(Methods in Molecular Biology 1290) Anoop Kumar, András Simon (Eds.) - Salamanders in Regeneration Research - Methods and Protocols

Methods in
Molecular Biology 1290
Anoop Kumar
Andrs Simon Editors
Salamanders
in Regeneration
Research
Methods and Protocols
METHODS
IN
M O L E C U L A R B I O LO G Y
Series Editor
John M. Walker
School of Life and Medical Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
For further volumes:

http://www.springer.com/series/7651
Salamanders in Regeneration
Research
Methods and Protocols
Edited by
Anoop Kumar
Institute of Structural and Molecular Biology, Division of Biosciences,
University College London, London, UK
Andrs Simon
Department of Cell and Molecular Biology, Karolinska Institute, Stockholm, Sweden
Editors
Anoop Kumar
Institute of Structural and Molecular
Biology, Division of Biosciences
University College London
London, UK
Andrs Simon
Department of Cell and Molecular Biology
Karolinska Institute
Stockholm, Sweden
ISSN 1064-3745
ISSN 1940-6029 (electronic)
Methods in Molecular Biology
ISBN 978-1-4939-2494-3
ISBN 978-1-4939-2495-0 (eBook)
DOI 10.1007/978-1-4939-2495-0
Library of Congress Control Number: 2015931955
Springer New York Heidelberg Dordrecht London
Springer Science+Business Media New York 2015
This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to
be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty,
express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.
Printed on acid-free paper
Humana Press is a brand of Springer
Springer Science+Business Media LLC New York is part of Springer Science+Business Media (www.springer.com)
Preface
Many of the most fundamental discoveries in experimental biology, such as the embryonic
organizers, neuronal specificity, nerve guidance, and units of DNA transcription, originate
from salamander research. Salamanders are the only tetrapods capable of repeatedly regenerating entire limbs as adults, and they also display the widest range of regeneration capacities of other complex tissues and organs. These animals constitute unique models for
understanding critical processes underlying morphological and functional restoration of
lost or damaged structures in vertebrates. The present volume focuses on this particular
aspect of salamander biology, which has gained new momentum during the past 1015
years, partly due to the general interest in stem cells and regenerative medicine. A combined
search on Google scholar using the terms salamander and regeneration shows a steady
growth in the number of yearly publications with a 140 % increase between 2001 and 2013,
resulting in more than 10,000 published articles during this period.
There are considerable variations among the most commonly studied salamanders in
the laboratory in terms of their general physiology, life cycle, regeneration spectrum, and
also mechanisms by which replacement structures form. The first part of the book outlines
the best practices and conditions for maintaining the most commonly used salamander species in the laboratory. The chapters of the two following parts describe experimental manipulations in vivo and in vitro, respectively. These include methods targeting a wide variety of
structures, ranging from the limb to the heart and to the brain. The two final sections deal
with genetically modified organisms and tools for mining in the genomic databases. These
chapters illustrate the boom of recent technical developments, which provide new platforms for understanding salamander regeneration using the most modern molecular tools.
The methods chapters of this book are preceded by an inspiring essay on salamander regeneration from phylogenetic and evolutionary perspectives by Jeremy Brockes, who has
greatly contributed to revitalize this research field.
Finally, we thank all the colleagues for their invaluable time and efforts to provide with
all the finer details to produce this comprehensive collection of methods chapters. We
hope that this collection will be useful to all, who already are devoting our activities to
salamander regeneration, as well as for those who are just considering to dwell on to this
intriguing problem.
London, UK
Stockholm, Sweden
Anoop Kumar
Andrs Simon
Contents
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
PART I
SALAMANDERS
1 Variation in Salamanders: An Essay on Genomes, Development,

and Evolution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Jeremy P. Brockes
2 Maintaining Eastern Newts (Notophthalmus viridescens)
for Regeneration Research . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Hans-Georg Simon and Shannon Odelberg
3 Housing and Maintenance of Ambystoma mexicanum,
the Mexican Axolotl . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Johanna E. Farkas and James R. Monaghan
4 Husbandry of Spanish Ribbed Newts (Pleurodeles waltl ) . . . . . . . . . . . . . . . . .
Alberto Joven, Matthew Kirkham, and Andrs Simon
5 Maintaining Plethodontid Salamanders in the Laboratory
for Regeneration Studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Claudia Marcela Arenas, Andrea Gmez-Molina,
and Jean Paul Delgado
PART II
v
ix
17
27
47
71
EXPERIMENTAL MANIPULATION IN SALAMANDERS
6 Newt Lens Transdifferentiation: From Lentectomy to Immuno-FISH . . . . . . .

Nobuyasu Maki
7 Studying Newt Brain Regeneration Following Subtype Specific
Neuronal Ablation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Matthew Kirkham and Alberto Joven
8 The Accessory Limb Model: An Alternative Experimental System
of Limb Regeneration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Tetsuya Endo, David M. Gardiner, Aki Makanae, and Akira Satoh
9 High-Efficiency Electroporation of the Spinal Cord in Larval Axolotl . . . . . . .
Aida Rodrigo Albors and Elly M. Tanaka
10 Pseudotyped Retroviruses for Infecting Axolotl . . . . . . . . . . . . . . . . . . . . . . . .
Tzu-Hsing Kuo and Jessica L. Whited
11 Thyroxine-Induced Metamorphosis in the Axolotl
(Ambystoma mexicanum) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Peggy S. Coots and Ashley W. Seifert
12 Generation of Aneurogenic Larvae by Parabiosis of Salamander Embryos . . . .
Anoop Kumar and Jean Paul Delgado
vii
81
91
101
115
127
141
147
viii
Contents
13 In Vivo Modulation and Quantification of microRNAs

During Axolotl Tail Regeneration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Jami R. Erickson and Karen Echeverri
PART III
SALAMANDER CELLS IN CULTURE
14 Derivation and Long-Term Culture of Cells from Newt Adult Limbs

and Limb Blastemas . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Patrizia Ferretti and Anoop Kumar
15 Culture and Transfection of Axolotl Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Jean-Franois Denis, Fadi Sader, Patrizia Ferretti, and Stphane Roy
16 Isolation and Culture of Neurospheres from the Adult Newt Brain . . . . . . . . .
Liyakath Ali Shahul Hameed and Andrs Simon
17 Methods for Axolotl Blood Collection, Intravenous Injection,
and Efficient Leukocyte Isolation from Peripheral Blood
and the Regenerating Limb. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Ryan J. Debuque and James W. Godwin
18 Assessing Cardiomyocyte Proliferative Capacity in the Newt Heart
and Primary Culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
19 Long-Term Organ Cultures of Newt Hearts . . . . . . . . . . . . . . . . . . . . . . . . . .
Tanja Piatkowski and Thomas Braun
20 In Vitro Preparation of Newt Inner Ear Sensory Epithelia as a Model
for Repair and Regeneration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Ruth R. Taylor
PART IV
171
187
197
205
227
241
253
TRANSGENESIS IN SALAMANDERS
21 Transgenesis in Axolotl (Ambystoma mexicanum) . . . . . . . . . . . . . . . . . . . . . .

Shahryar Khattak and Elly M. Tanaka
22 Generating and Identifying Axolotls with Targeted Mutations
Using Cas9 RNAGuided Nuclease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
G. Parker Flowers and Craig M. Crews
23 Gene Manipulation for Regenerative Studies Using the Iberian
Ribbed Newt, Pleurodeles waltl . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Toshinori Hayashi and Takashi Takeuchi
PART V
159
269
279
297
GENE EXPRESSION
24 Transcriptomics Using Axolotls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

S. Randal Voss, Antony Athippozhy, and M. Ryan Woodcock
25 Sal-Site: Research Resources for the Mexican Axolotl . . . . . . . . . . . . . . . . . . .
Nour W. Al Haj Baddar, M. Ryan Woodcock, Shivam Khatri,
D. Kevin Kump, and S. Randal Voss
26 Data Mining in Newt-Omics, the Repository for Omics Data
from the Newt . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Mario Looso and Thomas Braun
309
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
353
321
337
Contributors
ANTONY ATHIPPOZHY, PH.D. Department of Biology, University of Kentucky, Lexington,
KY, USA
NOUR W. AL HAJ BADDAR Department of Biology, University of Kentucky, Lexington,
KY, USA
LIYAKATH ALI SHAHUL HAMEED Department of Cell and Molecular Biology,
Karolinska Institute, Stockholm, Sweden
THOMAS BRAUN, PH.D. Max-Planck-Institute for Heart and Lung Research, Bad Nauheim,
Germany
JEREMY P. BROCKES, PH.D. Institute of Structural and Molecular Biology, Division of
Biosciences, University College London, London, UK
CLAUDIA MARCELA ARENAS Grupo Gentica, Regeneracin y Cncer, Instituto
de Biologa. Universidad de Antioquia, Medelln, Colombia
PEGGY S. COOTS Department of Biology, University of Kentucky, Lexington, KY, USA
CRAIG M. CREWS, PH.D. Department of Molecular, Cellular and Developmental Biology,
Yale University, New Haven, CT, USA
RYAN J. DEBUQUE Australian Regenerative Medicine Institute (ARMI),
Monash University, Clayton, VIC, Australia
JEAN PAUL DELGADO, PH.D Grupo Gentica, Regeneracin y Cncer, Instituto de Biologa.
Universidad de Antioquia, Medelln, Colombia
JEAN-FRANOIS DENIS Department of Biochemistry, Faculty of Medicine,
Universit de Montral, Montral, QC, Canada
KAREN ECHEVERRI, PH. D. Department of Genetics, Cell Biology and Development,
Stem Cell Institute, University of Minnesota, Minneapolis, MN, USA
TETSUYA ENDO, PH.D. Division of Liberal Arts and Sciences, Aichi Gakuin University,
Nissin, Aichi, Japan
JAMI R. ERICKSON Department of Genetics, Cell Biology and Development, Stem Cell
Institute, University of Minnesota, Minnesota, USA
JOHANNA E. FARKAS Department of Biology, Northeastern University, Boston, MA, USA
PATRIZIA FERRETTI, PH.D. UCL Institute of Child Health, University College London,
London, UK
G. PARKER FLOWERS, PH.D. Department of Molecular, Cellular and Developmental
Biology, Yale University, New Haven, CT, USA
DAVID M. GARDINER, PH.D. Department of Developmental and Cell Biology, University
of California, Irvine, CA, USA
JAMES W. GODWIN, PH.D. Australian Regenerative Medicine Institute (ARMI),
Monash University, Clayton, VIC, Australia
ANDREA GMEZ-MOLINA Grupo Gentica, Regeneracin y Cncer, Instituto de Biologa.
Universidad de Antioquia, Medelln, Colombia
TOSHINORI HAYASHI, PH.D. Department of Biomedical Sciences, School of Life Science,
Faculty of Medicine, Tottori University, Tottori, Japan
ALBERTO JOVEN, PH.D. Department of Cell and Molecular Biology, Karolinska Institute,
Stockholm, Sweden
ix
Contributors
SHIVAM KHATRI Paul Laurence Dunbar High School, Lexington, KY, USA
SHAHRYAR KHATTAK, PH.D. Technische Universitt Dresden, DFG Center for Regenerative
Therapies Dresden, Dresden, Germany
MATTHEW KIRKHAM, PH.D. Department of Cell and Molecular Biology, Karolinska
Institute, Stockholm, Sweden
ANOOP KUMAR, PH.D. Institute of Structural and Molecular Biology, Division of
Biosciences, University College London, London, UK
D. KEVIN KUMP Department of Biology, University of Kentucky, Lexington, KY, USA
TZU-HSING KUO Brigham Regenerative Medicine Center and the Department
of Orthopedic Surgery, Brigham & Womens Hospital, Cambridge, MA, USA; Harvard
Medical School, Harvard Stem Cell Institute, Cambridge, MA, USA
MARIO LOOSO, PH.D. Max-Planck-Institute for Heart and Lung Research, Bad Nauheim,
Germany
AKI MAKANAE, PH.D. Research Core for Interdisciplinary Sciences (RCIS), Okayama
University, kitaku, Okayama, Japan
NOBUYASU MAKI, PH.D Institute of Protein Research, Osaka University, Osaka, Japan
JAMES R. MONAGHAN, PH.D. Department of Biology, Northeastern University, Boston,
MA, USA
SHANNON ODELBERG, PH.D. Molecular Medicine Program, Eccles Institute of Human
Genetics, Department of Internal Medicine, Cardiology Division, University of Utah,
Salt Lake City, UT, USA
TANJA PIATKOWSKI Max-Planck-Institute for Heart and Lung Research, Bad Nauheim,
Germany
AIDA RODRIGO ALBORS, PH.D. DFG Center for Regenerative Therapies TU Dresden
(CRTD), Technische Universitt Dresden, Dresden, Germany
STPHANE ROY, PH.D. Department of Stomatology, Universit de Montral, Montral,
QC, Canada
FADI SADER Department of Biochemistry, Faculty of Medicine, Universit de Montral,
Montral, QC, Canada
AKIRA SATOH, PH.D. Research Core for interdisciplinary sciences (RCIS),
Okayama University, Okayama, Japan
ASHLEY W. SEIFERT, PH.D. Department of Biology, University of Kentucky, Lexington,
KY, USA
ANDRS SIMON, PH.D. Department of Cell and Molecular Biology, Karolinska Institute,
Stockholm, Sweden
HANS-GEORG SIMON, PH.D. Department of Pediatrics, Lurie Childrens Hospital
of Chicago Research Center, Northwestern University Feinberg School of Medicine,
Chicago, IL, USA
TAKASHI TAKEUCHI, PH.D. Department of Biomedical Sciences, School of Life Science,
Faculty of Medicine, Tottori University, Yonago, Tottori, Japan
ELLY M. TANAKA, PH.D. DFG Center for Regenerative Therapies TU Dresden (CRTD),
Technische Universitt Dresden, Dresden, Germany
RUTH R. TAYLOR, PH.D. UCL Ear Institute, University College London, London, UK
S. RANDAL VOSS, PH.D. Department of Biology, University of Kentucky, Lexington, KY, USA
JESSICA L. WHITED, PH.D. Harvard Medical School, Harvard Stem Cell Institute,
Cambridge, MA, USA
M. RYAN WOODCOCK, PH.D. Department of Biology, University of Kentucky,
Lexington, KY, USA
Part I
Salamanders
Chapter 1
Variation in Salamanders: An Essay on Genomes,
Development, and Evolution
Jeremy P. Brockes
Abstract
Regeneration is studied in a few model species of salamanders, but the ten families of salamanders show
considerable variation, and this has implications for our understanding of salamander biology. The most
recent classification of the families identifies the cryptobranchoidea as the basal group which diverged in
the early Jurassic. Variation in the sizes of genomes is particularly obvious, and reflects a major contribution from transposable elements which is already present in the basal group. Limb development has been
a focus for evodevo studies, in part because of the variable property of pre-axial dominance which distinguishes salamanders from other tetrapods. This is thought to reflect the selective pressures that operate on
a free-living aquatic larva, and might also be relevant for the evolution of limb regeneration. Recent fossil
evidence suggests that both pre-axial dominance and limb regeneration were present 300 million years ago
in larval temnospondyl amphibians that lived in mountain lakes. A satisfying account of regeneration in
salamanders may need to address all these different aspects in the future.
Key words Newt, Axolotl, Limb regeneration
Introduction
This collection of articles is about regeneration in salamanders and
various experimental approaches for working with these animals. It
is largely focused on the axolotl and some species of newt, which are
the two most widely used laboratory animals. The newt and axolotl
fall into two of the ten families of salamanders, and regeneration
research is mainly concerned to identify common, ancestral, or unifying aspects of the underlying mechanisms. In a recent study that
provided an interesting perspective, the origin of muscle-derived
cells in the limb blastema was traced to satellite cells in the axolotl,
but to multinucleate myofibers in the newt [1]. Salamanders present considerable variation between and within families in certain
aspects of their biology, and this chapter explores some examples. I
will also consider the related problems of diversity in salamander
genomes and in embryonic and larval development. The origin of
salamanders is discussed in relation to the fossil evidence from dif-
Anoop Kumar and Andrs Simon (eds.), Salamanders in Regeneration Research: Methods and Protocols, Methods in Molecular
Biology, vol. 1290, DOI 10.1007/978-1-4939-2495-0_1, Springer Science+Business Media New York 2015
Jeremy P. Brockes
Batrachoseps major
30 nuclear genes
Eurycea bislineata
(total 27,834 bp)
Aneides hardii
Plethodontidae
Amphiuma means
0.1 subsititutions/site
Rhyacotriton variegatus
Amphiumidae
Rhyacotritonidae
Necturus beyeri
Proteus anguinus
Proteidae
Cynops orientalis
Tylototriton asperrimus
Salamandridae
Salamandroidea
Plethodon jordani
Salamandra salamandra
99/1.0/1.0/83
1
Dicamptodon aterrimus
Ambystoma mexicanum
Dicamptodontidae
Ambystomatidae
Pseudobranchus axanthus
Sirenidae
Batrachuperus yenyuanensis
Ranodon sibiricus
99/1.0/1.0/74
Hynobiidae
Onychodactylus fischeri
Andrias davidianus
Cryptobranchidae
Bombina fortinuptialis
Cryptobranchoidea
Siren intermedia
ANURA
Silurana tropicalis
Ichthyophis bannanicus
Typhlonectes natans
GYMNOPHIONA
Gallus gallus
Chrysemys picta bellii
Mus musculus
Homo sapiens
Non-amphibian
Outgroup
Latimeria chalumnae
Fig. 1 This tree is taken from Shen et al. [4] and shows the tree for the 10 salamander families based on the
analysis of 30 genes in the 19 species shown here. Note that the basal group comprises the hynobiid and
cryptobranchid salamanders
ferent Paleozoic amphibians. I suggest that ultimately it will be necessary to understand the evolution of regenerative ability in
conjunction with these different aspects of salamander biology.
The ten families have historically been grouped into different
trees using a variety of approaches [2, 3], but perhaps the most
compelling of these has been the recent molecular analysis by
Zhang and colleagues [4]. It employed 30 nuclear protein-coding
loci that were identified by PCR from 19 salamander species
representing the 10 families. The resulting tree is shown in Fig. 1.
Variation in Salamanders: An Essay on Genomes, Development, and Evolution
According to this analysis, the first group to diverge from the

lineage of extant salamanders were the Cryptobranchoidea,
composed of two families, the Hynobiidae and the
Cryptobranchidae. The time at which the split occurred can be
estimated from molecular dating to be approximately 190200 million years ago (MYA) at about the beginning of the Jurassic
(P. Zhang, personal communication). The two families lack internal fertilization with a spermatophore which is found in all other
salamanders, with the possible exception of the Sirenidae [5].
From this and other analyses, hynobiids and cryptobranchids seem
to be the most basal group of modern crown-group salamanders.
The Cryptobranchidae are giant aquatic salamanders found in the
eastern USA, China, and Japan. The Hynobiidae are land-living
salamanders from Central and Eastern Asia.
The family Plethodontidae, sometimes referred to as the lungless
salamanders, is noteworthy from the viewpoint of variation [6, 7].
There are more species of plethodontids than the sum of all the other
families. They include aquatic, terrestrial, and arboreal forms and are
almost all found in the New World. The variation in genome size
(haploid DNA content) is about sevenfold, so they are an important
resource for evaluating the consequence of differences in this property. They also exhibit a range of life histories, including larvae of various durations before metamorphosis, perennibranchiate (retaining
gills throughout life) or neotenic species, and notably many direct
developing species [7]. In the latter case the eggs may be laid in water
or on land, and so the embryo develops outside the reproductive
tract. There is no free-living aquatic larva in such species, and most
adult features form in the embryo and are present at hatching. There
is evidence that direct development arose on several occasions during
plethodontid evolution.
Variation in the Salamander Genome

Some of the largest vertebrate genomes are found in salamanders,
which range from approximately 14120 Gb [8]. DNA content is
positively correlated with nuclear and cell size [9], and large salamander cells and chromosomes have provided a valuable resource
for studies on topics such as cytogenetics [10], transcription architecture [11, 12], and microtubule dynamics [13]. Genome size
also affects aspects of organismal biology such as the rates of
metabolism, differentiation, and growth, as well as the time course
of embryonic development and regeneration, and even the biogeography, which the species inhabit [10, 14]. In a noteworthy study
nearly 30 years ago, Sessions and Larson analyzed 27 species of
plethodontid with a sixfold range in haploid DNA content [15].
These investigators observed an inverse correlation with the rate of
limb regeneration, for example, a difference in the time required
Jeremy P. Brockes
for complete regeneration varying from 2 to 9 months. These relationships were observed in certain plethodontid lineages and not
others. In later studies, large genomes in salamanders have been
correlated with changes in the neural circuitry [16] and in the circulatory system [17].
The most informative studies to date on the causes of genomic
gigantism in salamanders have emphasized the importance of
transposable elements (TE). Although at the time of writing no
complete salamander genome sequences are available, low-coverage
shotgun data has been generated for six plethodontid species covering a threefold range of genome size [8]. Up to 47 % of the
genome (for the species Aneides flavipunctatus) can be attributed
to TEs, but the predominant class is the long terminal repeat
(LTR) retrotransposon, which is estimated to be 30 % of the
A. flavipunctatus genome. These data raise the question of when
these sequences entered the genome during salamander evolution.
Recent analysis of the basal group genome of the hellbender, a
cryptobranchid species, has indicated that the high level of LTR
retrotransposons is likely to be characteristic of modern salamanders as a whole and to reflect persistence and diversification of
ancestral TE families [18].
It is likely that much remains to be discovered about the role
of TEs in salamander biology, but the study by Zhu et al. provides
a valuable entry point for some of the issues in relation to limb
regeneration [19]. The non-LTR long interspersed nucleotide
element-1 (LINE-1) retrotransposon was found to be markedly
upregulated in axolotl limb regeneration in both the mesenchymal
blastema and the wound epidermis. The genomic content of
LINE-1 elements was found to progressively increase by 1.52fold comparing the normal limb with two successive rounds of
regeneration, suggesting that productive retrotransposition is
induced by limb transection. Presumably this would apply to tissue
removal or injury in other regenerative contexts in the salamander.
If this occurs, and the data remain fragmentary at present, it needs
to be reconciled with the ability of salamanders to undergo multiple rounds of regeneration, for example, in the case of the newt
lens [20], without a detectable change in outcome. The recent
transcriptome analyses of regenerating newt heart [21] and axolotl
limb [22] have found that many different TE and endogenous retrovirus sequences are markedly upregulated in regeneration. What
might be the significance of these findings?
A recent analysis of mammalian development suggests that
regulation by endogenous retroelements plays a critical role at
early stages [23]. In the totipotent cells of the 2-cell (2C) stage
mouse embryo and in rare cells that arise in ES cell populations in
culture, retroviral GAG protein is expressed as well as many transcripts with junctions to endogenous retroelements. This promoter
activity of retroelement LTRs is turned off by the transition to
pluripotency after the 2C stage in mouse embryogenesis or by
conversion to ES cells in culture. In this and other contexts [24,

