 Signal sequence 100
Sampling, zwickel 448 Silica gel 417
Sanitary design 479 Silicon bandgap sensor 292
Sanitize 337, 428 Silo 168, 172
caps and lids 357 Single‐stranded binding
filler 362 protein 96
Sanitizer 354, 487 Sinner circle 478
acid 487 Skunked beer 384
Sanitizing 478 Small regulatory RNA 103
Sankey 332 S‐methyl methionine 380
Saturated 80 S‐methylthiohexanoate 154
Scale 486 Sodium
Schiff base 136, 376, 400 channel 373
Schlitz Beer 31 chloride 45
Schwann, Theodor 20 hypochlorite 488
Scientific method 23 metasilicate 485
Screen, standard 141 Sodium hydroxide 234, 484
Seam safety 484
testing 365 Softening
thickness 365 boiling 116
Seamer lime 116
chuck 357 Soils 478
roller 357 Solubility 55, 57, 79
Seaming, can 357 Sørensen, Søren 110
Secondary structure 83 Sour 370
570 Index
Sparge 181, 223, 375, 379 quality 239

stuck 78 saturated 237
Sparging 9 superheated 237
Spear 332 trap 239
assembly 334 Steam boiler, water 115
body 334 Steel’s masher 202
drop‐in 332 Steep 3
ejection 333 Sterile 487
ring 333 filtration 353, 444
threaded 332 Steroid 80
Specification 467 Sterol 91
Specific gravity 269–270 Stillage 336
Specificity 65, 189 Strain gauge 171
Spectrophotometer 401 S/T ratio 142
Speed Streaking, plate 452
enzyme 191 Strecker degradation 31, 387
of light 398 Strength, mechanical 77
Spirochete 431 Stress response 101
Spoilage 148, 427, 440, 456 Strike temperature 201
sources 427 calculation 207
Spoilage organism 418 Structure
detection 449 condensed 58
Spontaneous 64 Lewis 57
Spray ball 481 skeletal 58
Sprayer 481 Style characteristic 378, 384
Spray shadow 482, 489 Sucrose 370
Stability 427 Sugar 73, 75, 77, 196, 336
Stabilization 309 fermentable 187
Stacking force 417 formula 70
Stahl, Georg Ernst 18 open chain 72
Stainless steel 64, 114, 223, 233, 234, 251, taste 370
282, 283, 320, 325, 479, 485, 487, 488 Sugar molecule, numbering 72
cask 335 Sulfite 81
keg 332 Sulfur, aroma compounds 154
Stale 81 Sulfur compounds 381
Staling 30, 378, 383, 400 Super sack 170, 172
Standard deviation 462, 463, 466 Supersaturate 443
Starch 1, 7, 70, 75, 177, 187 Surface 56, 403
hydrolysis 70, 189 energy 403
structure 187 tension 403
Statistical probability 26 Surfactant 478, 486
Statistics 461–466 Sweet 370
Steam 231 Sweetness, beer 370
boiler 233
culinary 243 Tannin 120, 125, 143, 146, 177, 185, 217,
distillation 249 223, 224, 373, 375, 411
engine 18 Tap 336
jacket 237 Tap room 342
Index 571
Taste 54, 369 Transglutaminase 419

bitter 151 Translation 95
bud 370 Transmittance 397
receptor cell 370 Triacylglycerol 80
testing 389 Tri‐clamp 479
TAVB. See Thermostatic air vent‐ Trier 140
vacuum breaker (TAVB) Triglyceride 80
Tax and Trade Bureau 28 Trioxidane 48
Taxation 28 Troubleshooting 23, 27
Temperature Trub 10, 231, 245, 418
controller 287 lipid content 82
gradient 233 True‐to‐type 29, 32
Kelvin 338 Tubing, barrier 344
mash 198 Turbid 434, 437
sensor 283, 291–292 Turbidity 420, 428
Temperature control 287, 291 Turbulence 294, 349, 350, 479
on‐off 291 Turbulent flow 235, 443, 479, 483
PID 291
proportional 291 Ubiquitin 103
Terpenes 154, 376 Ultrafiltration 117
Terpenoid 376 Umami 370–371
Tertiary structure 83, 100 Uncrating 354
Tetra hydroxyisohumulone 160 Uracil 88
Texture 30 Urea, synthesis 20
Thenard, Louis 19
Thermal conductivity 233 Vacuole 94
table 234 Valence electron 52
Thermistor 291 Valency 38, 47–48
Thermocouple 291 Valine 313
reference junction 292 Valve
Thermometer 18 butterfly 172
Thermostatic air vent‐vacuum breaker gate 172
(TAVB) 237 inspection 450
Threose 73 iris 170, 172
Threshold 369 protector 347
Titration 124 van der Waals 54
Top fermenting 13 Vanillin 325
Topoisomerase 96 Vapor
Torrified 210 pressure 63, 237
Total dissolved solids 124 recompression 245
Transamination 381 Variables, uncontrolled 25
Transcription 95, 97 Variation 461
elongation 97 v‐curve 360
factor 102, 372 VDK. See Vicinal diketones (VDK)
initiation 97 Vegan 315
termination 97 Ventilation 181
Transcriptional control 102 Vesicles 94
Transcription factor signaling 102 Vicinal diketones (VDK) 310, 383
572 Index
Vinegar 435–436 Wheat 2
Vinyl guaiacol 61, 213, 381, 439 Whirlpool 10, 231, 245
Vinylphenol 439 DMS 380
Viscometer 145 eddy 246
Viscosity 78, 196, 400, 410 Widget 350
Visual impression 395 Windisch‐Kolbach 146
Vitalists 19 Wöhler, Friedrich 20
Vitamin 80 Wort 6, 75, 86
Voltage gated sodium channel 373 caramelization 239
Volume fraction 52 clarification 245
Vorlauf 219 oxygen solubility 251
spoilage 441
Water 48, 108, 316, 428, 484 sterilize 441
alkalinity 112, 137 storage 441
alkalinity measurement 124 stripping 246
analysis 118 viscosity 145
boiler 115 weak 224
contamination 449 Wort separation 6–7, 9, 217, 316, 411
dealkalization 116
degrees of hardness 118 Xylose 78–79, 213
dilution 115
filter 115 Yeast 4, 12, 90, 427
hardness 113 autolyse 376
hardness measurement 124 harvesting 285
heat fusion 108 immobilized 312
heat vaporization 108 propagation 441
hydrogen bond 108 removal 316
iron removal 117 species 13
manganese removal 117 strain 4
molecule 108 vitality 74
phases 108 wild 439
polarity 108
reverse osmosis 117 Ziemann Holvrieka company 221
specifications 449 Zinc 191, 210
specific heat 108 Z‐score, limits 463
standards 115 Zwickel 283
tasting 125 contaminant 438
treatment 115, 125 sampling 448
Wax 80 sanitary 448
Weevil 175 Zymase 22
Weizenbier 61 Zymomonas 437
WILEY END USER LICENSE
AGREEMENT
Go to www.wiley.com/go/eula to access Wiley’s ebook EULA.