25], transposon sequences play a key role in allowing coordinate
expression and subsequent repression of many genes. It is possible
to speculate that expansion of the genome by assimilation of TEs
early in the salamander lineage was critical in the evolution of an
extended repertoire of regeneration, by permitting the coordinated
regulation of many genes after injury. A related suggestion has
been made in relation to the interspersed repetitive sequences
present in the newt Hox C and Hox D gene clusters. These
sequences include a high level of newt-specific repeats as well as
various kinds of TE. The authors point out that these elements
could contribute to the regulation of postembryonic expression in
the context of tissue regeneration. The generation of pseudogenes
and gene duplications are other activities attributed to TEs, and
they may be relevant for the evolution of regeneration [25].
Variation in Limb Development

Limb development in salamanders poses an intriguing set of problems. On the one hand there are aspects of limb development that
can be recognized in all salamanders, but are not present in other
tetrapods (anuran amphibians and amniotes). Although these are
not understood, they challenge the generality of some of our ideas
about limb development in amniotes, and I will give one current
example. On the other hand many salamander species have fully
functional limbs for much of the larval period, in contrast to
anurans where the limbs emerge shortly before metamorphosis, or
amniotes where limb development occurs in the egg [26]. The
selective pressures in different larval ecologies lead to marked variations in the timing of limb and digit formation which have been
of great interest for understanding the evolution of development
[27]. The connections between limb regeneration and these problems of limb development in salamanders have not been apparent
in the past, but this may be changing as outlined here.
Figure 2 is modified from a recent review of these issues [27]
and illustrates the difference between the property referred to as
preaxial dominance in salamanders and its counterpart in other tetrapods. The anterior, or preaxial, digits 2 and 1 are the first to
develop, with the radius before the ulna; the same occurs with the
corresponding elements in the hind limb. This difference in timing
is maintained in relation to subsequent ossification. In other tetrapods the posterior, or postaxial, digits are the first, with the ulna
before the radius. Another unique feature in salamanders is the
fusion of the carpal bones at the base of digits 1 and 2 to form the
basale commune. The differences in timing were recognized at least
since the early twentieth century and were even used at one point to
propose two separate origins of the tetrapod limb [28]. This is no
longer considered seriously as an option, and preaxial dominance is
Jeremy P. Brockes
Fig. 2 Diagram illustrating the difference between postaxial and preaxial dominance in outgrowth of the digits.
The large 2 and 1 numerals illustrate the first digits to extend in the case of salamanders or the other tetrapods. Modified from a similar diagram in Frobisch and Shubin [27]
regarded as a salamander innovation or apomorphy [27]. The analysis of Hox A and D complex gene expression in axolotl limb buds has
not revealed any differences from other tetrapods that appear to
explain the mechanism of preaxial dominance [29].
The significance of preaxial dominance can be appreciated in
terms of the selective pressures on aquatic larvae (or embryos for
direct developing species) in different locales. Most salamanders
have extended larval periods, which can last for more than a year in
some species. In species with pond-type larvae, limb development
proceeds slowly after hatching while the larvae move aroundthe
limbs are moved as they are developing. These larvae use the preaxial part of the autopod for locomotion and support. Such larvae
often have transient balancer organs at hatching to hold the animal
in place during the initial phase of limb elongation. The larvae of
Salamandrella keyserlingii in the Urals have a long fin-like mesenchymal membrane between digits 2 and 1 to assist movement and
floating during active feeding [30]. In stream-adapted larvae, for
example, the Pacific giant salamander, limb development is
advanced at hatching and the forelimb elements are completely
differentiated [31]. In plethodontids with direct development,
there is no larva, and the limbs develop within the capsule [32].
Nonetheless all of these cases show the extension of the limb axis
through digit 2, not digit 4. This is particularly marked for the
pond and stream-dwelling larvae, but it has also been observed for
the plethodontid case [32]. This is noteworthy because the latter
appears in other respects to be more reminiscent of amniote limb
development. The limb bud extends in a paddle configuration and
the digits form in a concerted fashion, in contrast to the iterative
episodes seen in digit development in the larval forms [32]. The
variations in limb development illustrate the operation of strong
selective pressures, particularly on the free-living aquatic larva,
which is considered to be the ancestral life history for salamanders
[26, 33]. It is possible to suggest that these selective pressures
might operate for regeneration of the limb in a context where predation and density-dependent biting behavior have been observed
[34, 35].
Although the basale commune is specific to salamanders, it is an
example of the reduction of bones in the limb, a widespread feature of tetrapod evolution [36]. In some salamander familiesthe
amphiumids, proteids, and sirenidsthe limbs may be reduced so
as to have only two digits. For example, the cave-dwelling salamander Proteus has two digits in the foot and three in the hand. In
these highly reduced salamander limbs, the remaining digits are
always the preaxial 1 and 2. It is interesting that in this context the
missing digits do not form in development, whereas a recent
analysis of digit loss in crocodiles and birds has provided examples
where digit remnants are clearly observed [37].
The nature of digit development in salamanders is of particular
interest at present, when the currently favored model for digit formation in amniotes posits a Turing-type reaction-diffusion network in the limb bud, leading to the concerted formation of the
digits [38]. Yet it is well documented that larval salamanders may
show extension of digits 2/1, followed by a gap of several days,
then formation of digit 3, another gap, and formation of digit 4
[32]. It seems somewhat unlikely that this could reflect the operation of a reaction-diffusion network as proposed for mice. It will be
interesting to see if the salamander is just a special case, even a
distinct mechanism for generating the digits, or whether the
reaction-diffusion network remains the most supported possibility
for amniotes.
Origin of Salamanders and Salamander Phenotypes in Deep Time

The origin of salamanders in tetrapod evolution poses many difficult problems, yet the current fossil evidence has some fascinating
aspects, including some that are of direct relevance here. Fossils of
salamanders are known from the Jurassic, but they resemble extant
10
Jeremy P. Brockes
Fig. 3 Schematic outline of salamander evolution and paleontology. Note that

although Apateon is denoted as being at the origin of preaxial dominance, there
may be as yet undiscovered earlier species with this property
salamanders and so do not provide much evidence about origins

[5, 39]. One example is the cryptobranchid Chunerpeton, a wellpreserved fossil from the Middle Jurassic (165 MYA) of China
[40]. The life histories of metamorphosis and paedomorphosis
(neoteny) have both been identified in Jurassic fossils, but during
the preceding Triassic era there is little or no evidence about earlier
forms [39]. This takes us back to the Permian era (290245 MYA)
at the end of the Paleozoic (Fig. 3). There is significant uncertainty
about how salamanders diverged from anurans and caecilians. The
hypotheses vary from proposing a common ancestry for all three
groups, to separate origins for each from distinct lineages of
Paleozoic amphibians [27, 39, 41, 42]. I will focus on the
Temnospondyls, the most anatomically diverse and most specious
clade of late Paleozoic amphibians. Although it is possible that
preaxial dominance and limb regeneration were found in earlier
tetrapods, this group is the oldest for which we have evidence at
present.
The Dissorophoidea are a prominent group of Temnospondyl
species which include Apateon, Gerobatrachus, and Micromelerpeton.
Apateon was a prominent neotenic species in the lakes of the
Variscan mountain belt in the early Permian (~300 MYA), and
some locations in Germany show exceptional preservation of fossils
due in part to anoxic conditions at the bottom of the lakes. This is
a rare example in paleontology where evidence of a developmental
process in deep time, that is preaxial dominance in the limb, is
11
Fig. 4 Fossil of the early Permian from Rhineland-Pfalz showing a single large
Micromelerpeton at the right and three smaller examples of Apateon at the left
(authors collection). Scale bar, 5 cm
directly available by inspection of more than a hundred examples

of staged fossil larvae from a single location [43]. In these specimens digit 2 leads in the digital sequence of ossification, while the
preaxial zeugopodial elements are advanced relative to the postaxial ones. The presence of this salamander apomorphy in Apateon
provides strong evidence for a relationship between salamanders
and dissorophids [5, 27, 43]. The analysis of cell volumes in
Paleozoic tetrapods has just started, and it is interesting that dissorophids appear to have a relatively large volume that is comparable to salamanders. This could be consistent with an expansion in
genome size in these animals, but it seems that few samples have
been analyzed to date [41].
Micromelerpeton is another dissorophid which is known from
well-preserved specimens in the early Permian (~300 MYA) lake
deposits. Figure 4 shows a Permian fossil from the Rhineland, with
one Micromelerpeton and three Apateon preserved in association. It
was apparently a predator of Apateon judging from analysis of gut
12
Jeremy P. Brockes
contents. Several examples of Micromelerpeton display limb abnormalities considered characteristic of regeneration in modern salamanders [44]. For example, the fusion of digits along the
proximodistal axis is observed, as well as the formation of narrow
additional digits. These are distinct from the abnormalities
observed in limb development in salamanders. This evidence for
limb regeneration in the fossil record is not as direct as that for
preaxial dominance [27], but nonetheless it constitutes prima facie
evidence that Micromelerpeton was capable of limb regeneration.
Gerobatrachus is a single fossil from Texas dating to the early
Permian and described originally in 2008 [45]. It is classified as a
dissorophid but its precise relationship to urodeles and anurans is a
matter of active debate [41]. The leg skeleton possesses a definitive
salamander character that is the presence of a basale commune. In
summary there is strong evidence for preaxial dominance and significant evidence for limb regeneration and the basale commune in the
possible Paleozoic ancestors of salamanders. It is important to note
that this is about 100 MY before the divergence of cryptobranchoids
and emergence of crown-group salamanders. The lake system that
may have provided the habitat for evolution of salamander-like features in dissorophids, as well as being important for fossil preservation, did not persist beyond the early Permian [41]. The changes
that occurred before the appearance of lower or middle Jurassic
cryptobranchoids were in part concerned with the challenges of terrestrial life, such as feeding or hearing [39]. They include the development of a tongue, which is apparently not a regenerative structure
in modern salamanders, in contrast to the jaws [46].
Conclusions
Our ability to deliver meaningful insights into the possible extension of mammalian regeneration will be enhanced by a more
detailed understanding of the evolution of regeneration and the
factors underlying the extensive repertoire in salamanders. Limb
regeneration is a property that distinguishes salamanders from
other adult tetrapods, that is, the anuran amphibians as well as
amniotes. On the other hand, preaxial dominance is a property of
limb development that also distinguishes salamanders from other
adult tetrapods. There is a significant consensus among evolutionary biologists that preaxial dominance evolved in the salamander
lineage, possibly in response to the selective pressures operating on
free-living aquatic larvae [27]. It is plausible, as suggested above,
that the same or related pressures may extend to regeneration of
the limb. Limb regeneration could be a purely ancestral property
for tetrapods that was lost in adult anurans and amniotes, and this
remains the most popular hypothesis. Alternatively, it may be that
certain salamander-specific novelties were required in addition to
13
an ancestral component in order to confer regeneration on the

limb [47, 48]. Both viewpoints would be consistent with the operation of strong selection pressures for limb function in salamander
larvae. Recent contributions to the debate on these issues have
come from pointing to fin regeneration in Polypterus in favor of an
ancestral component [49], while a variety of molecular analyses
have provided microevolutionary evidence for salamander novelties embedded in the mechanism of salamander regeneration [21,
47, 50]. It is possible that the origins of preaxial dominance and
limb regeneration are connected: they share a common target tissue and a similar rationale in terms of selective pressure, and they
are both detectable in certain late Paleozoic fossil aquatic dissorophids at a time before the origin of definitive salamanders. The
theme of this essay has been that it is interesting to consider connections between these different aspects of salamander biology,
and we can expect in the future to include microevolutionary and
genomic issues in the mix, as outlined earlier.
Acknowledgments
I thank Peng Zhang for his help in relation to salamander phylogeny and Anoop Kumar for help with the figures.
References
1. Sandoval-Guzman T, Wang H, Khattak S,
Schuez M, Roensch K, Nacu E, Tazaki A,
Joven A, Tanaka EM, Simon A (2014)
Fundamental differences in dedifferentiation
and stem cell recruitment during skeletal muscle regeneration in two salamander species.
Cell Stem Cell 14:174187
2. Larson A, Dimmick WW (1993) Phylogenetic
relationships of the salamander families: an
analysis of congruence among morphological
and molecular characters. Herpetol Monogr
7:7793
3. Duellman WE, Trueb L (1994) Biology of
amphibians. Johns Hopkins University Press,
Baltimore, MD
4. Shen XX, Liang D, Feng YJ, Chen MY, Zhang
P (2013) A versatile and highly efficient toolkit
including 102 nuclear markers for vertebrate
phylogenomics, tested by resolving the higher
level relationships of the caudata. Mol Biol
Evol 30:22352248
5. Carroll R (2009) The rise of amphibians.
The Johns Hopkins University Press,
Baltimore, MD
6. Wake DB, Marks SB (1993) Development and

evolution of Plethodontid salamanders: a
review of prior studies and a prospectus for
future research. Herpetologica 49:194203
7. Wake DB, Hanken J (1996) Direct development
in the lungless salamanders: what are the consequences for developmental biology, evolution
and phylogenesis? Int J Dev Biol 40:859869
8. Sun C, Shepard DB, Chong RA, Lopez Arriaza
J, Hall K, Castoe TA, Feschotte C, Pollock DD,
Mueller RL (2012) LTR retrotransposons contribute to genomic gigantism in plethodontid
salamanders. Genome Biol Evol 4:168183
9. Olmo E, Morescalchi A (1979) Evolution of
the genome and cell sizes in salamanders.
Experientia 31:804806
10. Sessions SK (2008) Evolutionary cytogenetics
in salamanders. Chromosome Res 16:183201
11. Miller OLJ, Beatty BR (1969) Visualization of
nucleolar genes. Science 164:955957
12. Kaufmann R, Cremer C, Gall JG (2012)
Superresolution imaging of transcription units
on
newt
lampbrush
chromosomes.
Chromosome Res 20:10091015
14
Jeremy P. Brockes
13. Hayden JH, Bowser SS, Rieder CL (1990)

Kinetochores capture astral microtubules during chromosome attachment to the mitotic
spindle: direct visualization in live newt lung
cells. J Cell Biol 111:10391045
14. Litvinchuk SN, Rosanov JM, Borkin LJ (2007)
Correlations of geographic distribution and
temperature of embryonic development with
the nuclear DNA content in the Salamandridae
(Urodela, Amphibia). Genome 50:333342
15. Sessions SK, Larson A (1987) Developmental
correlates of genome size in Plethodontid
salamanders and their implications for genome
evolution. Evolution 41:12391251
16. Roth G, Nishikawa KC, Wake DB (1997)
Genome size, secondary simplification, and the
evolution of the brain in salamanders. Brain
Behav Evolut 50:5059
17. Mueller RL, Gregory TR, Gregory SM,
Hsieh A, Boore JL (2008) Genome size, cell
size, and the evolution of enucleated erythrocytes in attenuate salamanders. Zoology
111:218230
18. Sun C, Mueller RL (2014) Hellbender genome
sequences shed light on genomic expansion at
the base of crown salamanders. Genome Biol
Evol 6:18181829
19. Zhu W, Kuo D, Nathanson J, Satoh A, Pao
GM, Yeo GW, Bryant SV, Voss SR, Gardiner
DM, Hunter T (2012) Retrotransposon long
interspersed nucleotide element-1 (LINE-1) is
activated during salamander limb regeneration.
Dev Growth Differ 54:673685
20. Eguchi G, Eguchi Y, Nakamura K, Yadav MC,
Millan JL, Tsonis PA (2011) Regenerative
capacity in newts is not altered by repeated
regeneration and ageing. Nat Commun 2:384.
doi:10.1038/ncomms1389
21. Looso M, Preussner J, Sousounis K,
Bruckskotten M, Michel CS, Lignelli E,
Reinhardt R, Hoffner S, Kruger M, Tsonis PA,
Borchardt T, Braun T (2013) A de novo assembly of the newt transcriptome combined with
proteomic validation identifies new protein
families expressed during tissue regeneration.
Genome Biol 14(2):R16. doi:10.1186/
gb-2013-14-2-r16
22. Stewart R, Rascon CA, Tian S, Nie J, Barry C,
Chu LF, Ardalani H, Wagner RJ, Probasco
MD, Bolin JM, Leng N, Sengupta S, Volkmer
M, Habermann B, Tanaka EM, Thomson JA,
Dewey CN (2013) Comparative RNA-seq analysis in the unsequenced axolotl: the oncogene
burst highlights early gene expression in the
blastema. PLoS Comput Biol 9(3):e1002936.
doi:10.1371/journal.pcbi.1002936
23. Macfarlan TS, Gifford WD, Driscoll S, Lettieri
K, Rowe HM, Bonanomi D, Firth A, Singer O,
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
Trono D, Pfaff SL (2012) Embryonic stem cell

potency fluctuates with endogenous retrovirus
activity. Nature 487:5763
Macia A, Blanco-Jimenez E, Garcia-Perez JL
(2014) Retrotransposons in pluripotent cells:
impact and new roles in cellular plasticity.
Biochim Biophys Acta doi: 10.1016/j.
bbagrm.2014.07.007
Muotri AR, Marchetto MC, Coufal NG, Gage
FH (2007) The necessary junk: new functions
for transposable elements. Hum Mol Genet
16:R159R167
Wells KD (2007) The ecology and behavior of
amphibians. University of Chicago Press,
Chicago, IL
Frobisch NB, Shubin NH (2011) Salamander
limb development: integrating genes, morphology, and fossils. Dev Dyn 240:10871099
Holmgren N (1933) On the origin of the
tetrapod limb. Acta Zool 14:187248
Torok MA, Gardiner DM, Shubin NH, Bryant
SV (1998) Expression of HoxD genes in developing and regenerating axolotl limbs. Dev Biol
200:225233
Vorobyeva EI, Hinchliffe JR (1996)
Developmental pattern and morphology of
Salamandrella keyserlingii limbs (Amphibia,
Hynobiidae) including some evolutionary
aspects. Russ J Herpetol 3:6881
Wake DB, Shubin NH (1998) Limb development in the Pacific giant salamanders,
Dicamptodon
(Amphibia,
Caudata,
Dicamptodontidae). Can J Zool 76:
20582066
Franssen RA, Marks S, Wake D, Shubin N
(2005) Limb chondrogenesis of the seepage
salamander, Desmognathus aeneus (amphibia:
plethodontidae). J Morphol 265:87101
Shubin NH, Wake DB (2003) Morphological
variation, development, and evolution of the
limb skeleton of salamanders. In: Heatwole H,
Davies M (eds) Amphibian biology, vol 5.
Surrey Beatty and Sons, Chipping Norton,
NSW, pp 17821808
Semlitsch RD, Reichling SB (1989) Densitydependent injury in larval salamanders.
Oecologia 81:100103
Wildy EL, Chivers DP, Kiesecker JM, Blaustein
AR (2001) The effects of food level and conspecific density on biting and cannibalism in
larval long-toed salamanders, Ambystoma
macrodactylum. Oecologia 128:202209
Shubin NH (2002) Origin of evolutionary
novelty: examples from limbs. J Morphol 252:
1528
de Bakker MA, Fowler DA, den Oude K,
Dondorp EM, Navas MC, Horbanczuk JO,
38.
39.
40.
41.
42.
43.
44.
Sire JY, Szczerbinska D, Richardson MK

(2013) Digit loss in archosaur evolution and
the interplay between selection and constraints.
Nature 500:445448
Raspopovic J, Marcon L, Russo L, Sharpe J
(2014) Modeling digits. Digit patterning is
controlled by a Bmp-Sox9-Wnt Turing network modulated by morphogen gradients.
Science 345:566570
Carroll RL (2007) The palaeozoic ancestry of
salamanders, frogs and caecilians. Zool J Linn
Soc 150:1140
Gao K-Q, Shubin NH (2003) Earliest known
crown-group salamanders. Nature 422:
424428
Schoch RR (2014) Amphibian evolution: the
life of early land vertebrates. Wiley-Blackwell,
Chichester
Hanken J (1986) Developmental evidence for
amphibian origins. Evolut Biol 20:389417
Frobisch NB, Carroll RL, Schoch RR (2007)
Limb ossification in the Paleozoic branchiosaurid Apateon (Temnospondyli) and the early
evolution of preaxial dominance in tetrapod
limb development. Evol Dev 9:6975
Frobisch NB, Bickelmann C, Witzmann F
(2014) Early evolution of limb regeneration in
tetrapods: evidence from a 300-million-year-
45.
46.
47.
48.
49.
50.
15
old amphibian. Proc R Soc B 281:20141550.

doi:10.1098/rspb.2014.1550
Anderson JS, Reisz RR, Scott D, Frobisch NB,
Sumida SS (2008) A stem batrachian from the
Early Permian of Texas and the origin of frogs
and salamanders. Nature 453:515518
Ghosh S, Thorogood P, Ferretti P (1994)
Regenerative capability of upper and lower
jaws in the newt. Int J Dev Biol 38:479490
Garza-Garcia AA, Driscoll PC, Brockes JP
(2010) Evidence for the local evolution of
mechanisms underlying limb regeneration in
salamanders. Integr Comp Biol 50:528535
Brockes JP, Gates PB (2014) Mechanisms
underlying vertebrate limb regeneration: lessons from the salamander. Biochem Soc Trans
42:625630
Cuervo R, Hernandez-Martinez R, ChimalMonroy J, Merchant-Larios H, Covarrubias L
(2012) Full regeneration of the tribasal
Polypterus fin. Proc Natl Acad Sci U S A 109:
38383843
Looso M, Michel CS, Konzer A, Bruckskotten
M, Borchardt T, Kruger M, Braun T (2012)
Spiked-in pulsed in vivo labeling identifies a
new member of the CCN family in regenerating newt hearts. J Proteome Res 11:
46934704
Chapter 2
Maintaining Eastern Newts (Notophthalmus viridescens)
for Regeneration Research
Abstract
The adult Eastern newt, Notophthalmus viridescens, has long served as a model for appendage as well as
heart muscle regeneration studies. Newt tissues include all major cell types known in other vertebrates and
mammals, including bone, cartilage, tendon, muscle, nerves, dermis, and epidermis. Therefore, these
aquatic salamanders make an excellent model for studying the regeneration of complex tissues. Regeneration
of adult tissues requires the integration of new tissues with preexisting tissues to form a functioning unit
through a process that is not yet well understood. Scale is also an issue, because the regenerating tissues or
structures are magnitudes larger than their embryonic counterparts during development, and therefore, it
is likely that different physics and mechanics apply. Regardless, regeneration recapitulates to some degree
developmental processes. In this chapter, we will describe basic methods for maintaining adult Eastern
newts in the laboratory for the study of regeneration. To determine similarities and differences between
development and regeneration at the cellular and molecular level, there is also a need for embryonic newt
tissue. We therefore also outline a relatively simple way to produce and raise newt embryos in the
laboratory.
Key words Eastern newt, Red-spotted newt, Notophthalmus viridescens, Embryo, Larva, Red eft,
Breeding, Spawning, Regeneration
1
1.1
Introduction
Eastern Newts
Eastern newts are urodele amphibians, commonly called salamanders [1]. A native of eastern North America, Eastern newts belong
to the genus Notophthalmus of which there are three known species: N. viridescens (Eastern newt), N. meridionalis (black-spotted
newt), and N. perstriatus (striped newt). Notophthalmus is one of
only two genera of newts native to the United States, the other
genus being Taricha, which inhabits primarily the coastal regions
of western North America. Taxonomists currently classify Eastern
newts into four subspeciesN. v. viridescens (red-spotted newt),
N. v. dorsalis (broken-striped newt), N. v. louisianensis (central
newt), and N. v. piaropicola (peninsula newt). Red-spotted newts
are endemic to the northeastern region of the United States but
17
18
range as far north as the Canadian provinces Ontario and Quebec;

as far south as Alabama, Georgia, and South Carolina; and as far
west as Michigan, Indiana, Kentucky, and Tennessee. Central
newts range as far west as Texas and Oklahoma and south to the
Gulf of Mexico. Broken-striped newts are mostly restricted to the
coastal regions of North and South Carolina, and peninsula newts
are found in the Florida peninsula.
1.2
Life Cycle
Fig. 1 Newt life cycle
Eastern newts have two distinct features that set them apart from
most other vertebrate speciestheir remarkable regenerative abilities and their unusual and complex life cycle, which can be divided
into four major stages, including the embryo, larval, red eft, and
adult stages (Fig. 1). Newts have two fascinating courtship and
breeding behaviors. Courtship may involve a stereotypical behavior known as hula during which the male undulates his body and
tail in an effort to entice the female to nudge his tail. After receiving this stimulus, the male deposits a spermatophore. The female
then uses her cloaca to pick up the sperm and stores them in a
special cavity known as the spermatheca to be used later for fertilizing her eggs. Alternatively, a more common courtship behavior
involves amplexus, in which the male grasps the females trunk
with his large hind limbs and nuzzles her with his snout. Amplexus
can go on for several hours before the male dismounts and deposits
a spermatophore in front of the female. A female newt fertilizes
Newt Husbandry
19
each egg with stored sperm just before depositing the egg on an
underwater leaf. She then gently wraps the egg with the leaf to
form a protective shield. The fertilized egg develops into an
embryo that hatches in about 2035 days. Over a period of
25 months, the gilled larvae develop first forelimbs followed by
the hind limbs. When the larvae reach a length of about 3538 mm,
they metamorphose into land-dwelling red efts. These red efts typically grow over a 3-year period before developing into mature
adults that are mostly aquatic (Fig. 1). In the wild, newts can live
for 1215 years, which is remarkable longevity for a vertebrate that
only weighs 23 g. More details concerning the life cycle of the
newt have been described elsewhere [2].
1.3 Regenerative
Abilities
Although the ancient Greeks knew about regeneration in vertebrate species as evidenced both by Aristotles notation in Historia
Animalium that lizards can regenerate their tails and the Greek
myth of liver regeneration in Prometheus, the first known scientific
study of regeneration in a vertebrate was published by the Italian
scientist Lazzaro Spallanzani in 1768 [3]. Spallanzani was able to
show that the aquatic salamander (most likely a newt) is able to
regenerate its forelimbs and hind limbs, tail, upper and lower jaws,
and caudal spinal cord. He also showed that aquatic salamanders
could repeatedly regrow a limb even after multiple amputations.
Over the past decades, major discoveries have been made using the
newt as a model organism for regeneration. In fact, the adult
Eastern newt (most often the red-spotted newt) has long served as
a primary model for the study of epimorphic regeneration of amputated limbs and tails [4, 5]. Similar to the limb, in a study spanning
16 years, Goro Eguchi and coworkers demonstrated that the
regenerative capacity of the newt lens is not altered by repeated
regeneration and aging [6]. It has also been shown that during lens
regeneration, pigment epithelial cells of the iris can transdifferentiate to lens cells [7]. The plasticity of differentiated cells has been a
great focus in regeneration studies. Adult newt cardiomyocytes
were shown to reenter the cell cycle [8, 9], and high resolution 3D
imaging as well as modern lineage tracing methods have revealed
that during limb regeneration, newt multinucleate myofibers
dedifferentiate and fragment to form proliferating mononuclear
cells that give rise to new skeletal muscle in the regenerated limb
[10, 11, 12, 13]. Moreover, the newt not only regenerates the
caudal spinal cord following tail amputation but can also regenerate the trunk spinal cord following a complete transection and
regain function of initially paralyzed appendages caudal to the
injury site [14, 15]. Modern cellular and molecular studies have
also shown that parts of the brain can regenerate by activation of
quiescent regions of the adult newt brain [16, 17].
As illustrated above, the advent of new methodologies has opened
an era in which the newt has become an attractive model to study the
cellular and molecular basis of regeneration in a vertebrate species.
20
This chapter focuses on the maintenance of Eastern newts in a

laboratory setting for the purpose of studying their remarkable
regenerative abilities.
Materials
Prepare all solutions using ultrapure water and analytical grade
reagents. Prepare and store all reagents at room temperature
(unless indicated otherwise). Diligently follow all waste disposal
regulations when disposing waste materials. The housing and
maintenance of animals must follow the guidelines of and be
approved by the Institutional Animal Care and Use Committee.
2.1
Adult Newts
Notophthalmus viridescens can be purchased from Connecticut

Valley Biological Supply Company (Southampton, MA) or Charles
D. Sullivan Co (Nashville, TN) (see Notes 13).
2.2
Newt Water
Deionized and dechlorinated water supplemented with 0.0375 %

Instant Ocean (Aquarium supply store). We use Instant Ocean salt
at a very low concentration, which is not comparable to the concentrations typically used in salt-water aquariums (see Note 4).
2.3 Aquarium Setup

and Maintenance
1. In a dedicated room with controlled temperature of 2022 C

and day-night light cycle, set up 80 L glass tanks
(61 cm 32 cm 42 cm) (Aquarium supply store) with lid
(Fig. 2a).
2. Cover bottom of aquarium with a 34 cm layer of small pea
gravel (Aquarium supply store) (Fig. 2a, b).
3. Fill aquarium halfway with approximately 38 L deionized
water.
4. In a 4 L plastic beaker, dissolve 15 g Instant Ocean in 2 L of
deionized water and add to tank.
5. The conductivity of the water in the aquarium should be
approximately 600 SI. Read the conductivity with a Nester
Micro MHO Pen or similar device every month! When conductivity has doubled, dilute water with deionized water.
6. The water pH should be in a range of 78. Determine the pH
with a calibration-free pH meter every 2 weeks! If pH is
getting low, adjust with 1 M NaOH.
7. For water aeration, circulate water using a pump with integrated carbon filter. To maintain water quality, use a filtering
system like the H.O.T. Magnum BIO-PRO System
(Marineland), which contains in a canister a container with
activated carbon (removes toxic chemicals and dissolved
organic pollutants), micron cartridge (traps microscopic dirt
particles), and Rite-Size sleeve prefilter (screens out free-floating
Newt Husbandry
21
Fig. 2 Aquarium setup and swimming adult newts. (a) 80 L aquariums are
supported by metal shelves in temperature- and light cycle-controlled room. (b) A
layer of pea gravel covers the aquarium bottom with (c) aquatic plants rooted into
the gravel
dirt and debris) plus a magnetic impeller module that pumps

water through the filter. Adjust water level every week.
22
2.4
Food
1. Beef heart (local butcher). Mince in food processor and keep

small portions packaged in plastic bags frozen at 20 C.
2. Daphnia sp., Tubifex sp., and California blackworms (Aquatic
Foods; see Note 5). Note that newts prefer live worms over
frozen food.
2.5 Breeding,
Spawning,
and Rearing of Newt
Larvae
1. Environmental enrichment for breeding: In addition to the

described aquarium setup, root into the gravel a mixed variety
of aquatic plants, e.g., Sagittaria sp. and Elodea sp. (Fig. 2c).
Newts also like to spend time out of the water, so you may
want to add several rocks that generate a ramp out of the water.
2. Newt eggs and larvae: Keep deposited eggs and rear hatched
newt larvae in small clear plastic containers (30 cm
18 cm 13 cm). Change water daily.
Methods
Carry out all procedures at room temperature unless otherwise
specified. The use of animals must follow the guidelines of and be
3.1 Animal Housing

and Care
1. Keep groups of approximately 30 adult newts in a 20 C

temperature-controlled room in 80 L aquariums with circulating water (Fig. 2ac).
2. Feed newts live Tubifex sp., California blackworms, or frozen
beef heart every 3 days.
3.2 Breeding,
Spawning,
and Rearing
of Newt Larvae
We have experienced that females caught in the wild during spring

will spontaneously deposit eggs if housed in an aquarium that contains a variety of aquatic plants (Fig. 2c).
1. Mix several sexually mature males and females in a tank and
feed well. Noticeable gravid females (females with swollen
abdomens) and males with blackened distal hind limb digit
pads are the most suitable for mating (see Note 6). A supply of
100200 eggs per aquarium with a group of 20 mixed female
and male animals can be achieved over a period of 24 weeks.
2. Inspect your spawning chamber daily for deposited eggs.
Typically, females will attach the eggs to the underside of the
plants leaves, at times rolling a leaf around a single egg or
cluster of deposited eggs. Freshly laid eggs are about 1.5 mm
in diameter.
3. Remove the egg-laden plant sprigs and transfer them to a clear
plastic container. The eggs develop well in room temperature
newt water and hatch in 2035 days to produce free-swimming
larvae.
Newt Husbandry
23
4. Carefully transfer the larvae to a separate clear plastic container

filled with newt water and supplemented with Daphnia sp.,
which the larvae will consume.
5. The larvae develop rapidly and once they mature, you can
detect prominent gills. These larger larvae require live, moving
food, and we found Tubifex sp. worms ideally suited.
6. Change the water daily in these small plastic containers. To
enhance the animals environment, add aquatic plants to float
in the water.
7. The newt larvae will eventually metamorphose into red efts.
This is a physiologically and morphologically significant event,
as the animals will resorb their external gills and switch to lung
breathing. When you notice signs of this transformation, transfer these more developed animals into a larger chamber that
includes an aquatic area with floating Elodea sp. plants and a
terrestrial component so that the animals can leave the water.
8. Continue feeding the red efts with Daphnia sp. and Tubifex sp.
The mix of land and water with abundant food supply provides
an environment the efts will thrive well in. We note that investigators have developed protocols for induced spawning, and
we refer to this published work for a more detailed setup
description [18, 19].
Notes
1. Newts freshly shipped from the vendor should be kept separate
for 2 weeks before using for experimentation. Occasionally, a
sick newt is among the shipments, and keeping animals in
quarantine helps to prevent spreading of a potential disease.
2. Newts can be handled by gently picking them up by the tail
with gloved hands. Unlike some lizards, which readily discard
their tails as a defense mechanism, the tail of the newt cannot
be discarded and therefore picking up the newt by the tail is an
appropriate method for quickly transferring animals from one
location to another. If the newt is to be handled for any length
of time beyond a simple transfer, its body should be supported
by the palm of the hand.
3. The skin of both Eastern and Western newts often contains a
potent neurotoxin known as tetrodotoxin, which binds to and
blocks voltage-gated sodium ion channels. The concentration
of tetrodotoxin has been shown to vary widely between
individuals depending on location, diet, and possibly other
unknown factors. Although controversy still remains as to the
origin of the tetrodotoxin, several studies suggest that in
Eastern newts, the toxin might be of dietary origin and if newts
24
are fed a toxin-free diet, they can lose their toxicity over a
period of several years [20]. Regardless, when handling newts
at any stage of their lives, it is best to wear gloves. If a newt is
handled without gloves, the hands should be washed immediately afterwards. Needless to say, unlike axolotls, which were
regularly eaten in Mexico before they became critically endangered (or possibly extinct in the wild), newts should never be
consumed.
4. In the wild, newts live in and by water streams, and therefore, in
principle, they can be kept in tap water in the laboratory.
However, in most cities, the drinking water is chlorinated to an
extent that it could be harmful to the animals. Therefore, if chlorinated tap water is used, it should be sufficiently dechlorinated
by allowing it to stand exposed to the air for a sufficient time
period for the chlorine to evaporate (usually several days).
However, many municipalities are treating their water supply
with monochloramine, rather than chlorine. Monochloramine
cannot be removed by evaporation. Therefore, we prefer to carefully prepare our own newt water by supplementing the deionized water supply in the laboratory with low amounts of Instant
Ocean salt to achieve a conductivity of approximately 600 SI
(equivalent to Evian Water). We have found that the method
described in this chapter produces reliable results that allow for
the maintenance and care of a healthy population of newts.
5. California blackworms can also be purchased from Eastern
Aquatics. Website: currently easternaquatics.com.
6. There is considerable competition among males for the right
to mate with females. Often males will try to dislodge a male
that is in amplexus with a female. Occasionally, a different male
not in courtship deposits his spermatophore between the spermatophore of a male in courtship and the female in an attempt
to get the female to collect sperm from his spermatophore
rather than the spermatophore from the male in courtship.
Acknowledgments
We would like to acknowledge both current and former researchers in our respective laboratories who helped develop the protocols
described in this chapter. These individuals include Paul Khan,
Barbara Linkhart, Claudia Guzman, Sarah Calve, Sarah Mercer,
Donald Atkinson, Vladimir Vinarsky, Tamara Stevenson, David
Kent, and Katherine Zukor. We would also like to acknowledge
several of our colleagues who provided us with invaluable advice
when we were just beginning our studies on regeneration using
this remarkable animal, including Cliff Tabin, Mark Keating,
Jeremy Brockes, David Stocum, Roy Tassava, Panagiotis Tsonis,
and Anthony Mescher.
Newt Husbandry
25
References
1. Duellman WE, Trueb L (1986) Biology of
amphibians. McGraw-Hill Book Company,
New York, NY
2. Petranka JW (1996) Salamanders of the United
States and Canada. Smithsonian Institution
Press, Washington, DC
3. Spallanzani L (1769) An essay on animal reproductions. Translated from Italian by M. Maty.
Printed for T. Becket, and P. A. de Hondt, in
the Strand, London. Available through UMI
Books on Demand
4. Wallace
H
(1981)
Vertebrate
Limb
Regeneration. J Wiley and Sons Ltd., Toronto,
ON
5. Nye HL, Cameron JA, Chernoff EA, Stocum
DL (2003) Regeneration of the urodele limb: a
review. Dev Dyn 226:280294
6. Eguchi G, Eguchi Y, Nakamura K, Yadav MC,
Lillan JL, Tsonis PA (2011) Regenerative
capacity in newts is not altered by repeated
regeneration and ageing. Nat Commun 2:384.
doi:10.1038/ncomms1389
7. Eguchi G, Itoh Y (1982) Regeneration of the
lens as a phenomenon of cellular transdifferentiation: regulability of the differentiated state
of the vertebrate pigment epithelial cell. Trans
Ophthalmol Soc U K 3:380384
8. Oberpriller J, Oberpriller JC (1971) Mitosis in
adult newt ventricle. J Cell Biol 49:560563
9. Bettencourt-Dias M, Mittnacht S, Brockes JP
(2003) Heterogeneous proliferative potential
in regenerative adult newt cardiomyocytes.
J Cell Sci 116:40014009
10. Calve S, Odelberg SJ, Simon H-G (2010) A
transitional extracellular matrix instructs cell
behavior during muscle regeneration. Dev Biol
344: 259-271
11. Calve S and Simon H-G (2011) High resolution 3D imaging: Evidence for cell cycle reentry
in
regenerating
skeletal
muscle.
Developmental Dynamics 240:1233-1239
12. Lo DC, Allen F, Brockes JP (1993) Reversal of

muscle differentiation during urodele limb
regeneration. Proc Natl Acad Sci U S A 90:
72307234
13. Sandoval-Guzmn T, Wang H, Khattak S,
14. Piatt J (1955) Regeneration of the spinal cord
in the salamander. J Exp Zool 129:177207
15. Davis BM, Ayers JL, Koran L, Carlson J,
Anderson MC, Simpson SB Jr (1990) Time
course of salamander spinal cord regeneration
and recovery of swimming: HRP retrograde
pathway tracing and kinematic analysis. Exp
Neurol 108:198213
16. Okamoto M, Ohsawa H, Hayashi T, Owaribe
K, Tsonis PA (2007) Regeneration of retinotectal projections after optic tectum removal in
adult newts. Mol Vis 13:21122118
17. Berg DA, Kirkham M, Beljajeva A, Knapp D,
Habermann B, Ryge J, Tanaka EM, Simon A
(2010) Efficient regeneration by activation of
neurogenesis in homeostatically quiescent
regions of the adult vertebrate brain.
Development 137:41274134
18. Khan PA, Liversage RA (1995) Development
of Notophthalmus viridescens embryos. Dev
Growth Differ 37:529537
19. Khan PA, Liversage RA (1995) Spawning of
Notophthalmus viridescens embryos. Herpetol
Rev 26:9596
20. Yatsu-Yamashita M, Gilhen J, Russell RW,
Krysko KL, Melaun C, Kurz A, Kauferstein S,
Kordis D, Mebs D (2012) Variability of tetrodotoxin and of its analogues in the red-spotted
newt, Notophthalmus viridescens (Amphibia:
Urodela: Salamandridae). Toxicon 59:257264
Chapter 3
Housing and Maintenance of Ambystoma mexicanum,
the Mexican Axolotl
Abstract
The aim of this paper is to assemble a significant amount of information on Ambystoma mexicanum, the
axolotl salamander, to assist in the basic knowledge needed to raise, breed, and study most aspects of axolotl biology. It is important to understand the basic biology of the axolotl in order to make informed decisions on their proper care and use in experiments. Therefore, we will provide necessary information to
the non-herpetologist that will assist in their study of this unique and fascinating animal. We also aim to
provide a resource on the general anatomy, behavior, and experimental tips specific to the Mexican axolotl
that will be of use to most axolotl laboratories. Axolotls have been actively researched since the 1860s,
giving testament to their relatively straightforward maintenance and their versatility as an animal model for
development and regeneration. Interest in using the axolotl in laboratory research has grown tremendously over the past decade, so dedicated resources to support the study of this species are needed and
encouraged.
Key words Salamander, Limb regeneration, Animal model, Axolotl anatomy
Introduction
1.1 Taxonomy,
Habitat,
and the Laboratory
Strain
A. mexicanum, commonly named the axolotl (Fig. 1), are

members of the order Urodela (oura tail + delos evident, also called
Caudata) or tailed amphibians, which constitute ten extant families of salamanders found mainly across the temperate regions
of the northern hemisphere. Axolotls belong to the family
Ambystomatidae, genus Ambystoma, which are commonly called
mole salamanders and are comprised of approximately 30 species
found across North America from southern Mexico to southern
Alaska. There are 17 Mexican ambystomatid salamander species
that inhabit the mountains of Central Mexico. Five of these species are primarily or obligatorily neotenic, meaning they do not
undergo metamorphosis and can breed in the adult larval form
[1]. Axolotls are endemic to the Lake Xochimilco area in the
Valley of Mexico, which has been reduced over the centuries to a
27
28
Fig. 1 Image of female leucistic (left ), female albino (middle), and male wild-type
(right ) axolotls. Notice the large bellies of the two females indicating they are
filled with eggs and the large cloaca of the mature male wild-type
~40 km2 area of artificial canals just outside the city limits of
Mexico City [2]. This high-altitude lake system (~2,200 m above
sea level) has been inhabited for centuries, most notably by the
Aztecs. This is where the name axolotl originates, as the animal
was named after the Aztec god Xolotl [3]. The water conditions
of Lake Xochimilco between 1978 and 1988 were estimated to be
between 16 and 20 C, pH 7.48.0, with a conductivity between
975 and 1,650 microsiemens (S)/cm [1]. Today, axolotls are
critically endangered and are on the brink of extinction due to
habitat loss, the introduction of invasive species, and shifts in
water quality [4]. It has been estimated that densities were at
6,000 ind./km2 in 1998, 1,000 ind./km2 in 2000, and 100 ind./
km2 in 2008 [2], and only a few axolotls were cited in the lake
system after months of surveying in 2013 [5]. Unfortunately, the
majority of axolotls today are found in aquaria and laboratories
around the world.
The modern axolotl strain used in most laboratories is a highly
inbred population that most likely arose from a donation of seven
wild axolotls (six wild-type and one white mutant) between 1863
and 1866 to the Paris Natural History Museum [6]. In fact, most
modern-day laboratory axolotls likely have a direct lineage to these
founders, and all white mutants are descendants from this single
white animal [7]. A few wild-caught axolotls were introduced into
the colony strain in the 1960s including an albino tiger salamander
(Ambystoma tigrinum) [8], but overall the present-day laboratory
strain is likely one of the most long-running inbred strains of any
laboratory species. The 150-year history of laboratory breeding
seems to have selected against spontaneous metamorphosis (currently <1 % frequency), as it is more prevalent in wild strains than
the lab strain [7, 9]. The most extensive colony of laboratory axolotls is maintained at the Ambystoma Genetic Stock Center (AGSC)
at the University of Kentucky (www.ambystoma.org), which is a
continuation of the Indiana University Axolotl Colony initiated by
Housing and Maintenance of Ambystoma mexicanum, the Mexican Axolotl
29
Humphrey R.R. in 1957 [10]. Over the past 50 years, the Axolotl
Colony has provided the majority of axolotls and housing information to labs worldwide. Valuable information on housing, breeding, and diseases of axolotls can be found at www.ambystoma.org
as well as in the archives of the Axolotl Newsletter.
1.2 Laboratory
Research Using
the Axolotl
Axolotls have classically been used in developmental biological