Farber, Matthew - Barth, Roger - Mastering Brewing Science - Beer Production and Quality-John Wiley & Sons (2019)

Uploaded by

Copyright:

Available Formats

Farber, Matthew - Barth, Roger - Mastering Brewing Science - Beer Production and Quality-John Wiley & Sons (2019)

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Farber, Matthew - Barth, Roger - Mastering Brewing Science - Beer Production and Quality-John Wiley & Sons (2019)

Uploaded by

Copyright:

Available Formats

MASTERING BREWING

About the Authors xi

1 BREWING QUALITY OVERVIEW 1

2.6 Organic Chemistry and Functional Groups 59

4 RAW MATERIALS 107

5 GRAIN HANDLING AND MILLING 167

7 WORT SEPARATION 217

7.3 Lipid Removal 227

8 BOILING, WORT CLARIFICATION, AND CHILLING 231

11 PACKAGING AND SERVING 331

11.3 Keg Dispense System 341

13 COLOR, FOAM, AND HAZE 395

14 BIOLOGICAL STABILITY 427

15 MATHEMATICS OF QUALITY 461

Check for Understanding 475

16 CLEANING, CIP, AND SANITIZATION 477

Matthew Farber, PhD, is the program director of the Brewing Science

Brewing is a creative art. Underlying that art is a framework of technical

BREWING QUALITY OVERVIEW

Mastering Brewing Science: Quality and Production, First Edition.

1.2 BREWING OVERVIEW

A graphical overview of the brewing process is provided in Figure 1.1. In brief:

mashing wort separation

premasher grist case

TABLE 1.1 Brewing Steps, Durations, and Temperatures

Figure 1.2 Brew house at Victory Brewing Company.

Milling Malt is delivered to breweries in bulk or in bags. Before use in

Figure 1.3 Mill at Susquehanna Brewing Company.

Mashing During the mashing step, starch is converted to smaller sugars

Figure 1.4 Inside the mash tun at Victory Brewing Company.

• Isomerization of hop compounds for bitterness.

Boiling generates solid material called hot break or trub (“troob”).

Figure 1.6 Brew kettle at Yuengling Beer Company.

Chilling Before fermentation, the temperature of the wort must be lowered

Figure 1.7 Chiller at Philadelphia Brewing Company.

Fermentation Cooled, aerated wort from the chiller is transferred to a

Figure 1.8 Caves at Yuengling Beer Company.

Figure 1.9 Fermentation vessels in the cellar at Susquehanna Brewing Company.

to the main reaction, fermentation is accompanied by a variety of side reactions

sediment. It may be clarified in a centrifuge. It may be filtered, often through

Figure 1.10 Kegs (straight‐sided vessels) and casks at Philadelphia Brewing.

TABLE 1.2 US Beer Packages

Figure 1.11 Packaging line at Victory Brewing Company.

1.3 A SCIENTIFIC HISTORY OF BREWING

TABLE 1.3 Traditional Beers from Around the World

of the phlogiston theory of combustion, postulated that the violent activity

Pasteur was an outstanding experimentalist. He established that fermenta­

MUSINGS ON THE HISTORY OF BEER…

“It is much more productive to study a process in chemical glassware than in

“After drinking beer from said process, my neurons say otherwise.”

Building upon Buchner’s discoveries, Arthur Harden (1865–1940) dis­

(1884–1951), and Yakov Oskarovich Parnas (1884–1949). Glycolysis in some

The Scientific Method

Let us use troubleshooting an issue in the brewery as an example of the

1. Make an observation. You have noticed that fermentation stalled in the

fermentation will stall.” It is important to consider that the hypothesis

Clearly, if a hypothesis cannot be tested, it cannot be supported by evi­

Figure 1.14 Cumulative outcomes of marble draws.

1.4 INTRODUCTION TO BEER QUALITY

About the Authors xi

Pasteur was an outstanding experimentalist. He established that fermenta

Building upon Buchner’s discoveries, Arthur Harden (1865–1940) dis

Clearly, if a hypothesis cannot be tested, it cannot be supported by evi

c orresponds to 52.14% carbon by mass. Because mass is conserved, the