research for practically every organ system due to their large egg
size, external development, reliable breeding, acceptance of embryonic and adult tissue grafts, and large clutch sizes [11]. Historically,
both newts and axolotls have been the primary types of salamanders used in lab research, but the unique advantage of axolotls is
that they can be easily bred in a lab environment in the long term.
What truly sets both newts and axolotls apart from other animal
models is that they are our closest relatives that display a wide
range of striking regenerative capabilities. In fact, axolotls can
regenerate and recover from virtually any injury that does not kill
them. Regeneration has been observed in parts of the heart, the
tail, the jaw, the spinal column, the gills, the brain, and entire limbs
(Fig. 2). This regrowth occurs without scarring and with full restoration of function. It can also presumably reoccur an indefinite
number of times without any loss of fidelity, although a careful
analysis of this point is needed in axolotls. Regeneration can be
induced throughout all stages of life, although the process is faster
in larvae and less reliable in animals that have been forced to
undergo metamorphosis [12, 13].
Other amphibians besides axolotls are studied for their regenerative abilities. Tadpoles of the African clawed frog Xenopus laevis
can regenerate their tails and spinal columns, while certain species
of newts (Pleurodeles waltl, Notophthalmus viridescens, and Cynops
pyrrhogaster are the most commonly studied species) can regenerate appendages and organs. Despite these similarities, the axolotl is
not closely related to these species. As a member of the order
Anura, X. laevis is only distantly related to urodele salamanders
with a common ancestor approximately 260 million years ago
[14], a divergence emphasized by the fact that X. laevis loses its
regenerative abilities in late larval stages. Furthermore, although
newts and axolotls are both urodeles with superficially similar anatomy, they diverged from a common ancestor at least 145 million
years ago [14], and recent studies have shown that newt regeneration and axolotl regeneration differ in both mechanism [1517]
and recovery after denervation [18]. Consequently, caution is
advised when attempting to compare axolotl protocols and findings with those of other amphibian models.
1.3
Unlike the majority of urodeles, axolotls are obligate paedomorphs

which do not undergo metamorphosis unless it is artificially
induced via the addition of thyroid hormone to their environment
[19]. Consequently, they grow to be large fully aquatic adults and
Gross Anatomy
30
Fig. 2 Cartoons of the exterior (top) and interior (bottom) of an adult leucistic axolotl. Each organ is drawn to
approximate scale and represents the approximate position in the animal. Colors also represent the approximate color of each organ. The regenerating limb and tail represent mid-bud blastema stages. Internal histology
of a mid-bud blastema is represented in Fig. 3c
maintain the feathery external gills characteristic of ambystomatid

larvae throughout their lives (Figs. 1 and 2). Males reach sexual
maturity, indicated by a blackening of the nails, at around
10 months of age, while females tend to mature slightly later from
12 to 18 months. Sexual dimorphism is moderate but visible, as
males are slimmer and longer than females and exhibit a cloacal
bulge (Fig. 2). Sexually mature females are also more rotund due
to their egg supply. While the lifespan of wild axolotls remains
unknown, they generally live between 10 and 15 years. Animals
can be induced to undergo metamorphosis, which become terrestrial and strongly resemble adult tiger salamanders (Ambystoma
tigrinum). Axolotls are in fact closely related to tiger salamanders
and are capable of crossbreeding with this species in additional to
various other ambystomatid salamander species [20]. Studies of
A. tigrinum have thus provided extensive insight into the anatomy
and development of A. mexicanum [21].
Although the overall body plan of the axolotl is considered to be
among the most primitive of the tetrapods, these salamanders nevertheless share a number of basal characteristics with other vertebrates
and have proved useful for the study of many different systems.
31
Aquatic and lacking a middle-ear structure, axolotls rely on olfaction far more than audition when they are searching for food. The
urodele olfactory system is quite complex and allows the animal to
discriminate between very similar odorants and chemicals. Because
their olfactory epithelium and olfactory bulb are large and easily
accessible, tiger salamanders were a favored model for the study of
olfaction and neuronal signaling during the 1970s and 1980s
[2224]. Axolotls possess true teeth and a calcified skeleton with
cartilaginous joints that are anatomically similar to mammalian
joints [25, 26].
Although their eyesight is poor and their vision is largely limited to the detection of movement, the axolotl retina displays the
layered structure typically seen in vertebrates. In fact, many early
studies of retinal intracellular signaling were conducted in salamanders because of their large and easy-to-access retinal cells [2729].
Tiger salamanders can detect ultraviolet light, and their UV-sensitive
photoreceptors express three different opsins [30, 31].
Furthermore, like fish and other aquatic amphibians, axolotls possess a lateral line system that is used to detect both electrical currents (via ampullary organs located on the head) and water
movement (via mechanoreceptive neuromasts that run along the
side of the animal). The lateral line develops from neurogenic placodes, and this developmental process may provide insights into the
evolution of vertebrate sensory systems [32]. However, the study
of the axolotls development and evolutionary history has been
complicated by its massive genome. Consisting of around 32 109
base pairs located across 14 haploid chromosomes [33], the axolotl
diploid genome is among the largest of all tetrapods. Our understanding of this animal is sure to increase rapidly as genetic technology advances and more techniques are adapted for use with
salamanders.
1.4 Structure
of the Circulatory
and Respiratory
System
Axolotls possess a three-chambered heart consisting of two atria

and one ventricle. As blood leaves the ventricle, it can pass to either
the pulmonary arteries or through an aorta that leads to the rest of
the body. Oxygenated blood leaves the lungs and is pumped back
into the lone ventricle of the heart, where it mixes with deoxygenated blood that has already circulated through the body. This
three-chambered system is consequently less efficient than the
four-chambered system seen in mammals and birds, as tissues are
nourished by blood that is not saturated in oxygen. The number of
aortic arches can vary greatly between and within different urodele
species, but axolotls always have four aortic arches [34]. Like all
amphibians, axolotls are poikilothermic and their heart rate is
strongly influenced by the temperature of their environment.
Hematopoiesis arises from the adult liver and spleen [35] and their
erythrocytes are very large, nucleated, and strongly autofluorescent. Injury induces rapid vasoconstriction to prevent excessive
32
blood loss, and clotting occurs very quickly even after injury to
major arteries. As a result, axolotls are at only minimal risk of
bleeding to death during and after surgery. They are a fairly popular model for the study of cardiac development because they can
exhibit a recessive mutation, dubbed c, that is cardiac lethal within
2 weeks after hatching. The hearts of c/c mutants do not beat, and
studies have found that these mutant hearts are largely differentiated
but lack tropomyosin [36] and organized sarcomeres [37].
Aquatic throughout their lives, axolotls utilize multiple strategies for obtaining oxygen from their environment. They exchange
oxygen with their three-paired external gills and can respire
through their skin via cutaneous gas exchange. However, axolotls
also possess rudimentary lungs and may obtain at least 4060 % of
their oxygen through surface breathing [38]. These lungs are elongated and translucent in appearance and run parallel to the spinal
column for virtually the entire length of the body cavity (Fig. 2).
Very little research on axolotl respiration has been conducted, but
previous studies of tiger salamander larvae have provided likely
insights into the mechanism of this process. These larvae inhale
using a two-stroke buccal pump system that mixes expired and
fresh air in the buccal cavity before pumping it into the lungs.
Exhalation is active and very rapid, minimizing the amount of fresh
air that is expelled through the mouth and gills. The ventilation
efficiency of this system is comparable to that of mammalian ventilation [39]. Axolotls housed in hypoxic tanks make frequent trips
to the surface to breathe [40], which can increase the probability
that they will swallow air and cause the formation of an air bubble
within the body that can disrupt the animals locomotion and feeding. Because of their numerous options for respiration, axolotls can
survive for hours outside of their tanks so long as they are not
allowed to desiccate. This ability proves useful for the purpose of
surgical procedures, as axolotls will heal very quickly if kept moist
and left sedated after surgery.
1.5 The
Immune System
Axolotls have a very primitive acquired immune system and are

generally described as immunodeficient. They do not induce a
humoral response to soluble antigens [41], they produce just two
classes of immunoglobulins, and they generate antibodies to antigens extremely slowly if at all [42]. This immunodeficiency is common in urodeles and has worked to the advantage of researchers, as
axolotls do not reject tissue from other salamanders and will even
readily accept tissues [43] and tissue primordia [44] from other
amphibian species such as X. laevis. Creative grafting experiments
using embryos have done much to elucidate the development of
axolotls, while grafting of larval or adult tissue has uncovered some
of the mechanisms of regeneration. The recent production of GFPexpressing axolotls has opened up a new avenue of grafting possi-
33
bilities, and researchers have already begun grafting GFP tissues to

white animals in order to reveal the basis of cellular plasticity and
positional memory during regeneration [45].
Despite these deficiencies in the acquired immune system,
the axolotl is still resistant to bacterial infections. This is likely
due to their mucus coat and fairly robust innate immune system,
which represent the main line of immune defense for urodeles.
Abundant neutrophils and macrophages rapidly engulf and destroy
foreign invaders, while antimicrobial peptides provide an additional layer of defense [46]. Past the age of 2 weeks, axolotls are at
moderate to minimal risk of bacterial infection even after surgery.
However, they are still susceptible to fungal and viral infections
and can acquire bacterial infections after chronic stress. Exposure
to Ambystoma tigrinum virus (ATV) can devastate both wild and
laboratory populations, with mortality rates potentially exceeding
90 % [47]. This extreme susceptibility is likely due to a lack of lymphocyte proliferation upon exposure to the virus [48]. Another
curiosity of the axolotl immune system is the fact that macrophages
seem to be essential for regeneration, as early ablation of macrophages completely inhibits blastema formation and results in excessive collagen deposition after limb amputation [49].
Intriguingly, although they may undergo high levels of cellular
proliferation in multiple tissues throughout their lives, axolotls are
remarkably resistant to cancer. Repeated studies of various urodeles have failed to induce cancerous growth in regenerating tissues even upon administration of carcinogens [50, 51], although
spontaneously occurring tumors have been described in veterinary
literature [52, 53]. This curious resistance to malignant growth
even during extreme cellular proliferation remains largely
unexplored.
1.6 Pigmentation
and Structure
of the Epidermis
Wild-type axolotls are a mottled gray/brown/olive-green color,

and this coloration arises from a combination of three different
neural crest-derived pigment cells. Black melanophores are the predominant chromatophores in adult wild-type animals, while yellow
xanthophores are more abundant early in development (Fig. 1)
[54]. Tip: shiny iridophores reflect light and are strongly reflective
under fluorescent imaging. White leucistic (white mutant, d/d) axolotls are the result of a recessive mutation in an unknown gene.
They are oftentimes preferred over wild-type animals for research
purposes, as pigment can negatively affect histological staining or
fluorescent imaging. Leucistic animals are descendants of a single
founder white axolotl that was donated to Auguste Dumril in
1866, hence the genetic designation d [55]. Leucistic larvae are
lightly pigmented dorsally but lose almost all pigment shortly after
hatching due to a lack of pigment cell migration to the flank of
the animals [56]. In contrast, albino animals completely lack
melanin and have a yellow appearance due to an overabundance of
34
xanthophores (Fig. 1). Although albino eggs are difficult to inject

due to their lack of pigment, they are very useful for whole-mount
embryonic staining methods. Adult leucistic salamanders can be
easily distinguished from albinos by their black eyes.
The adult axolotl epidermis is similar to other larval amphibians and does not contain the distinct cornified layer (stratum corneum) that mammals or metamorphosed amphibians possess [57].
It is highly vascularized in order to facilitate efficient cutaneous gas
exchange and is coated with mucus secreted by epidermal Leydig
cells dermal mucous glands help retain moisture and withstand
microbial threats. Leydig cells are large, club-shaped, and packed
with secretory granules (Fig. 3a, b). As they fill with these granules, they rupture and release mucus into the intracellular space
where it can then escape via pores onto the epidermal surface [58].
This mucus coat is very sticky and makes for an effective natural
adhesive during surgical manipulation of the animals. Epidermal
healing and regeneration is completely scar-free and occurs without extensive long-term fibrosis [57].
1.7
Regeneration
Limb regeneration is the classic paradigm of complex tissue regeneration and is currently the primary focus of laboratory research on
the axolotl (Fig. 2). Axolotls regenerate limbs by generating a mass
of highly proliferative cells called a blastema at the distal tip of a
limb stump (Fig. 3c). After amputation, locally derived lineagerestricted progenitor cells or dedifferentiated cells proliferate and
recapitulate developmental processes in order to regrow the missing portion of the limb [59]. As long as animals are well cared for,
limb regeneration is a robust, dependable assay. A juvenile animal
(8.510 cm SVL) will reach the differentiation stage of regeneration around approximately 32 days post amputation but will not
replace 100 % of the missing limb for at least 100 days post amputation. Three-month-old axolotls (~5 cm SVL) will reach the differentiation stage of regeneration at approximately 22 days post
amputation and will replace 100 % of their limbs by approximately
66 days post amputation [12].
Perhaps because axolotls are a neotenic member of an evolutionarily primitive order, their brains are very simple and share
several similarities with the mammalian embryonic brain (Fig. 3d).
The axolotl brain is relatively flat and elongated with clear delineations between the telencephalon, mesencephalon, and rhombencephalon (Fig. 2). The olfactory bulbs are large, but the optic
lobes are small and poorly separated, and the cerebellum is relatively undersized and weakly developed as well [21]. The cerebellum contains the only neurons in the axolotl central nervous
system that are not paraventricularall other neurons remain stationary and do not migrate from the germinal site during development [60] (Fig. 3d). Though less is documented about the
terrestrial axolotl brain, it is known that the brain undergoes
35
Fig. 3 Histological images of axolotl tissues. (a) Massons trichrome histological staining of a juvenile axolotl
epidermis. Notice the large Leydig cells (L) throughout the epidermis, dermal tissue underneath the epidermis
(D), and muscle lying underneath the dermis (M). (b) A transmission electron micrograph of a Leydig cell in a
juvenile axolotl epidermis. Notice the nucleus in the middle (N), which is surrounded by rough endoplasmic
reticulum and a large number of dense vesicles (V). PM represents the Leydig cell plasma membrane. K represents a keratinocyte with N representing the nucleus of the keratinocyte. (c) Massons trichrome histological
staining of a juvenile mid-bud limb blastema (BL). The bone is indicated with a B. Notice the thickened epidermis on the distal tip of the blastema and mesenchymal cell that makes up the blastema. (d) Hematoxylin and
eosin histological staining of a juvenile axolotl brain. The cross section is taken through the posterior telencephalon (forebrain; see Fig. 2). Notice the ventricular zone that contains highly proliferative neural progenitor
cells [66]
structural changes during the metamorphic process, particularly

in the optic lobes as they grow to accommodate the animals new
mode of binocular vision [61]. This suggests that the axolotl brain
remains plastic and capable of drastic change throughout the animals lifespan, possibly indicating that axolotls would make a
favorable model for the study of neural plasticity. Although seemingly possessed of limited intelligence, laboratory axolotls will
learn to associate humans with food and will move to the front of
their tank in anticipation of feeding. Few studies on axolotl
learning have been conducted, but classical conditioning studies
36
have been performed on tiger salamanders and seem to be most

effective when the conditioned stimulus is olfactory in nature
[62]. Tiger salamanders have also been trained to complete a
T-maze test, a feat which occurs more rapidly and reliably in adult
animals than in larvae [63].
Unlike mammals, which possess only limited regenerative
potential in the central nervous system, the axolotl CNS can
recover from extensive injury. Large portions of the axolotl brain
can regenerate fully after injury, and studies have found that they
can even recover from complete lobectomy [64, 65]. Neuronal
proliferation has been observed all along the ventricular zone of
adult brains [66]. Axolotls are also capable of fully recovering from
spinal crush and regenerating their tail, spinal column included,
after amputation. Both of these regenerative processes occur without the formation of a glial scar [67, 68], which in mammals is
thought to inhibit axonal growth after CNS injury. Precisely why
the CNS of these animals can heal without glial scarring remains
under investigation.
The peripheral nervous system of the axolotl is simple but
organized in a manner similar to other tetrapods. The axolotl PNS
is of particular interest to researchers because of the phenomenon
of nerve-dependent regeneration. If a limb is amputated and then
denervated within approximately 7 dayseasily accomplished by
severing two of the three major nerves at the brachial plexusthe
blastema does not form and regeneration does not occur. The
cause of this nerve dependency is still under investigation, although
it may be due to a loss of nerve-secreted mitogenic factors that are
essential for supporting the regenerative process. Axolotl peripheral nerves are myelinated and generally easy to find and sever,
particularly in young animals. However, they begin to regrow
within 10 days and must be periodically re-severed in studies that
last longer than this span. Denervation becomes successively more
challenging over time, and consequently it is difficult to maintain a
fully denervated state for longer than approximately 20 days.
1.8 Reproductive
System Structure
Axolotls reproduce sexually and fertilize internally. Males lay spermatophores which are then taken up and dissolved by the female in
the spermatheca, allowing spermatozoa to be stored in the cloaca
until it is time for spawning to occur. As eggs leave the oviducts and
enter the cloacal chamber, spermatozoa come into contact with the
egg and more than one sperm enter the egg cytoplasm [69]. Eggs
are usually laid in strings and are protected by a thick coating of
sticky jelly, which must be removed prior to embryonic injections or
grafting experiments. Though spawnings vary considerably in size,
most females will lay between 200 and 1,000 eggs per spawn.
Breeding ease and efficiency in the laboratory peaks in the spring
and decreases throughout the summer, suggesting that axolotl
breeding is seasonal even in animals which have been removed from
37
their natural environment. This seasonality is probably linked to

spermatogenesis, which typically begins in early summer and results
in the deposition of sperm into the vas deferens during the winter
[70]. Some labs have attempted to overcome this seasonal impediment by hormonally inducing ovulation with injections of human
chorionic gonadotropin (hCG) [71]. However, this technique does
not seem to affect the rate of spermatophore deposition, which
seems to be the limiting step in this process.
Despite the fact that axolotls are commonly and reliably bred
in the laboratory setting, much remains unknown about the structure and development of their reproductive system. It is known
that axolotls share a conserved inductive mechanism of germ cell
development with mammals, rather than the oocyte-derived germplasm observed in Xenopus laevis and zebrafish [72]. Structural
anatomy of the axolotl ovary has yet to be fully described or characterized, though it has been found that adult females constantly
undergo oogenesis and thus their ovaries contain oocytes at all
stages of maturation and development [73]. The axolotl ovary can
take up a considerable portion of the peritoneum and resides next
to the fat bodies (Fig. 2). Although breeding fidelity tends to
decrease over time, oogenesis never halts completely. Therefore,
although few studies of axolotl ovarian development and anatomy
have been conducted, the animal remains an intriguing model of
ovarian regeneration and long-term adult oogenesis.
Slightly more is known of the male reproductive system. The
axolotl testis is comprised of a variable number of lobes, and older
animals tend to have increased numbers of these lobes. Lobes are
made of lobules, which resemble sacs and are themselves composed
of small spermatogonial cysts, each of which arose from a single
stem cell [70]. As noted previously, spermatogenesis begins in the
early summer after old cysts from the previous reproductive cycle
have been broken down and replaced. By August the testis is swollen and heavy, and sperm are released into the vas deferens in the
following months as cysts rupture and then degenerate. Not all
individuals adhere strictly to this seasonal pattern, and there is even
some variation within a single testis as cysts may mature at different
rates. Consequently, an axolotl testis is likely to exhibit cysts at
many different stages of development.
2
2.1
Materials
Housing
1. A windowless (see Note 1) or blacked-out room held at a constant temperature of 1620 C (see Note 2).
2. An automatic light timer which controls lighting conditions
for a 12L:12D light cycle (see Note 3).
38
3. Deionized water or dechlorinated tap water supplemented

with a balanced salt solution at a pH between 7.0 and 7.5.
Commercial artificial seawater is sufficient for housing all
animals. Classically, 4050 % Holtfreters solution has been
used for adult housing, which has a conductivity of approximately 2,300 S/cm (NaCl = 30 mM, MgSO47H2O = 0.4 mM,
CaCl2 = 0.45 mM, KCl = 0.33 mM) (see Note 4).
4. Water can be stored in a large recirculating storage tank or in a
food service quality 45-gallon wheeled trashcan (see Note 5).
5. For animal storage, 6QT/5.7 L Sterilite plastic boxes or comparable plastic/glass containers.
6. Animals can also be housed in 5-gallon (18.9 L) aquaria with
minimal flow through (see Note 6).
7. For high animal volume labs, automated flow-through systems
can be used to house large quantities of both juvenile (23 L
tanks) and adult (10 L tanks) animals (see Note 7). Water temperature should be set to 18 C, pH 7.0, conductivity to 800
1,500 S/cm, with 5 % daily water changes. The water flow in
each tank should be kept low.
2.2 Raising Axolotls
from Embryos
to Adulthood
1. Soda-lime glass bowls, 8 in. diameter.

2. Soda-lime glass bowls, 3.5 in. diameter.
3. 20 % Holtfreters solution.
4. Aeration bubblers.
5. Soft mesh nets.
6. Artemia brine shrimp and brine shrimp hatchery (see Note 8).
7. California Blackworms (Lumbriculus variegatus) (see Note 9).
8. Soft moist salmon pellets.
2.3
Breeding
1. 28-quart plastic container (58.4 cm L 41.3 cm W 15.2 cm H)

lined on the outside with foil.
2. Reusable ice packs.
3. Broken terracotta pots or large flat natural rocks.
4. Soft mesh nets.
2.4 Disease
Treatment
1. 35 g/L salt solution.
2.5
1. At least two water-sealed containers.
Shipping
2. 5 mg/mL amikacin solution.
2. Packing materials.
3. Thick, sealable plastic bags.
4. Disposable ice packs.
3
3.1
39
Methods
Housing
1. Three times a week, change water in animal containers

manually using a plastic colander or soft mesh net.
2. Scrub containers thoroughly with a brush at each water change
(see Note 10).
3. Feed animals on same schedule as water changes.
4. For aquaria, perform 10 % water changes weekly.
5. Check pH, conductivity, and water level of flow-through systems daily. Check ammonia levels every 24 weeks once systems are established.
6. Monitor animal health daily.
7. For further sources on axolotl housing, see Note 11.
3.2 Raising Axolotls

from Embryos
to Adults
1. Place embryos in groups of 100 animals in aerated 20 %

Holtfreter solution (see Note 12).
2. The expected death rate is 10 %. Check for and remove dead
embryos daily (see Note 13).
3. Change water three times a week.
4. Embryos will hatch out of their eggs on their own and should
be separated from unhatched animals at the next water
change.
5. Larvae (see Note 14) are housed in small groups of 20/container in 6QT plastic containers or 8 in. soda-lime glass bowls.
6. Feed larvae newly hatched artemia brine shrimp daily.
7. Change water three times a week using a soft mesh net.
8. Split groups in half at the first sign of cannibalism and house
animals of a similar size together.
9. Transition animals from brine shrimp to aquatic California
Blackworms, Lumbriculus variegatus, as soon as they are
large enough to eat the worms (approx. 3 cm total length)
(see Note 15).
10. At approximately 3 cm SVL, juvenile (see Note 16) house at
a density of 5 per 6QT container or 8 in. soda-lime glass
bowl.
11. Animals can be transitioned to sinking soft moist salmon pellets at approximately 7 cm SVL.
12. Housing water is changed and animals are fed every Monday,
Wednesday, and Friday.
13. House animals that are being used for limb regeneration
experiments alone in a 3.5 in. soda-lime glass bowl
(see Note 17).
40
14. At approximately 5 cm SVL, animals are transitioned to

individual 6QT housing containers or into the automated
flow-through systems in 3 L housing containers.
15. Adult (see Note 18) axolotls are either housed in individual
6QT containers or automated flow-through systems.
3.3
Breeding
1. Place one male and one female together in a 28-quart plastic

container covered with aluminum foil. Include two reusable
ice packs and a substrate of broken terracotta pots or large flat
rocks (see Note 19).
2. If spermatophores are observed in the tank after the first night,
remove the male and add soft mesh nets to the container.
3. The female will lay eggs continuously over the next 1224 h,
usually laying between 200 and 1,000 eggs on the provided
substrate.
4. The males can mate once a month and females at maximum
every 3 months (see Note 20).
3.4 Disease
Treatment
1. In order to prevent disease, keep animals well fed and in fresh

water from the moment eggs are laid to the death of the animal. Chronic stress is the most common cause of illness.
2. Catch signs of poor health early before disease spreads. This
usually is apparent by a lack of appetite, loss of coloration in
the gills, floating continuously, or loss of the feathery appearance of the gills.
3. A columnaris bacterial infection manifests as a white funguslooking growth on the animals gills or flank.
4. Treat columnaris-infected animals with a high salt bath of
35 g/L for 10 min for three consecutive days [74].
5. Aeromonas is a common parasite that manifests as red blotchy
skin, oftentimes on the animals leg.
6. Treat Aeromonas with three intraperitoneal injections of 5 mg/
mL amikacin solution at 5 mg/kg body weight separated 48 h
apart.
7. For more information on axolotl diseases, please see [75].
3.5
Shipping
1. Always ship axolotls with proper institutional animal care

approval (see Note 21).
2. Shipping should be performed in a water-sealed container such
as a cooler or Styrofoam box inside a second cardboard box.
3. Place packing material within the interior container.
4. Place animals and water in a thick plastic bag, seal it, and place
the bag within a second bag.
5. Seal bags with heat or securely tape them shut (see Note 22).
41
6. Disposable ice packs should also be added to the shipping

container.
7. Ship overnight only and remove animals from shipping containers to fresh water as soon as they arrive at their destination.
Notes
1. Restricting sources of natural light will increase the chances of
successful mating taking place during the typically nonbreeding months.
2. Water temperatures higher than 22 C are stressful on the animals and can have long-term negative effects on axolotl health.
3. A dimly lit room is preferable to a bright one, as axolotls can
be stressed by bright lights.
4. Success is also possible at a lower salinity of 750 S/cm [76].
Thus, axolotls thrive in a range of salinity conditions.
5. Free-standing water, especially tap water, should be treated
with the water conditioners Amquel Plus and Novaqua Plus
(Kordon LLC).
6. Aquarium filters should be used, but make sure that the water
flow is kept to a minimum, as high flow is irritating to axolotls.
Long-term housing in these tanks is reliable without any substrate, but small gravel can be used to act as a host for nitrifying
bacteria and supplemented with 20 % crushed coral to facilitate
pH balance (Jessica Whited, pers. comm.).
7. The advantage of these systems is that the footprint is relatively
small and many of the daily tasks are automated and alarmed
over network including water changes, water conductivity, pH,
water flow, and temperature. Water-cooling is highly recommended with axolotls considering the heat that is generated by
the automated systems. Most modern buildings can leverage
process-cooling water, but if this is not available, air-cooled units
can be used for chilling as long as an exhaust vent for hot air is
built into the animal room. The downside to an automated system is that the water is shared between tanks so disease could
spread between animals. Therefore, diligent observation of animal health is critical when using an automated system.
8. Commercial brine shrimp hatcheries work very well for high
yields. If the axolotl colony is small, a simple brine shrimp
hatchery can be generated using a 500 mL glass bottle with a
bubbler set at the bottom placed next to a window. Hatching
solution should include 35 g sea salt/L and 1.5 g brine shrimp
cysts per 500 mL. Cysts will hatch after approximately 24 h
depending upon salinity, heat, light, and batch of artemia so
optimization will be needed for each lab.
42
9. A two-pound shipment of California Blackworms can be kept

in the refrigerator in a large plastic container with just enough
axolotl housing solution to cover the worms. Worms will
survive for weeks if they are washed daily.
10. A small amount of sodium bicarbonate can assist in scrubbing.
11. For advice on establishing a colony, consult the AGSC, read
over their guide to axolotl care (www.ambystoma.org), and
read the several reviews on raising and caring for axolotls in
captivity [11, 55, 76, 77].
12. Embryos left in their jelly coat will hatch in 23 weeks. The
speed of development can be slowed if embryos are housed in
colder temperatures.
13. There is substantial variability in clutch-to-clutch embryo survival so close examination is needed to ensure maximal viability. It is important to remove dead eggs as they will foul the
water and negatively affect the development of other embryos.
Aerating the water with bubblers will increase animal survival
and leads to faster embryo development.
14. Hatched axolotls are considered larvae until their hind limbs
have developed to the digit stage.
15. We have found that feeding larval axolotls live blackworms
promotes rapid growth.
16. Juveniles are categorized as animals that have completed development, but are not yet sexually mature. Animals range from
approximately 3 cm snout tip to vent (SVL) to 1012 cm
SVL. Axolotls do not undergo metamorphosis so it is not possible to determine a true transition from the larval to juvenile
stage.
17. This ensures that limbs will be kept intact, as animals housed
together may attempt to eat and injure each other.
18. Adults are categorized as animals that are sexually mature.
Sexual maturity is highly variable in axolotls ranging from 8 to
15 months. For this reason, we categorize axolotls that are
larger than 20 cm snout tip to cloaca length as adults and
greater than 10 months of age.
19. Two reusable ice packs are included to lower the temperature
of the water to induce male mating behavior. On the first night
of mating, males lay spermatophores onto the bottom of the
tank, and the female takes up one or more spermatophores
into her cloaca. A substrate of broken terracotta pots or large
flat natural rocks is added to provide substrate for the males to
lay spermatophores.
20. We have found an approximate 30 % success rate in the mating
of healthy animals. Reproductive success is variable depending
on the season and age of the animals. Matings are generally
43
more successful during the winter and spring months, with

lower success in the summer months.
21. Shipping axolotls is relatively straightforward and safe if the
proper measures are taken to safeguard the welfare of the
animal.
22. There is enough oxygen in the water for the animals to survive
the trip.
Acknowledgments
We would like to thank the Ambystoma Genetic Stock Center for
the continued support and advice on axolotl maintenance (R24
OD010435). We would also like to thank Panagiotis Katsaros and
William Fowle for the electron microscopy images, Matthew
Nguyen and Pankhuri Singhal for the histological staining, and
Alex Sweeney and Jason Langshaw for the careful reading of the
manuscript.
References
1. Shaffer HB (1989) Natural history, ecology,
and evolution of the Mexican Axolotls.
Axolotl Newslett 18:511
2. Contreras V, Martnez-Meyer E, Valiente E,
Zambrano L (2009) Recent decline and potential distribution in the last remnant area of the
microendemic Mexican axolotl (Ambystoma
mexicanum). Biol Conserv 142:28812885
3. Smith HM (1969) The Mexican axolotl: some
misconceptions and problems. Bioscience 19:
593615
4. Zambrano L, Reidl PM, McKay J, Griffiths R,
Shaffer HB, Flores-Villela O, Parra-Olea G,
Wake DB (2010) Ambystoma mexicanum.
IUCN 2013. IUCN Red List of Threatened
Species. Version 2013.2
5. Press A (2014) Axolotl, Endangered Water
Monster, Sighted In Mexico after fears of
disappearance. 02/24/2014
6. Smith H (1989) Discovery of the axolotl and
its history in research. In: Armstrong JB,
Malacinski GM (eds) Developmental biology
of the axolotl. Oxford University Press,
New York, NY, pp 312
7. Malacinski GM (1978) The Mexican axolotl,
Ambystoma mexicanum: its biology and developmental genetics, and its autonomous celllethal genes. Am Zool 18:195206
8. Humphrey RR (1967) Albino axolotls from an
albino tiger salamander through hybridization.
J Hered 58:95101
9. Voss SR, Smith JJ (2005) Evolution of salamander life cycles: a major-effect quantitative
trait locus contributes to discrete and continuous variation for metamorphic timing. Genetics
170:275281
10. Humphrey RR (1979) The axolotl colony at
Indiana University. Axolotl Newslett 1:38
11. Voss SR, Epperlein HH, Tanaka EM (2009)
Ambystoma mexicanum, the axolotl: a versatile
amphibian model for regeneration, development,
and evolution studies. Cold Spring Harb Protoc
2009:pdb.emo128. doi:10.1101/pdb.emo128
12. Monaghan JR et al (2014) Experimentally
induced metamorphosis in axolotls reduces
regenerative rate and fidelity. Regeneration
1:214
13. R: A language and environment for statistical
computing
14. Zhang P, Wake DB (2009) Higher-level salamander relationships and divergence dates
inferred
from
complete
mitochondrial
genomes. Mol Phylogenet Evol 53:492508
16. Blassberg RA, Garza-Garcia A, Janmohamed
A, Gates PB, Brockes JP (2011) Functional
44
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.

convergence of signalling by GPI-anchored
and anchorless forms of a salamander protein
implicated in limb regeneration. J Cell Sci
124:4756
Kumar A, Nevill G, Brockes JP, Forge A (2010)
A comparative study of gland cells implicated
in the nerve dependence of salamander limb
regeneration. J Anat 217:1625
Liversage RA, McLaughlin DS (1983) Effects
of delayed amputation on denervated forelimbs
of adult newt. J Embryol Exp Morphol
75:110
Page RB, Voss SR (2009) Induction of metamorphosis in axolotls (Ambystoma mexicanum). Cold Spring Harb Protoc 2009(8):pdb.
prot5268. doi:10.1101/pdb.prot5268
Voss SR, Shaffer HB (1996) What insights into
the developmental traits of urodeles does the
study of interspecific hybrids provide? Int J Dev
Biol 40:885893
Francis ETB (1934) The anatomy of the salamander. The Clarendon Press, Oxford, With
an historical introduction by Professor Cole FJ
Getchell TV (1977) Analysis of intracellular
recordings from salamander olfactory epithelium. Brain Res 123:275286
Mackay-Sim A, Shaman P (1984) Topographic
coding of odorant quality is maintained at different concentrations in the salamander olfactory epithelium. Brain Res 297:207216
Mackay-Sim A, Shaman P, Moulton DG
(1982) Topographic coding of olfactory quality: odorant-specific patterns of epithelial
responsivity in the salamander. J Neurophysiol
48:584596
Lee J, Gardiner DM (2012) Regeneration of
limb joints in the axolotl (Ambystoma mexicanum). PLoS One 7:e50615. doi:10.1371/
journal.pone.0050615
Cosden RS, Lattermann C, Romine S, Gao J,
Voss SR, MacLeod JN (2011) Intrinsic repair
of full-thickness articular cartilage defects in
the axolotl salamander. Osteoarthritis Cartilage
19:200205
Grabowski SR, Pak WL (1975) Intracellular
recordings of rod responses during darkadaptation. J Physiol 247:363391
Waloga G, Pak WL (1978) Ionic mechanism
for the generation of horizontal cell potentials
in isolated axolotl retina. J Gen Physiol 71:
6992
Dvorak D (1984) Off-pathway synaptic transmission in the outer retina of the axolotl is
mediated by a kainic acid-preferring receptor.
Neurosci Lett 50:711
Makino CL, Dodd RL (1996) Multiple visual
pigments in a photoreceptor of the salamander
retina. J Gen Physiol 108:2734
31. Isayama T, Chen Y, Kono M, Fabre E, Slavsky

M, DeGrip WJ, Ma JX, Crouch RK, Makino CL
(2014) Coexpression of three opsins in cone
photoreceptors of the salamander Ambystoma
tigrinum. J Comp Neurol 522:22492265
32. Smith SC (1996) Pattern formation in the urodele mechanoreceptive lateral line: what features can be exploited for the study of
development and evolution? Int J Dev Biol
40:727733
33. Straus NA (1971) Comparative DNA renaturation kinetics in amphibians. Proc Natl Acad
Sci U S A 68:799802
34. Putnam JL, Parkerson JB Jr (1985) Anatomy
of the heart of the amphibia II. Cryptobranchus
alleganiensis. Herpetologica 41:287298
35. Lopez D, Lin L, Monaghan JR, Cogle CR,
Bova FJ, Maden M, Scott EW (2014) Mapping
hematopoiesis in a fully regenerative vertebrate: the axolotl. Blood 124:1232.
doi:10.1182/blood-2013-09-526970
36. Erginel-Unaltuna N, Dube DK, Robertson
DR, Lemanski LF (1995) In vivo protein synthesis in developing hearts of normal and cardiac mutant axolotls (Ambystoma mexicanum).
Cell Mol Biol Res 41:181187
37. Lemanski SF, Kovacs CP, Lemanski LF (1997)
Analysis of the three-dimensional distributions
of alpha-actinin, ankyrin, and filamin in developing hearts of normal and cardiac mutant
axolotls (Ambystoma mexicanum). Anat
Embryol (Berl) 195:155163
38. Whitford WG, Sherman RE (1968) Aerial
and aquatic respiration in axolotl and transformed Ambystoma tigrinum. Herpetologica
24:233237
39. Brainerd EL (1998) Mechanics of lung ventilation in a larval salamander Ambystoma tigrinum. J Exp Biol 201:28912901
40. McKenzie
DJ,
Taylor
EW
(1996)
Cardioventilatory responses to hypoxia and
NaCN in the neotenous axolotl. Respir Physiol
106:255262
41. Ching YC, Wedgwood RJ (1967) Immunologic
responses in the axolotl, Siredon mexicanum.
J Immunol 99:191200
42. Charlemagne J (1979) Thymus independent
anti-horse erythrocyte antibody response and
suppressor T cells in the Mexican axolotl
(Amphibia, Urodela, ambystoma mexicanum).
Immunology 36:643648
43. Sessions SK, Gardiner DM, Bryant SV (1989)
Compatible limb patterning mechanisms in
urodeles and anurans. Dev Biol 131:294301
44. Harris WA, Cole J (1984) Common mechanisms in vertebrate axonal navigation: retinal
transplants between distantly related amphibia.
J Neurogenet 1:127140

45. Sobkow L, Epperlein HH, Herklotz S, Straube
WL, Tanaka EM (2006) A germline GFP
transgenic axolotl and its use to track cell fate:
dual origin of the fin mesenchyme during
development and the fate of blood cells during
regeneration. Dev Biol 290:386397
46. Froese JM, Smits JE, Wickstrom ML (2005)
Evaluation of two methods for measuring
nonspecific immunity in tiger salamanders
(Ambystoma tigrinum). J Wildl Dis 41:
209217
47. Chinchar VG, Hyatt A, Miyazaki T, Williams T
(2009) Family Iridoviridae: poor viral relations
no longer. Curr Top Microbiol Immunol
328:123170
48. Cotter JD, Storfer A, Page RB, Beachy CK,
Voss SR (2008) Transcriptional response of
Mexican axolotls to Ambystoma tigrinum virus
(ATV) infection. BMC Genomics 9:493
49. Godwin JW, Pinto AR, Rosenthal NA (2013)
Macrophages are required for adult salamander
limb regeneration. Proc Natl Acad Sci U S A
110:94159420
50. Tsonis PA, Eguchi G (1981) Carcinogens on
regeneration. Effects of N-methyl-N-nitro-Nnitrosoguanidine and 4-nitroquinoline-1-oxide
on limb regeneration in adult newts.
Differentiation 20:5260
51. Zilakos NP, Zafiratos CS, Parchment RE
(1996) Stage-dependent genetically-based
deformities of the regenerating newt limb from
4-nitroquinoline-N-oxide mutagenesis: potential embryonic regulation of cancer.
52. Shioda C, Uchida K, Nakayama H (2011)
Pathological features of olfactory neuroblastoma in an axolotl (Ambystoma mexicanum).
J Vet Med Sci 73:11091111
53. Harshbarger JC, Chang SC, DeLanney LE,
Rose FL, Green DE (1999) Cutaneous mastocytomas in the neotenic caudate amphibians
Ambystoma
mexicanum
(axolotl)
and
Ambystoma tigrinum (tiger salamander).
J Cancer Res Clin Oncol 125:187192
54. Frost SK, Epp LG, Robinson SJ (1984) The
pigmentary system of developing axolotls. I. A
biochemical and structural analysis of chromatophores in wild-type axolotls. J Embryol
Exp Morphol 81:105125
55. Gresens J (2004) An introduction to the
Mexican axolotl (Ambystoma mexicanum).
Lab Anim 33:4147
56. Keller RE, Lofberg J, Spieth J (1982) Neural
crest cell behavior in white and dark embryos
of Ambystoma mexicanum: epidermal inhibition of pigment cell migration in the white
axolotl. Dev Biol 89:179195
45
57. Seifert AW, Monaghan JR, Voss SR, Maden M

(2012) Skin regeneration in adult axolotls: a
blueprint for scar-free healing in vertebrates.
PLoS One 7:e32875. doi:10.1371/journal.
pone.0032875
58. Jarial MS (1989) Fine structure of the epidermal Leydig cells in the axolotl Ambystoma
mexicanum in relation to their function. J Anat
167:95102
59. Simon A, Tanaka EM (2013) Limb regeneration. Wiley Interdiscip Rev Dev Biol 2:
291300
60. Harris WA (1989) Neurobiology. In:
Armstrong JB, Malacinski GM (eds)
Developmental biology of the axolotl. Oxford
University Press, New York, NY, pp 157168
61. Stirling RV, Brandle K (1982) Expansion of
the visual projection to the tectum of axolotls
during metamorphosis. Brain Res 281:
343345
62. Dorries KM, White J, Kauer JS (1997) Rapid
classical conditioning of odor response in a
physiological model for olfactory research, the
tiger salamander. Chem Senses 22:277286
63. Schwartz JM, Cogan DC (1977) Position discrimination in the salamander, Ambystoma
tigrinum. Dev Psychobiol 10:355358
64. Kirsche K, Kirsche W (1964) Regenerative
processes in the telencephalon of Ambystoma
Mexicanum. J Hirnforsch 7:421436
65. Richter W (1968) Regenerative processes
following removal of the caudal sector of the
telencephalon including the telencephalodiencephalic border region in Ambystoma
mexicanum. J Hirnforsch 10:515534
66. Maden M, Manwell LA, Ormerod BK (2013)
Proliferation zones in the axolotl brain and
regeneration of the telencephalon. Neural Dev
8:1. doi:10.1186/1749-8104-8-1
67. Parish CL, Beljajeva A, Arenas E, Simon A
(2007) Midbrain dopaminergic neurogenesis
and behavioural recovery in a salamander
lesion-induced
regeneration
model.
68. Okamoto M, Ohsawa H, Hayashi T, Owaribe
K, Tsonis PA (2007) Regeneration of retinotectal projections after optic tectum removal in
adult newts. Mol Vis 13:21122118
69. Wakimoto BT (1979) DNA synthesis after
polyspermic fertilization in the axolotl.
J Embryol Exp Morphol 52:3948
70. Armstrong JB (1989) Spermatogenesis. In:
University Press, New York, NY
71. Armstrong JB, Duhan ST (1989) Induced
spawnings, artificial insemination and other
46
genetic manipulations. In: Armstrong JB,

New York, NY, pp 229235
72. Johnson AD, Crother B, White ME, Patient R,
Bachvarova RF, Drum M, Masi T (2003)
Regulative germ cell specification in axolotl
embryos: a primitive trait conserved in the
mammalian lineage. Philos Trans R Soc Lond
B Biol Sci 358:13711379
73. Beetschen J-C (1989) Oogenesis. In:
University Press, New York, NY
74. Borland S (2000) Practical Axolotl. Axolotl

Newslett 28:1722
75. Duhon ST (1989) Disease in axolotls. In:
Armstrong JB, Malacinski GB (eds)
University Press, New York, NY, pp 264269
76. Khattak S, Murawala P, Andreas H, Kappert V,
Schuez M, Sandoval-Guzman T, Crawford K,
Tanaka EM (2014) Optimized axolotl
(Ambystoma mexicanum) husbandry, breeding,
metamorphosis,
transgenesis
and
tamoxifen-mediated recombination. Nat Protoc
9:529540
77. Clare JP (2012) Axolotls. www.axolotl.org
Chapter 4
Husbandry of Spanish Ribbed Newts (Pleurodeles waltl )
Alberto Joven, Matthew Kirkham, and Andrs Simon
Abstract
Research on urodele amphibians, such as newts, is constantly contributing to our understanding of fundamental
biological processes. In the present chapter, we present detailed husbandry protocols for the Spanish
ribbed newt (Pleurodeles waltl ). We describe the main phases of their life cycle, with emphasis on the
progressive development of sensory, motor, and integration systems, which lead to the acquisition of specific
stereotyped (and conditioned) behaviors. The methods are outlined to manage housing, feeding, handling, captive breeding, health monitoring, and euthanasia in this species under laboratory conditions.
With minor changes, these protocols can also be applied to other species of urodele amphibians commonly
used in laboratory research.
Key words Salamander, Housing, Environmental enrichment, Reproduction, Breeding, Larvae,
Development
Introduction
Urodele amphibians became well known by scientists in the past,
mostly due to their large embryos, the relatively easy manipulation,
and their external and slow development that can be modulated by
temperature [14]. All these facts together permitted to easily analyze the key stages during ontogenetic development, and as a
result, research in urodeles provided significant knowledge regarding the ontogeny of vertebrates [2, 59]. In addition, the absence
of rejection after transplant [2, 10], their extraordinary regenerative abilities [1115], the large size of their neurons and neuroendocrine cells [2], and the secondary simplification that characterizes
their nervous system [16, 17] have attracted the attention of generations of researchers. Since urodeles have become amenable to
modern molecular technologies, such as transgenesis and genome
editing, they provide reemerging animal models in particular for
studying development and regeneration [2, 15, 1831]. The
Spanish ribbed newt is a relatively large urodele species natural of
the Iberian Peninsula and Morocco that can reach 31 cm long,
47
48
Alberto Joven et al.
although most individuals length ranges between 14 and 18 cm

[3235]. Wild populations develop two types of lifestyle, aquatic
and terrestrial, although the latter mostly happens in order to survive either the drying of water masses in which they live or extremely
cold environments [33, 35]. In the cases in which the place does
not dry up and remain suitable, the Spanish ribbed newts carry out
an entirely aquatic lifestyle [32, 36]. Accordingly, in captivity, they
can be housed in entirely aquatic systems, provided with environmental enrichments, such as floating surfaces that some individuals
eventually use [32]. Wild Pleurodeles can be found in shores, shallow and deepest parts of ponds, streams, and small lakes [33],
although some authors suggest that they are more difficult to be
seen during daytime, when they seem to remain in the deepest
parts, hidden either among the aquatic vegetation or under stones
[35, 37]. Therefore, for environmental enrichment, it is important
for the adults to facilitate them the access to floating surfaces,
aquatic plants, and hiding places. The diet during the adult aquatic
stage is based on a wide spectrum of invertebrate and vertebrate
species such as worms, crustaceans, snails, aquatic insects, small
fish, and amphibians, even practicing cannibalism. Similarly, the
larvae prey principally on different species of zooplankton, insects,
and amphibian larval forms, including conspecifics [33, 35]. Two
main conclusions can be obtained from this information: (1) it is
recommended to provide more than just one source of food, and
(2) the animals must be housed with tank mates of the same size in
order to avoid loss of animals due to cannibalistic behaviors.
The breeding season varies in the different wild populations
depending upon the environmental conditions, being restricted
to the spring time in places where winter is harsh. However, in
some temperate areas, the breeding season usually extends from
September to April, coinciding the starting with the first rains of
autumn [33, 35]. Mating occurs by spermatophore transfer after
amplexus, in which the male holds the female with his forelimbs,
placing her on his back. After several hours, the male twists
around and deposits a spermatophore which is up taken by the
female after the male manipulates her body [33, 35, 3739].
2448 h later, the female start to lay a variable number of eggs,
which is correlated with her age and size [33, 35, 39]. The
embryonic and larval development takes 26 months in the wild,
as is dependent on environmental factors, such as temperature,
and the size of juvenile newts at metamorphosis is very variable
[33, 35]. The specific developmental stages can be defined as
outlined in Table 1 [4047]. According to Gallien and Durocher
[41], the different stages of the Spanish ribbed newt development are grouped in three principal periods: embryonic life (till
hatching), initial larval period (ending at the beginning of feeding),
Am
141
4244
Life history
Embryonic
stages
Initial larval
stages
3538
034
Pw
Peg stage,
e2D stage
Tailbud stage,
limb field stage
bud stage
Nv
Peg stage: larva transparent, internal organs including heart, stomach,

visceral arches, and auditory capsules are visible; balancer at the maximum
point of development, hindbrain and midbrain show more growth and
maturation than forebrain areas (Pw St. 3536)
e2D stage: forelimb bud elongation (final shape: paddle), mouth opening,
gill branching and elongation, yolk absorption, hindbrain, and midbrain
show more growth and maturation than forebrain areas (Pw St. 3738)
Fertilization, first cleavages (Pw St. 04).

Blastulation (Pw St. 57).
Gastrulation (Pw St. 813).
Neurulation, somatogenesis (5 pairs of somites), eye primordium formation
(Pw St. 1421)
Somatogenesis (from 5 to 9 pairs of somites): brain flexure and growth,
pronephros and tailbud formation, otic placode, and gill primordia
appearance (Pw St. 2224)
Tailbud (from 10 to 19 pairs of somites): brain growth and early
segmentation, branchial furrowing, body axis straightening, tailbud
enlargement, olfactory organ primordium, melanophores in trunk, and
balancer appearance (Pw St. 2529)
Limb field (from 20 somites on): brain regionalization, lateral line
formation, appearance of melanophores in head region, unbranched gills
enlargement, and circulation establishment in gills and tail (Pw St. 3032)
Bud stage I: beginning of brain maturation, forelimb bud primordium formation,
eye maturation, operculum and mouth formation, gill branching and elongation,
second lateral line bypasses the forelimb on the ventral side (Pw St. 33)
Bud stage II: growth and maturation of hindbrain, mouth opening,
forelimb bud formation, balancer elongation (Pw St. 34)
Peculiarities:
In Notophthalmus viridescens, the embryo is encapsulated in a series of five
concentric jelly layers. Due to the limited sac space and the strong layers
covering it, the embryo is specially curved as growing proceeds
Ambystoma mexicanum dont develop balancers
Development of external characters
(continued)
Use of balancers to remain adhered in

all surfaces
Steady behavior
Escape response triggered by visual/
vibrational stimuli
Feeding: stereotyped suction marks
the end of this period
Development of sensory systems

Mechanoreceptive endings
in the skin
Skin excitability to noxious stimuli
A visual system firstly based on the
pineal eye, which is excited by
dimming
Development of locomotion in urodeles
First movements (head flexure stage)
C-coil stage
S-wave stage
Swimming
Miscellaneous
Primitive reflex mechanism: Muscular
response to a mechanical stimulus
Heart beating appearance
Spontaneous muscular movements
Sporadic swimming
Hatching
Development of key physiological and

behavioral events
Table 1
Comparative depiction of developmental periods of commonly used salamander species based on external characters and physiological and behavioral key events
56, 56+
Juvenile,
adult
Eft, adult
Hind limb: eT, 2T,

3T, 4T, 5T
Forelimb: 2D,
e3D, 3DI,
3DII, 4D
Hind limb: Limb
field, bud I,
bud II, bud III
Nv
Metamorphosis I: complete disappearance of fin and gills,

skin change, eyes reorientation (Pw St. 56)
Body growing, maturation of the brain (specifically
hypothalamus), sexual maturation (Pw St. 56+)
Metamorphosis II: skin change, fin development, brain
completely developed (Pw St. 56+)
Ambystoma mexicanum dont metamorphose
Balancer disappearance, formation of two fingers in hind limbs

(Pw St. 4649)
Formation of the five fingers and articulation in hind limbs, gills
at the maximum point of development, growth and maturation
of the brain, specifically forebrain basal ganglia (Pw St. 5055a)
Gills reduced to half of their size, fin regression, limbs
thickening, skin transformation in trunk region (Pw St. 55b)
First molting, skin transformation in the whole animal,
flattened head, gills extremely reduced (Pw St. 55c)
Formation of three fingers and elbow articulation in forelimbs,

hind limb bud primordia appearance, balancer thinning, gill branching and
elongation, numerous melanophores distributed
in the caudal fin, main subdivisions of the brain already present
(Pw St. 3942)
Formation of the forth finger in forelimbs, hind limb bud
formation, balancer reduction, differential growth of the
forebrain areas (Pw St. 4345)
Development of external characters
Am Ambystoma mexicanum, Nv Notophthalmus viridescens, Pw Pleurodeles waltl, St stage
57, 57+
4655c
Late active
5357
larval stages
Pw
3945
Am
Early active
4552
larval stages
Life history
Table 1
(continued)
Notophthalmus viridescens and Pleurodeles

waltl
Terrestrial lifestyle of the eft
Aquatic lifestyle of breeding adults
Terrestrial and aquatic lifestyles of
nonbreeding adults depending on
environmental cues
Feeding: jaw prehension or biting
Feeding: tongue prehension
Ambystoma mexicanum
Completely aquatic lifestyle
Scouting: head movements combined

with walking in the active seeking for
food
Feeding: acquisition of the use of
olfactory cues
Learning: care taker recognition
Cannibalistic behavior modulated by
learning
Progressive use of the hind limbs
Pulmonary breathing
Floating
Scouting: head movements from side

to side
Feeding: acquisition of lunging
Learning: modulation of
suction + lunging
Cannibalistic behavior, more common
at high density of larvae
Coordinated walking in the bottom
with the forelimbs
Development of key physiological and

behavioral events
51
and active larval life (in which limbs and complex behaviors
develop) finishing at metamorphosis. In the following paragraph,
more details of the different stages are given.
Throughout embryonic development (stages 034), in addition to the body plan formation, visual and olfactory primary
organ primordia develop, together with the mechanoreceptory
and chemoreceptory lateral line [41, 48]. The motor system also
appears, and basic stereotyped movement acquisition ends up in
swimming [4951]. Before hatching, at each side of the head a
balancer appears (a filament-like appendix used for remaining
adhered to different surfaces), followed by the development of
three branchial arches. During initial larval life (stages 3538),
behind the branching gills, the forelimb buds arise, and the visual
and lateral line systems mature along with the escape response
associated to visual and mechanical stimuli, although most of the
time the larvae remain steady, absorbing the remaining yolk
[26, 27, 5254]. By the end of this period, larvae start to eat by
stereotyped suction mechanism, driven also by visual and vibrational stimuli, but without active food searching. Consequently,
in the laboratory, live foods such as Artemia nauplii should be
provided. At this point, the active larval life begins and lasts about
3 months in Pleurodeles waltl, during which many morphological
variations occur related to key physiological and behavioral
changes [26, 27, 41, 45]. The active larval period can be further
divided into two phases: early active larval period (stages 3945,
when forelimbs develop) and late active larval period (stages
4655c, when hind limbs develop) [26, 27]. In the early active
larval period, the most remarkable external changes include the
loss of the balancers and forelimb development. In terms of hunting behavior, this period is driven by a refinement of the suction
technique, related to scouting the surroundings by first forelimbdriven walking steps together with head movements from side to
side, and the acquisition of lunging. During the late active larval
period, the hind limbs are formed, a major growth in the body
occurs, and the main structures present in the adult brain can be
recognized [26, 27, 41, 45]. From this period onwards, the
olfactory system start to be important for feeding, as active seeking followed by sniffing results in the capacity of predating on
immobile food such as commercial fish pellets or frozen food. In
addition, learning processes by classical conditioning can be
assessed during this period, as larvae show different behaviors
when raised in different conditions.
The present chapter describes husbandry protocols for successfully caring, breeding, and raising Pleurodeles waltl in the laboratory in a simplified manner with the aim of making the caretaker
job as easy and efficient as possible.
52
Materials
2.1 Tanks,
Containers, and
Environmental
Enrichment
Complements
In general, most of the supplies available from Aquarium suppliers

are sufficient.
1. Rack system: optional (Fig. 2a).
2. Plastic boxes in different sizes: pay attention to the maximum
number of animals that are recommended to be housed
together (Fig. 2b).
3. Aquaria: pay attention to the maximum number of animals
that are recommended to be housed together (Fig. 2b).
4. Gravel: large size to avoid accidental ingestion.
5. Tiles: can be used either whole for big setups or broken in
pieces for smaller tanks/containers.
6. Stones: select the irregular ones that can provide hiding places.
7. Natural or artificial plants.
8. Cork pieces/styrofoam: the borders ought to provide a shorelike structure.
2.2 Aquarium Setup,

Maintenance,
and Food
1. Filters (e.g., Fluval U2, U3, or U4 internal filters) or similar

biofilters.
2. Air pumps with accessories.
3. Syphon (e.g., Marina Easy clean gravel cleaner).
4. Nets and filter-cleaning brushes.
5. Artemia hatchery.
6. Tap water conditioner (e.g., Nutrafin Aqua Plus Tap water
conditioner).
7. Broad spectrum antibiotic/antimycotic (e.g., General tonic
from Tetra Medica).
8. Marine salts (artificial aquarium sea salt mixture).
9. Live Tubifex worms.
10. Live Grindal worms.
11. Artemia cysts.
12. Frozen food and pellets.
2.3 Laboratory
Supplies
and Equipment
1. Surgical no. 5 forceps.

2. Plastic Pasteur pipettes.
3. Surgical scalpels.
4. 24-well plates.
5. Petri dishes (150 mm 25 mm cell culture dish).
6. Stereomicroscope with fiber optic illumination.
2.4 Reagents
and Solutions
53
1. Ultrapure water (distilled water).

2. Human chorionic gonadotropin (e.g., Sigma-Aldrich, cat no.
C8554).
3. Cysteine (L-cysteine hydrochloride hydrate).
4. MS-222 (Tricaine methanesulfonate): Dissolve 1 g of
MS-222 in 1 L of dechlorinated tap water.
5. 10 Modified Holtfreters solution (MHS): Dissolve 34.6 g of
NaCl, 0.5 g of KCl, 1 g of CaCl2, 2 g of NaHCO3, and 2 g of
MgSO4 in 1 L of ultrapure water. Store at 4 C.
6. 20 % MHS (for embryos): Dilute 20.4 mL of 10 stock MHS
in 1 L of distilled H2O. Add 10 mL of penicillin-streptomycin.
Adjust the pH to 7.6 with 1 N NaOH.
7. 4050 % MHS (for larvae and adults): Dilute 41.652.6 mL of
10 stock MHS in 1 L of distilled H2O. Adjust the pH to 7.6
with 1 N NaOH.
8. 1 MHS (for recovering adults, unfertilized eggs, and sperm
solution): Dilute 111.1 mL of 10 stock MHS in 1 L of distilled H2O. Add 10 mL of penicillin-streptomycin. Adjust pH
to 7.6 with 1 N NaOH.
9. Marine salt solution: dissolve 30 g of marine salts in 1 L of
distilled H2O.
Methods
3.1 Housing
Metamorphic/Adult
Newts
Although the metamorphic ribbed newts are air breathers, in

nature this species is mostly aquatic and remains all the year in
water if the conditions are favorable (see Note 1). As the laboratory
conditions are quite stable, there is no need for the animals to
undergo hibernation or aestivation, and newts can be housed in an
aquatic-based environment described herein, supplemented with
just a floating surface (Fig. 1a).
1. Prepare the location in which the animals will be settled, having
in mind ventilation, light/darkness (see Note 2) conditions,
and possible temperature fluctuations (see Note 3).
2. Select the appropriate container according to the number of
animals that are to be housed (Fig. 2).
3. Brush the tank (see Note 4) under hot tap water, and give a
final rinse it in cold tap water.
4. Fill up the tank with chlorine-free water (see Note 5).
5. Add environmental enrichment objects (see Note 6) distributed evenly in the tank, providing at least a floating surface,
artificial plants, and hiding places (Fig. 1a).
6. Add the filter (see Note 7), heater, and air pump if desired.
54
Fig. 1 Setups for Spanish ribbed newts and key features of the different developmental stages. (a) Aquarium
for juveniles and adults. (b) Adult newts. Note the difference in the shape of the body and the specialization of
the male forelimbs (arrowhead). (c) Detail of a Petri dish containing Pleurodeles embryos. Note the contaminated eggs that should be removed. (d) Representative stages of embryonic development, according to Gallien
and Durocher [41]. The arrowheads point to the blastopore at stage 11, the closure of the neural tube at stage
18, the eye protrusion at stages 20 and 23, and the balancer at stage 30; the gill primordia are encircled at
stage 30. (e) Box for housing initial and early active larvae. (f) Dorsal, lateral, and ventral views of late embryo,
hatchling, and initial larva; note the progressive development of the forelimb buds (small circles in dorsal
view), the development of the digestive system (big circles in ventral view), and the maintenance of the balancer (arrowheads). (g) Box for late active larvae. Observe the even distribution of environmental enrichment
objects. (h) Early and late active larvae, showing the appearance and development of the hind limbs (circles)
55
Fig. 2 Examples of housing systems for Spanish ribbed newts and advisable maximum number of animals that
should be housed together. (a) Hypothetical rack system. (b) Housing in Petri dishes, plastic boxes and aquaria
of different sizes
7. Check that the temperature of the water ranges between 15

and 28 C.
8. Transfer the newts to the tank (see Subheading 3.3 for appropriate handling).
9. Ensure that the lids of the tank allow air exchange with the
room and prevent newts from escaping.
3.2 Feeding
Metamorphic/Adult
Newts
Feed the animals every 23 days (see Note 8).

1. Select the appropriate food types (Table 2), weigh the desired
quantity, and mix altogether (see Note 9).
2. Distribute the food evenly in the tank.
3. If some newts are found in the floating land areas, offer them
food (see Note 10) helped by forceps (see Note 11).
3.3 Handling
and Sexing Postmetamorphic/Adult
Pleurodeles waltl
1. Use a net to take a newt out of the tank (see Note 12).
2. Grip the newt by the base of the tail with one hand.
3. Observe the cloaca (see Note 13).
4. Place it calmly in the palm of your other hand.
5. Observe the forelimbs (see Note 14 and Fig. 1b).
Frozen
food
Free-living
food
Type
White mosquito larvae
Black mosquito larvae
Mysis
Bloodworms
Cyclops
Grindal worms
(Enchytraeus sp.)
Artemia nauplii from

commercial cysts
Tubifex worms
Name (and reference

where possible)
Pet shop/online (e.g.,

[email protected])
[email protected])
[email protected])
[email protected])
[email protected])
310
310
28
310
0.52
0.5 10 to
1 40
0.5 2 to
14
Pet shop/aquarist
Pet shop/aquarist
0.4
Size (mm)
Pet shop/online
Where to find it?
Types of food, sources, sizes, adequateness, and suggested quantities
Table 2
Late active larvae
Late active larvae
Late active larvae
Early and late

active larvae
Late active larvae
Early active larvae
Early and late

active larvae
Early active larvae
Adequate for
812 g
812 g
812 g
812 g
812 g
Can be used as a
supplement:
~500 worms
Can be used as a
supplement:
~500 worms
Inadequate
Quantity for
feeding 200 late
active larvae of
~0.2 g/larvae
1215 g
1215 g
1215 g
1215 g
Inadequate
Inadequate
Inadequate
Inadequate
Quantity for feeding

50 metamorphic
juveniles of ~2 g/newt
56
Pellets
Pet shop/online
(www.hikari.info)
Pet shop/online
(www.jbl.de)
JBL Pond Sterlet

(4020000)
Pet shop/online
(www.tetra.net)
Pet shop/online
(www.nlsfishfood.com)
Pet shop/online
(www.tropical.pl)
Pet shop/online (www.
aquatic-nature.com)
Pet shop/online
(www.tetra.net)
Pet shop/online
(www.tetra.net)
Pet shop/online
(www.nlsfishfood.com)
Powder Microvit
BASIC (70342)
Tropical energy food
S (TENF190)
Cichlid mini granules
(T506387-CE)
TetraMin granules
(T505322CE)
New Life
SPECTRUM
Community fish
formula
Tropical Spirulina
granulat (60434)
New Life
SPECTRUM
Amphibian formula
Hikari tropical sinking
wafers (21521)
Early and small late
active larvae
Late active larvae
Late active larvae and
small juveniles
small juveniles
0.40.8
13
Metamorphic
juveniles (previously
broken) and adults
Big adults
6 12
78

small juveniles
Metamorphic
juveniles and adults
12
13
12
Early active larvae
0.1
Inadequate
Inadequate
Inadequate
0.51 g
0.51 g
0.51 g
0.51 g
0.51 g
Inadequate
Inadequate
12 g
12 g
12 g
12 g
12 g
Inadequate
Inadequate
Inadequate

57
58
3.4 Cleaning
Post-metamorphic/
Adult Pleurodeles
waltl
For small experimental setups lacking filter, partial cleaning should

be done the day after feeding, and a thorough cleaning is recommended at least once every 7 days. In the case of large tanks
equipped with filter and air pump, partial cleaning should be done
once a week and thorough cleaning once a month.
Partial cleaning
1. Take the tube of the syphon and fill it up with water.
2. Holding both endings of the tube with your thumbs, place one
of them inside the tank and direct the other one towards an
empty bucket (see Note 15).
3. Release completely the ending of the tube that is inside the
tank, and modulate the vacuum strength with your finger by
opening and closing the opposite ending.
4. Use the vacuum to take out of the tank at least one third of the
water from the bottom part, absorbing as much detritus as
possible (see Note 16).
5. Refill the tank with chlorine-free tap water (see Note 5).
Deep cleaning
1. Set up a new tank using the procedure described in
Subheading 3.1.
2. Transfer the animals to the new tank using a net.
3. Empty the water of the old tank. Rinse the filter, stones, cork
mat, gravel, and plant over a bucket to collect the water.
4. Brush the stones and the cork mat, clean the filter (and all its
components), and move the gravel under hot tap water and
natural plants under cold tap water.
5. Brush the old tank under hot tap water.
6. Rinse everything in cold tap water.
3.5 Promoting
Natural Breeding
Animals kept in good conditions will eventually produce natural

spawns if both sexes are housed together, so regular ocular inspections shall be done to detect eggs (see Note 17). Remove the eggs
from the breeding tank to avoid predation from the adults which
subsequently provide the best conditions for the offspring to
develop (see Subheading 3.7). Natural breeding can be promoted
by mimicking the conditions in which the Spanish ribbed newts
reproduce in their natural environment:
1. Decrease the water level gradually during 1530 days, increase
the temperature to 30 C, and feed the newts only once a week
during that period (see Note 18).
2. Increase the level of water in three consecutive days, decrease
the temperature, and start feeding daily (see Note 19).
59
3. Observe the behavior of the newts (see Note 20) and look for
eggs in the tank.
4. Collect all the eggs from the breeding tank using a widemouthed plastic pipette (see Note 21), and place them in a
clean container (see Note 22).
3.6 Artificial
Fertilization
For in vitro fertilization, males and females are kept separately, as

the female newts are able to keep the sperm for several months
after mating [55]. This ensures that fertilization occurs exactly
when you want to.
1. Select adult newts that display breeding morphology (see Note 23).
2. Under anesthesia (see Note 24), give the female a dose of
50200 IU of human chorionic gonadotropin (see Note 25)
by injecting it subcutaneously in the lower jaw (see Note 26).
3. After 818 h, place the female in 100 % MHS (see Note 27);
she will start to lay eggs that must be collected every 15 min to
perform the in vitro fertilization (see Note 28).
4. Under anesthesia, squeeze the male abdomen by pressing
gently to collect the sperm in a 2 mL tube containing 100 %
MHS supplemented with antibiotics (see Note 29).
5. Place the collected eggs in a Petri dish and remove the excess
of MHS. Add some sperm solution over the eggs, and then
mix it by collecting the eggs with a widemouthed plastic
Pasteur pipette (see Note 30).
6. Wait 15 min (see Note 31), and add 20 % MHS (supplemented
with antibiotics) to the fertilized eggs to allow water absorption by the jelly (see Note 32).
3.7 Egg and Embryo

Maintenance
A daily careful inspection of the eggs is essential to prevent microbial growth. Remove any unfertilized or contaminated eggs (see
Fig. 1c), and change the medium (chlorine-free tap water or MHS)
every 24 days.
1. Fill up the new housing place with chlorine-free tap water or
20 % MHS.
2. If necessary, release the egg from the jelly (see Note 33) either
mechanically using no. 5 forceps or chemically by rinsing them
in a solution of 2 % cysteine in 20 % MHS at pH 8.0 for
25 min. In the latter case, several washes in freshwater/20 %
MHS must be done afterwards.
3. Follow the correct development of the embryos (Fig. 1d), and
separate those that show abnormalities.
4. After hatching, when larvae start swimming, monitor daily the
development of the embryos for free-living food to be supplemented at appropriate timing (see Note 34 and Fig. 1f).
60
3.8 Housing Newt

Larvae
1. Select an appropriate container (see Note 35) according to the

number of animals that are to be housed and their developmental stage and size, in order to provide them with the
required area (see Note 36 and Figs. 1dh and 2b).
2. Brush the tank under hot tap water, and give a final rinse it in
cold tap water.
3. Fill up the tank (see Note 37) with chlorine-free water
(see Note 5).
4. Fix the heater and air pump (see Note 38).
5. Add environmental enrichment objects in the case of late active
larvae (see Note 39 and Fig. 1g).
6. Check that the temperature of the water ranges between 15
and 28 C.
7. Transfer the larvae to the tank (see Subheading 3.10 for appropriate handling of larvae).
3.9 Feeding Newt

Larvae: General
Procedures
1. Maintain the alternative sources of Artemia (see Note 40)

regarding free-living food: Tubifex (see Note 41) and Grindal
worms (see Note 42).
2. Select the appropriate food (Table 2) according to the developmental stage (see Note 43).
3. Chop the food in small pieces if necessary (see Note 44).
4. Mix the desired quantity in 500 mL of chlorine-free water.
5. Use a wash bottle (see Note 45) to evenly distribute the food
among all the larvae (see Note 46).
6. Clean the wash bottle under tap water, and let it dry
completely.
3.10 Handling Newt

Embryos and Small
Larvae
The big larvae can be easily collected using a net, but embryos and
small larvae are more fragile and can be easily killed when trying to
pick them up with a net. Use Pasteur pipette as described below.
1. Cut the tip of a plastic Pasteur pipette to have an opening
larger than the size of the larvae to be transferred.
2. Calmly approach the larva with the widemouthed Pasteur
pipette.
3. Capture the larva by a quick vacuum movement.
4. Use your finger tip to close the opening of the pipette
(see Note 47).
5. Release the larva into its new location.
3.11 Cleaning Boxes

and Tanks for Larvae
Clean the nonfeeding larvae setups (Petri dishes) at least once a

week. The feeding larval containers require cleaning every second
day (see Note 48).

3.11.1 Petri Dishes
61
1. Collect the eggs/embryos/initial larvae with a tip-cut pipette,

and place them directly into a new one.
2. Clean the old Petri dish brushing it with hot tap water, give a
final rinse in cold tap water, and let it dry completely. If contamination detected, discard the Petri dish.
3.11.2 Plastic Boxes
1. Place a large net over an empty plastic box or a bucket.

2. Prepare a small container with freshwater.
3. Take out the stones and artificial plants, and brush them under
hot tap water.
4. Transfer the entire volume from the container with the newt
larvae through the net.
5. Gently move the net to discard detritus and transfer the larvae
into the small container with freshwater (see Note 49).
6. Remove any remaining debris using a pipette from the temporary tank containing the larvae.
7. Check in the empty container that no larvae escaped in the
filtering process and discard the water.
8. Brush the plastic tank under hot tap water, and give a final
rinse in cold tap water.
9. Fill the tank with chlorine-free water.
10. Replace the stones and artificial plants and gently place the
larvae into the clean tank.
3.12 Health
Inspection and
Treatment of Diseases
Periodically observe the animals for signs of abnormalities in the

skin (i.e., bleeding, ulceration, pigmentation abnormalities, fungus),
behavior (i.e., slow moving, floating, or upside-down animals),
and body constitution (either bloating or extremely skinny animals) (see Note 50).
1. If a sick animal is detected, isolate it from the main tank.
2. Place the animal in a temporary plastic container filled with
marine salt solution for 15 min. Skip this step if the affected
newt is a larva.
3. Transfer the newt into a tank with an easy access to an artificially
created land area and containing 4050 % MHS supplemented
with antibiotic/antimycotic (follow manufacturers instructions) (see Note 51). The depth should be around 10 cm.
4. Change the water of the tank every second day.
5. Daily follow the state of the sick newt and check the other
newts in the tank in which the sick animal was found.
6. If more animals are affected in the same tank, empty it, brush
it with marine salt solution, autoclave the stones/tiles, submerge the filter for 1 h in salt solution after cleaning it, replace
62
the plants with new ones, and treat all the tank mates as
described in steps 2 and 3. Refill the tank with chlorine-free
water and add antibiotic/antimycotic solution.
7. Every 2 or 3 days, change one half of the volume of the tank.
8. Stop the treatment when the animals look healthy, 2 days after
the signs disappear.
3.13
Euthanasia
In those cases where no signs of improvement are observed after

treatment, the animal should be euthanized.
1. Place the animal in 0.1 % Tricaine so the depth of the water is
about 13 cm.
2. Wait a minimum of 30 min to ensure that the newt is deeply
anesthetized.
3. Using sharp scissors, cut through the neck of the salamander
to remove the head.
4. Quickly crush the skull with the flat side of the scissors or a
blade.
5. Freeze the rests of the animal inside a paper towel and discard
it according to the local regulations of the laboratory.
Notes
1. During the periods of extreme temperatures, Pleurodeles waltl
may undergo hibernation and aestivation. During these processes, the skin becomes thicker and less permeable; Animals
decrease food intake and slow down the metabolic rate.
Nevertheless, Spanish ribbed newts have been found all along
the year having an active lifestyle in the water [3236].
2. Natural populations experience slight variations along the year
in the light-dark (LD) cycle which approximately ranges from
(LD 15:9) in summer to the opposite in winter (LD 9:15).
They can be kept in a (LD 12:12) in laboratory conditions,
although placing the newts under the influence of natural light
(i.e., close to a window) or alternatively adapting the timer of
the animal facility trying to mimic the natural LD cycle (15 min
of light/week) may benefit the adult newts and induce the
natural breeding at the corresponding time of the year.
3. The Spanish ribbed newt has a high temperature tolerance. In
nature, this species survives in regions in which absolute temperatures range from bellow 10 C to over 40 C. In the
laboratory, the stable temperature prevents most of the newts
undergoing hibernation and aestivation. Nevertheless, some
animals may decide to spend several days/weeks in the floating surfaces, eating very little, moving slowly, and showing
63
skin changes typical of those two processes. Unless an animal

experiences an alarming loss of weight (such as two thirds of
their initial body mass), there is no reason to worry. They will
sooner or later go back to the water and eventually breed.
4. You must not use any soap or detergent. Usually, brushing the
different components under hot tap water is sufficient, but if
deep cleaning is desired, a good option is to use marine salt
solution described in Subheading 2.4, item 9. Disinfection by
autoclaving is advisable for stones, rocks, and tiles. In some
cases, 10 % bleach can be used for cleaning or disinfecting filters, but it is very important to rinse the tanks and filters several
times with tap water, let it dry for 24 h, and rinse it again several times before use.
5. Keep tap water in a separate container for 24 h to remove chlorine, and to equilibrate with the room temperature. Alternatively,
anti-chlorine product can be added to temperate tap water
(1525 C) according to the manufacturers instruction.
6. Newts should have the opportunity of choosing between
climbing on floating devices (such as cork mat or Styrofoam)
or remaining in the water. Under the water, they appreciate
hiding places. Entire or broken tiles are probably the best
option for this purpose, as they are easy to clean and offer a
good hiding area. Live or artificial plants available from aquarium suppliers are a good option to enhance the atmosphere in
an aquarium. For making an artificial plant, place some gravel
in a light-colored plastic bag (better green color) and make a
tight knot close to the base; then, cut the remaining plastic in
stripes of 12 cm thickness. The use of gravel or stones is
optional and it makes cleaning more laborious. If included, the
size of the gravel should be large enough so that the newts do
not swallow them by mistake.
7. The filter should direct the water flow towards the surface or
one of the corners of the tank in order to avoid strong flow.
8. Newts do not require feeding every day; two to three feedings
per week is sufficient. The frequency of feeding can be modulated according to the season to mimic natural conditions.
Animals can be offered food once a week for mimicking winter
time (LD 9:15) and every day for mimicking summer time
(LD 15:9).
9. Alternatively, choose one type of food for each feeding day.
10. To avoid rejection of the food in land, the dry pellets may be
placed in water for some min before offering them to the newts
and the frozen food shall be defrost.
11. In land, newts will rely mostly on their visual system, and thus
they recognize the food only if it moves. For that reason, one
should offer different types of food with a forceps, moving it
64
back and forth as if it would be a living prey (or alternatively

living preys such as earthworms can be offered with the forceps). After a first recognition, some newts will approach the
prey with snout and catch them by jaw prehension, while others may grab them directly by tongue protrusion [38, 57].
12. Regarding body proportions, males present larger tails, while
females tend to show a thicker body [32, 33, 35, 54].
13. Males cloaca shows papillary appearance, whereas females
cloaca presents inward borders. Males cloaca swells up during
the breeding season [32, 33, 35, 54].
14. Males forelimbs are proportionally longer and stronger than
females ones, and during breeding season the male forelimbs
develop black rugosities (nuptial pads) that are used to grip the
females during amplexus [32, 33, 35, 54].
15. For the vacuum to work, the level of the water in the tank must
be higher up than the bucket.
16. Avoid vacuuming close to the newts. If an animal gets stuck
into the tube, simply close the outflow ending of the tube and
the animal will be able to swim out of the tube.
17. Eggs can be found attached by the jelly coat either in the substrate, stones, or artificial plants. The eggs have an upper dark
animal pole and a lower opaque vegetal pole, so they are usually detectable after softly moving those objects in where they
may be present.
18. For the best results, coinciding with the decrease of water level
and feeding frequency, gradually lengthen the light cycle to
mimic the summer period (LD 15:9). Return slowly towards
the autumn-like light cycle (LD 12:12) starting 1 week before
increasing water level and food intake.
19. Not only increasing the quantity but also the variety of food may
have a positive effect on the induction of natural breeding.
20. The behavior of interest is the amplexus, as it precedes the
spawn. It can be recognized easily (see Subheading 1).
21. The plastic pipette should be cut in order to get a 34 mm tip
diameter. The jelly coat surrounding the egg is highly sticky;
therefore, once the eggs are drawn into the pipette, close the
opening with a finger.
22. Petri dishes can be used to facilitate oxygen exchange in water,
or alternatively an air pump can be supplied if the eggs are
placed in a large plastic container.
23. Breeding ribbed newts have swollen cloacae and flattened tails.
24. To anesthetize a newt, place it in a plastic box containing 2 cm
depth Tricaine solution (see Subheading 2.4, item 4) and
close the lid. Wait a minimum of 10 min before seeing if it is
65
anesthetized by placing the animal on its back. If it doesnt

move within 510 s, it is anesthetized.
25. Eggs can be collected from the same animal every 24 weeks,
although it is better to wait 23 months to avoid females stress.
26. The hormone can alternatively be injected intramuscularly in
the dorsal musculature, although the results are less satisfactory.
27. 1 MHS is used rather than water, as it prevents the jelly to
absorb water, which in turn inhibits fertilization.
28. Eggs remain fertile for about 30 min. The female can be gently
squeezed in order to collect the eggs ready to be laid in the
oviduct every hour, although the best results are obtained by
simply collecting the eggs every 15 min, avoiding the stress
produced by squeezing.
29. Sperm can be collected from the same animal every 23 weeks.
30. This step improves the fertilization rate, as the sperm motility
is activated by the jelly coat proteins, and the plastic pipette
mimics the oviduct in which eggs are fertilized in the case of
natural spawns.
31. Do not let the eggs completely dry at any time.
32. Eggs can be kept in chlorine-free tap water; however, the best
survival rates are obtained when artificial freshwater is used,
especially when supplemented with antibiotics/antimycotics
(See Subheading 2.4, item 6).
33. Egg jelly is a natural protection of the amphibian eggs but
sometimes sticks to undesirable material, such as detritus. In
this case, eggs shall be released from the jelly coat.
34. A good knowledge regarding newts life cycle is crucial for freeliving food to be supplemented at appropriate timing, preventing
the loss of animals due to cannibalistic behaviors (Table 1).
A sign indicating that larvae are ready to start hunting is the
disappearance of the whitish/yellowish color in the belly.
35. For eggs and embryos, Petri dishes are a good option, as the
oxygen requirement of eggs and early embryos is low and it
facilitates daily monitoring to separate unfertilized/dead eggs
from the healthy ones. For larvae, plastic tanks with external air
pumps are recommended, as they are more adaptable, and it
will allow to separate the animals based on size.
36. The surface area of the tank is more important than the volume, as newt larvae mostly lay in the bottom. The abrupt
increase in areal requirements from sedentary to early active
larvae as shown in Fig. 2b is due to the beginning of feeding.
This is to minimize cannibalistic behavior.
37. It is better to keep small larvae (initial and early active) in a
container with 510 cm depth of water, so they can find the
66
free-living food easily, they do not accidentally desiccate, and

the waste derived from non-eaten food and detritus will not
strongly decrease oxygen content. The water depth can be
increased for late larvae around 34 cm until 15 cm, as they
start to use all levels of the water column, albeit 10 cm is
enough. This will also help them to get air from the water surface, after they form the lungs and combine oxygen intake
from water and air sources (stage 55a).
38. Both the heater and the air pump are recommendable in larval
setups, although not essential. The former can be used to
increase the growth rate of the larvae, and the latter improves
the oxygen concentration of the water, preventing the growth
of undesirable microbiota and the consequent death of larvae,
especially when the water temperature is high.
39. The environmental enrichment of larvae of stages 4555a is
based on subaquatic objects (i.e., hiding objects and natural/
artificial plants). When signs of metamorphosis are seen, such
as absorption of the gills and a major change in pigmentation,
a floating surface should be provided. In addition, a lid is necessary at this point to prevent young metamorphic newts
escaping out of the tank.
40. Artemia nauplii provide adequate free-living food for the
early active larvae [55, 56]. Commercial Artemia cysts will
hatch in 13 days, and hatched nauplii can be used as food as
long as they remain alive, which is only possible if oxygen and
food is given. Its good to start a new culture every second day.
Filter the Artemia to discard the salt water of the culture and
distribute the nauplii evenly among the newt larvae using a
wash bottle.
41. Keep the Tubifex sp. in a plastic tank filled up with water and
provided with oxygenation through an air pump. Small doses
of fish pellets can be provided as food, but it is not essential.
Check the transparency of the water in the Tubifex culture; if it
is cloudy, change it by chlorine-free tap water (it must be done
every 13 days). Discard the dead worms. For feeding the larvae, collect some living worms and chop them in small pieces
using the lid of a Petri dish and a pair of scalpels.
42. Keep the Grindal worms (Enchytraeus sp.) in several small
plastic boxes filled up with moist soil, avoiding flood and in
dark conditions. Pre-soaked dry dog/cat food or fish pellets
can be used as food source. Worms can be easily collected with
forceps no. 5, a couple of hours after providing a food pellet to
the culture (they will surround the pellet). If the worm culture
grows too fast (i.e., the food is consumed within 24 h), split
the culture into two.
67
43. During the initial larval period, hatchlings live on their remaining
stalk; thus, no feeding is necessary. Once the bellies start to
lose their whitish-yellow appearance of the stalk, the initial
larval period is about to start, and the first meal (free-living
food) should be added. In the early active larval period, larvae
start to prey over small live food, which is recognized usually
by a combination of visual and vibrational cues. They do not
seek for food at these stages, but prey only over the small creatures that pass by their heads. Cannibalistic behaviors become
frequent; thus, it is recommendable to keep them at low densities and ad libitum conditions. At the beginning of the late
active larval period, larvae start to use odor cues to discriminate also steady food, and learning processes modulate food
intake. As a consequence, cannibalistic individuals should be
isolated if detected. Once cannibalism is solved by housing
larvae at appropriate densities, newts can learn that dry pellets
are a source of food. The pellet size after hydration should be
slightly smaller than the mouth of the animal.
44. For small and medium active larvae (stages 4554), cut the
frozen pellets as small as you can before the tablet gets defrost
(also the Tubifex). Mix it in freshwater and filter it.
45. Cut the tip of the wash bottle to increase the flow and to avoid
that food gets stuck inside the outflow tube.
46. The food tends to sink; thus, shake the wash bottle before adding the food into every tank.
47. Closing the opening of the pipette will prevent the larvae to
escape from the pipette and end up on the floor or another dry
surface. If they escape, try to save the larvae using a net or a
wet piece of paper. Avoid catching them with the fingers or
forceps.
48. If the tank is equipped with aeration, partial cleaning can be
done every second day (see Subheading 3.4), followed by total
cleaning after the next 2 days. Do not vacuum the larvae, and
always filter the discarded water through a net before disposal
to ensure that no larvae are being lost in the process.
49. Try to avoid touching the new clean water with the net;
instead, let the larvae gently drop down at a short distance of
the water surface. This procedure will prevent transfer of any
debris from the net to the water.
50. The Caudata Culture website (www.caudata.org) provides
information on the common symptoms and diseases in urodeles [58].
51. You may need to contact the university veterinarian for the
treatment.
68
Acknowledgments
This work could not have been possible without the opportunities
of working with various salamander species along the years, under
different group leaders: Paschalina Kiriakopoulou-Sklavounou
(AUTH, Greece), Agustin Gonzlez (UCM, Spain), and Elly M.
Tanaka (MPI-CBG, Germany). Also, many thanks to all the people
ever involved in the caring of the different colonies and for interesting conversations that resulted in improvements of the protocols, with special thanks to Heino Andreas, Shahul Hameed, Heng
Wang, Laure Belnoue, Tiago Pinheiro, Ivanna Mayorenko, Jorge
Perlado, Patricia Fernndez, Joana Branco, Laura Domnguez,
Sandra Bandn, Ruth Morona, and Nerea Moreno. This work was
supported by a postdoctoral fellowship to A.J. from the WennerGren-Foundation and by the Swedish Research Council to A.S.
References
1. Duprat AM, Gualandris L, Kan P, Pituello F,
Saint-Jeannet JP, Boudannaoui S (1986)
Archives danatomie microscopique et de morphologie exprimentale. Arch Anat Microsc
Morphol Exp 75:211227
2. Eagleson GW (1996) Developmental neurobiology of the anterior areas in amphibians: urodele perspectives. Int J Dev Biol 40:735743
3. Nieuwkoop PD (1996) What are the key
advantages and disadvantages of urodele species compared to anurans as a model system for
experimental analysis of early development? Int
J Dev Biol 40:617619
4. Gualandris-Parisot L, Husson D, Foulquier F,
Kan P, Davet J, Aimar C, Dournon C, Duprat
AM (2001) Pleurodeles waltl, amphibian,
Urodele, is a suitable biological model for
embryological and physiological space experiments on a vertebrate. Adv Space Res 28:
569578
5. Spemann H (1921) Die Erzeugung tierischer
Chimren durch heteroplastische embryonale
Transplantation zwischen Triton cristatus und
taeniatus. Wilhelm Roux Arch Entwickl Mech
Org 120:374706
6. Spemann H, Mangold H (1924) ber
Induktion von Embryonanlage durch implantation artfremder Organisatoren. Wilhelm
Roux Arch Entwickl Mech Org 100:599638
7. Holtfreter J (1933) Der Einfluss von
Wirtsalter und verschiedenen Orgenbezirken
auf die Differenzierung von angelagertem
Gastrulaektoderm. Wilhelm Roux Arch
Entwickl Mech Org 127:610775
8. Duprat AM, Gualandris L, Rouge P (1982)

Neural induction and the structure of the target cell surface. J Embryol Exp Morphol 70:
171187
9. Boucaut JC, Bernard B, Aubery M, Bourrillon
R, Houillon C (1979) Concanavalin A binding
to amphibian embryo and effect on morphogenesis. J Embryol Exp Morphol 51:6372
10. Nacu E, Knapp D, Tanaka EM, Epperlein HH
(2009) Axolotl (Ambystoma mexicanum)
embryonic transplantation methods. Cold
Spring Harb Protoc 2009(8):pdb.prot5265.
doi:10.1101/pdb.prot5265
11. Ferretti P (1996) Re-examining jaw regeneration in urodeles: what have we learnt? Int J Dev
Biol 40:807811
12. Mitashov VI (1996) Mechanisms of retina
regeneration in urodeles. Int J Dev Biol 40:
833844
and behavioural recovery in a salamander lesioninduced regeneration model. Development
134:28812887
14. Chernoff EA, Stocum DL, Nye HL, Cameron
JA (2003) Urodele spinal cord regeneration
and related processes. Dev Dyn 226:295307
15. Nacu E, Tanaka EM (2011) Limb regeneration: a new development? Annu Rev Cell Dev
Biol 27:409440
16. Roth G, Dicke U, Nishikawa K (1992) How
do ontogeny, morphology and physiology of
sensory systems constrain and direct the evolution of amphibians? Am Nat 139:S105S124

17. Roth G, Nishikawa KC, Naujoks-Manteuffel
C,
Schmidt
A,
Wake
DB
(1993)
Paedomorphosis and simplification in the nervous system of salamanders. Brain Behav Evol
42:137170
18. Gonzalez A, Smeets WJ (1991) Comparative
analysis of dopamine and tyrosine hydroxylase
immunoreactivities in the brain of two amphibians, the anuran Rana ridibunda and the urodele Pleurodeles waltlii. J Comp Neurol 303:
457477
19. Gonzalez A, Marin O, Smeets WJ (1995)
Development of catecholamine systems in the
central nervous system of the newt Pleurodeles
waltlii as revealed by tyrosine hydroxylase
immunohistochemistry. J Comp Neurol 360:
3348
20. Moreno N, Lopez JM, Sanchez-Camacho C,
Gonzalez A (2002) Development of NADPHdiaphorase/nitric oxide synthase in the brain of
the urodele amphibian Pleurodeles waltl. J Chem
Neuroanat 23:105121
21. Lopez JM, Moreno N, Gonzalez A (2003)
Ontogeny of choline acetyltransferase (ChAT)
immunoreactivity in the brain of the urodele
amphibian Pleurodeles waltl. Brain Res Dev
Brain Res 140:2943
22. Brockes JP, Kumar A (2005) Appendage
regeneration in adult vertebrates and implications for regenerative medicine. Science 310:
19191923
amphibian model for regeneration, development, and evolution studies. Cold Spring Harb
Protoc 2009(8):pdb.emo128. doi:10.1101/
pdb.emo128
regions of the adult vertebrate brain. Development 137:41274134
25. Berg DA, Kirkham M, Wang H, Frisen J,
Simon A (2011) Dopamine controls neurogenesis in the adult salamander midbrain in homeostasis and during regeneration of dopamine
neurons. Cell Stem Cell 8:426433
26. Joven A, Morona R, Moreno N, Gonzlez A
(2013) Regional distribution of calretinin and
calbindin-D28k expression in the brain of the
urodele amphibian Pleurodeles waltl during
embryonic and larval development. Brain
Struct Funct 218:9691003. doi:10.1007/
s00429-012-0442-1
27. Joven A, Morona R, Gonzlez A, Moreno N
(2013) Spatiotemporal patterns of Pax3, Pax6
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
69
and Pax7 expression in the developing brain of

a urodele amphibian, Pleurodeles waltl. J Comp
Neurol 521:40. doi:10.1002/cne.23385
Maden M, Manwell LA, Ormerod BK (2013)
Proliferation zones in the axolotl brain and
regeneration of the telencephalon. Neural Dev
8:1. doi:10.1186/1749-8104-8-1
Sandoval-Guzmn T, Wang H, Khattak S,
Schuez M, Roensch K, Nacu E, Tazaki A, Joven
A, Tanaka EM, Simon A (2014) Fundamental
differences in dedifferentiation and stem cell
recruitment during skeletal muscle regeneration
in two salamander species. Cell Stem Cell 14:
13. doi:10.1016/j.stem.2013.11.007
Kirkham M, Berg DA, Simon A (2011)
Microglia activation during neuroregeneration
in the adult vertebrate brain. Neurosci Lett
497:1116
Kirkham M, Hameed LS, Berg DA, Wang H,
Simon A (2014) Progenitor cell dynamics in
the newt telencephalon during homeostasis
and neuronal regeneration. Stem Cell Reports
2:12. doi:10.1016/j.stemcr.2014.01.018
Garca-Paris M (1985) Los anfibios de Espaa.
Neografis, S.L., Madrid
Barbadillo-Escriva LJ (1987) La gua de Incafo
de los anfibios y reptiles de la pennsula ibrica,
baleares y canarias. Incafo, S.A., Madrid
Daz-Paniagua C, Gmez C, Portheault A,
DeVries W (2005) Los anfibios de Doana.
Organismo Autnomo de Parques Nacionales,
Ministerio de Medio Ambiente, Madrid
Salvador A (2014) GallipatoPleurodeles
waltl. Museo Nacional de Ciencias Naturales.
www.vertebradosibericos.org/anfibios/pdf/
plewal.pdf
Hdar JA, Ruiz I, Camacho I (1993) Rgimen
alimenticio estival del gallipato Pleurodeles
waltl (Michaheles, 1830) en una localidad del
sureste peninsular. Rev Esp Herpetol 7:5
Martnez-del-Marmol G, Jimnez-Robles O
(2013) Pleurodeles waltl Michahelles, 1830 in
Morocco and Western Sahara. www.moroccoherps.com/en/ficha/Pleurodeles_waltl/
Griffiths R (1995) Newts and salamanders of
Europe. T & AD Poyser natural history, London
Schleich HH, Kstle W, Kabisch K (1996)
Amphibians and reptiles of North Africa.
Koeltz Sci. Books, Koenigstein
Glaesner L (1925) Normentafel zur
Entwicklung des gemeinen Wassermolchs
(Molge
vulgaris).
Normentafeln
zur
Entwicklungsgeschichte der Wirbeltiere
Gallien L, Durocher M (1957) Table chronologique de dveloppment chez Pleurodeles
waltlii Michahelles. Bull Biol 2:119
70
42. Armstrong JB, Malacinski GM (1989)

University Press, New York
43. Bordzilovskaya NP, Dettlaff TA, Duhon ST,
Malacinski GM (1989) Developmental-stage
series of axolotl embryos. In: Armstrong JB,
New York, pp 201219
44. Khan PA, Liversage RA (1995) Development
of Notophthalmus viridescens embryos. Dev
Growth Differ 37:529537
45. Shi DL, Boucaut JL (1995) The chronological
development of the urodele amphibian
Pleurodeles waltl (Michah). Int J Dev Biol
39:427441
46. Nye HL, Cameron JA, Chernoff EA, Stocum
DL (2003) Extending the table of stages of
normal development of the axolotl: limb development. Dev Dyn 226:555560
47. Wong CJ, Liversage RA (2005) Limb developmental stages of the newt Notophthalmus viridescens. Int J Dev Biol 49:375389
48. Roberts A, Soffe SR, Clarke JD, Dale N (1983)
Initiation and control of swimming in amphibian embryos. Symp Soc Exp Biol 37:261284
49. Coghill GE (1929) Anatomy and the problem of
behaviour. Cambridge University Press, London
50. Soffe SR, Clarke JDW, Roberts A (1983)
Swimming and other centrally generated motor
patterns in newt embryos. J Comp Physiol 152:
535544
51. Bekoff A (1985) Development of locomotion in
vertebrates, a comparative perspective. In: Gollin
52.
53.
54.
55.
56.
57.
58.
ES (ed) The comparative development of

adaptive skills: evolutionary implications.
Lawrence Erlbaum Associates, Hillsdale, NJ,
pp 5794
Diesener G, Reichholf J (1986) Lurche und
Kriechtiere (Reptiles y anfibios). Mosaik Verlag
GmbH, Mnchen
Nllert A, Nllert C (1992) Die Amphibien
Europas.
Bestimmung-Gefhrdung-Schutz
(Los anfibios de Europa. IdentificacinAmenazas-Proteccin).
Franckh-Kosmos
Verlags-GmbH, Sttutgart
Salvador A, Garca-Pars M (2001) Anfibios
espaoles. Identificacin, historia natural y distribucin. Canseco editores, S.L., Talavera de
la Reina
Hayashi T, Yokotani N, Tane S, Matsumoto A,
Myouga A, Okamoto M, Takeuchi T (2013)
Molecular genetic system for regenerative
studies using newts. Dev Growth Differ 55:
229236
Khattak S, Murawala P, Andreas H, Kappert V,
Schuez M, Sandoval-Guzmn T, Crawford K,
metamorphosis, transgenesis and tamoxifenmediated recombination. Nat Protoc 9:
529540
Deban SM, OReilly JC, Nishikawa KC (2001)
The motor control of feeding in amphibians.
Am Zool 41:18
Macke J (2007) Caudata Illness Part 3: Illness
Photographs. www.caudata.org/cc/articles/
illness3.shtml
Chapter 5
Maintaining Plethodontid Salamanders in the Laboratory
for Regeneration Studies
Claudia Marcela Arenas, Andrea Gmez-Molina, and Jean Paul Delgado
Abstract
Limb regeneration studies have been extensively carried out in species of Ambystomatidae and
Salamandridae families. So far limited research has been conducted in species belonging to the
Plethodontidae family, where some of the species differs from other salamander families due to their direct
development, thus absence of a larval life. Here, we describe a protocol to maintain the plethodontid
salamanders of genus Bolitoglossa species under laboratory conditions to perform regeneration studies.
Key words Plethodontidae, Bolitoglossa sp., Husbandry, Limb regeneration
Introduction
Ambystomatidae and Salamandridae family species are the most
common salamanders that have been used as models in the development and regenerative biology research [1, 2]. There are about
668 species of salamanders that are distributed in ten families [3].
In most of the species, the biological growth is termed indirect
development, where a larval stage occurs during development and
an ontogenic transition is attained by a process of metamorphosis.
However, in the family Plethodontidae, some species have direct
development [4]. Besides this, they also show some biological
adaptive differences such as anucleate red blood cells, projectile
tongue, tail autotomy, and the absence of lungs [5, 6].
South American salamanders are represented only by the family Plethodontidae [7], mainly by the genus Bolitoglossa, and about
28 species have been recognized [8]. Bolitoglossa species undergo
direct development; they are terrestrial animals distributed in
diverse habitats and elevations, from high-elevation grasslands to
lowland rainforest [9].
71
72
Claudia Marcela Arenas et al.
In this protocol, we describe the maintenance under captivity

of two wild species of salamanders, Bolitoglossa ramosi and
Bolitoglossa vallecula, and use them as a non-model salamanders
for regeneration studies.
Materials
2.1 Animal Housing

and Maintenance
1. The salamanders, B. ramosi and B. vallecula (Fig. 1a, b), are

sympatric species; they are found from 1,200 to 3,000 m.a.s.l
elevation, they are nocturnal, and they prefer microhabitats of
herbaceous and shrubby vegetation up to 1 m high along the
margins of streams and in forest interiors [9]. The average
length and weight of the animals are 7 cm and 1.21 g, respectively (see Note 1).
2. The animals are kept it in plastic tight containers with dimensions of 23 16 9.5 cm. Place a damp tissue paper sprayed
with filtered water to keep the humidity.
3. Environmental enrichment objects such as hollow pipes, sticks,
and artificial plants (Fig. 2) (see Note 2).
4. Tap water filtered through a carbon activated filter (see Note 3).
5. The animals are feed with flies and/or larval Drosophila
melanogaster three times a week (see Note 4).
2.2
Reagents
1. Holtfreters salt stock solution (10): Dissolve 34.6 g NaCl,

1 g CaCl2, 2 g MgSO4 7H2O, and 0.5 g KCl in 1 L sterile filtered tap water. Dissolve by continuously stirring with heat
until the solution is clear.
2. Holtfreters salt working solution (40 %): Dilute 20 mL of
Holtfreters stock solution to 480 mL with sterile filtered tap
water.
Fig. 1 Two species of South American Plethodontidae family members. (a)

Bolitoglossa ramosi. (b) Bolitoglossa vallecula
Maintaining Plethodontid Salamanders in the Laboratory for Regeneration Studies
73
Fig. 2 Plastic container to maintain the salamanders in captivity (a) damp paper
tissues to keep the humidity. (b) Environment enrichment with objects where the
animal can climb, hide, or explore
3. 1 M TrisHCl: Dissolve 0.788 g TrisHCl in 5 mL of sterile

filtered tap water. Adjust the pH to 7.4 with 1 N HCl.
4. Phenol red 0.5 %: Dissolve 0.5 g phenol red in 100 mL of
sterile filtered tap water.
5. Anesthetic working solution (1 %): Mix 0.5 mL of TrisHCl
(1 M pH 7.4) and add 250 L of phenol red (0.5 %). Make up
the volume up to 500 mL with Holtfreters salt working solution (item 2), and add 5 g of MS-222. Adjust the pH to 7.4
with 1 N NaOH (see Note 5) [10].
2.3 Microsurgery
Tools
1. Microforceps Dumont #5 (0.10 0.06 mm tips) or similar.

2. Microscissors (15 mm blades).
3. Offset Bone Nipper (cutting edge 7 mm).
Methods
3.1 Collection
of Salamanders
1. The salamanders are collected by the nighttime visual encounter method [11], which is based in the visual registration of the
animals in a limited time and area.
2. Once the animal is visualized, collect it carefully with both
hands, avoiding taking it by the tail that would lead to caudal
autotomy.
3. The specimens are kept in plastic bags and sprayed with filtered
tap water, and local vegetation is placed inside the bags to prevent desiccation.
74
4. Keep the plastic bags inside a polystyrene ice box with an ice
pack to maintain low temperature and humidity. Avoid direct
contact of the animal with the ice pack.
3.2 Housing
and Environmental
Conditions
1. The animals are placed inside the plastic container (see Note 6).
2. Maintain housing temperature at 1921 C throughout the
period.
3. Use a 12L:12D photoperiodic cycle for the animals.
4. To keep the humidity inside the container, place two layers of
tissue paper and spray them with filtered tap water (see Note 7).
5. Place environmental enrichment objects inside the container
to provide the animals with place to hide and to climb.
6. Replace the damp tissues and wash the container with filtered
tap water twice a week (see Note 8).
3.3
Feeding
1. Place the flask with flies inside the freezer 2030 min
(see Note 9).
2. Place about 20 flies and or larvae per each animal inside the
container.
3. Feed the animals three times a week.
Behavior
Plethodontids move slower and are more docile than newts or axolotls. When handled for long period of time, they can become
stressed; therefore, handle them only when necessary (see Note 10).
In the wild, they can be found in solitary, but in captivity, they
can be kept with other plethodontids in the same container.
3.5 Common
Diseases and Health
Monitoring
Salamanders are susceptible to different microbial diseases. One of

the most important microbial diseases that have been reported to
contribute to the decline of the amphibian world populations is the
fungal infection chytridiomycosis generated by Batrachochytrium
dendrobatidis [12]; nevertheless, there are few studies reporting
infection in plethodontids including Colombia [13, 14]. In our
experience, few animals have died in captivity possibly due to
fungal infections (see Note 11).
3.6 Surgical
Manipulation
Surgical manipulation is performed under anesthesia; this protocol

works for limb amputation of adult salamanders.
3.4
1. In a 10 cm Petri dish, add 20 mL of 1 % MS-222 prepared in

Subheading 2.2, item 5.
2. Place the animal inside the dish and cover with the lid. About
45 min is required for the animal to become motionless
(see Note 12).
3. Check the animals response to stimulus (see Note 13).
75
4. Place the animal under the stereomicroscope to perform the

surgical procedure.
5. Using microscissors and forceps, amputate the forelimb at the
distal or proximal plane (see Notes 14 and 15).
6. When the procedure is completed, place the animal inside a
Petri dish containing excess of sterile filtered tap water for
1 min.
7. Remove the animal from the water.
8. Add 500 L of 0.5 % sulfamerazine at the injury site of the
limb with a syringe or Pasteur pipette.
9. Spray the animal with sterile filtered tap water about every
10 min.
10. When the animal shows signs of awakening, return the animal
to the plastic container.
11. Watch the behavior of the animal during the first 2 h.
Notes
1. In the Andean Community Nations, the capture of wild animals is tightly regulated by the Department of Environment of
the respective country. For experimental studies requiring wild
caught salamanders, a specific license is required to collect the
animals. It is important to know the local regulations regarding the collection of wild animals in each country and, if
required, obtain the respective permits.
2. The plastic containers can be a kitchenware type with rubber
seal. It is important to place items that enrich the environment
so that the animal can hide from the light. Besides this, sticks
or artificial plants can help to increase the area where the animal can climb or explore (Fig. 3).
3. The quality of tap water in our city has a pH of 6.4, which
appears to be easily tolerated by the animals; only filtration is
needed it to remove the chlorine. A standard kitchen carbon
filter is sufficient for this purpose. Another option is to allow
chlorine evaporation overnight.
4. When you collect wild animals, it is important to standardize
the amount of food that is needed to keep the initial weight of
the animal. To do this, measure the weight of the animals once
a week. In our experience, 50 flies and/or larvae a week are
enough to keep the weight of these species. An important
aspect to take into account is that the animals need to hunt for
flies when they are alive, the animals do not eat dead flies.
5. It is critical to adjust the pH of the anesthetic before use; use a
buffered solution (Holtfreters salt solution) and adjust the pH
76
Fig. 3 Limb regeneration Bolitoglossa ramosi. Note the regeneration blastema on the left limb
Fig. 4 Handling of plethodontid salamander using a brush stick
to 7.4. When a low pH is used, animals could experience bleeding from the skin.
6. Handle the salamanders with gloves to avoid transmission of
any diseases between animals. In order to avoid stress and
induction of tail autotomy, handle the animals with a pencil,
brush, or stick. Because they like to hang on sticks by using the
prehensile tail, reach the tip of the pen or stick to the animal
and allow to climb on it (Fig. 4).
7. The quality of tissue paper is important because some brands
available from the market are acidic and, in contact with water,
will decrease the pH of water. In our experience, the recycled
tissue paper works fine.
8. It is important to keep the plastic containers with low microbial density to prevent diseases in the animals. However,
amphibians are reported to have antimicrobial peptides that
could help them to prevent diseases [15].
9. Flies can be obtained from genetic laboratory facilities.
Otherwise, insects can be purchased from local pet suppliers.
77
Low temperature decreases the fly metabolism, so it is easier to

feed the animal when the flies are inactive. It takes about
2030 min to decrease the metabolism of the flies. Regarding
feeding habits, when animals have been for a while in captivity,
it is feasible to hand-feed them with a brush.
10. To photograph the animals under the stereo microscope, it is
not necessary to anesthetize them, especially for collecting
images from the dorsal side. It is better to anesthetize the animals for procedures that imply handling the animal for long
periods of time or ventral picture acquisitions.
11. When signs of infection or diseases are detected (abnormal
posture, lethargy, loss of righting reflex, reddening of the skin,
extended hind limbs) [12], isolate the animal from others and
place in quarantine. Use separate gloves and sticks to handle
sick animals.
12. Keep the animals for the shortest possible time submerged in
anesthetic. When the animal is in contact with the anesthetic in
the first minute, they become hyperactive; soon after, their
movement of the limbs ceases. The induction and recovery
time varies on each animal; in our experience, the recovery
time is about 2550 min.
13. Check the response of the animals to stimulus by touching the
limb with tweezers.
14. Once the procedure is completed, it is possible to collect a
sample of blood from the amputation plane to carry out experiments by flow cytometry. Use a 10 L micropipette to take
the sample by capillary drawing in about 510 L. It is important to permeabilize the cell with Triton X-100 before flow
cytometry experiments.
15. Once the limb is removed, push the muscle tissue attached to
the bone rearward with microforceps # 5 and cut the protruding bone with bone nipper. Then, cut the protruding muscle
tissue with microscissors to ensure that surface of the amputated limb is flat.
Acknowledgments
Our work is funded by a program grant COLCIENCIAS 569 and
Programa-Sostenibilidad 20132014 of the University of
Antioquia. Claudia Arenas is funded by a fellowship from
COLCIENCIAS 567. We thank Juan Manuel Daza for the taxonomic identification of the animals and Melisa Hincapie, Carlos
Muoz, Jose Fang, and Santiago Cuartas for their help during the
field work and maintenance of the animals. The animals used to
establish this protocol were collected under the environmental
78
license Permiso Marco de Recoleccin de Especmenes de

Especies Silvestres de la Diversidad Biolgica con Fines de
Investigacin (Resolucin #0524-27/05/2014). This work has
the approval of the Comit de Biotica para Experimentacin con
Animales from the University of Antioquia.
References
1. Brockes JP, Kumar A (2008) Comparative
aspects of animal regeneration. Annu Rev Cell
Dev Biol 24:525549
2. Stocum DL, Cameron JA (2011) Looking
proximally and distally: 100 years of limb regeneration and beyond. Dev Dyn 240:943968
3. AmphibiaWeb: Information on amphibian
biology and conservation (2014). http://
amphibiaweb.org/
4. Wake DB (2009) What salamanders have
taught us about evolution. Annu Rev Ecol
Evol Syst 40:333352
5. Mueller RL, Gregory TR, Gregory SM, Hsieh
A, Boore JL (2008) Genome size, cell size, and
the evolution of enucleated erythrocytes in
attenuate salamanders. Zoology (Jena) 111:
218230
6. Mueller RL, Macey JR, Jaekel M, Wake DB,
Boore JL (2004) Morphological homoplasy,
life history evolution, and historical biogeography of plethodontid salamanders inferred from
complete mitochondrial genomes. Proc Natl
Acad Sci U S A 101:1382013825
7. Elmer KR, Bonett RM, Wake DB, Lougheed
SC (2013) Early Miocene origin and cryptic
diversification of South American salamanders.
BMC Evol Biol 13:59
8. Parra-Olea G, Garca-Pars M, Wake DB
(2004) Molecular diversification of salamanders of the tropical American genus Bolitoglossa
(Caudata: Plethodontidae) and its evolutionary
9.
10.
11.
12.
13.
14.
15.
and biogeographical implications. Biol J Linn

Soc 81:325346
Silva-Gonzlez N, Pez VP, Bock BC (2011)
Morphological variation in Bolitoglossa vallecula (Amphibia:Caudata:Plethodontidae) in the
cordillera central of Colombia. Actu Biol
33:251260
Lee J, Aguilar C, Gardiner D (2013) Gain-offunction assays in the axolotl (Ambystoma
mexicanum) to identify signaling pathways that
induce and regulate limb regeneration.
Methods Mol Biol 1037:401417
Grover M (2006) Comparative effectiveness of
nighttime visual encounter surveys and cover
object searches in detecting salamanders.
Herpetol Conserv Biol 1:9399
Densmore CL, Green DE (2007) Diseases of
amphibians. ILAR J 48:235254
Vazquez VM, Rothermel BB, Pessier AP
(2009) Experimental infection of North
American plethodontid salamanders with the
fungus Batrachochytrium dendrobatidis. Dis
Aquat Organ 84:17
Velasquez EBE, Castro HF, Bolivar GW,
Herrera MI (2008) Infection by the chytrid
fungus Batrachochytrium dendrobatidis in
anurans from Cordillera Occidental in
Colombia. Herpetotropicos 4:6570
Meng P, Yang S, Shen C, Jiang K, Rong M et al
(2013) The first salamander defensin antimicrobial peptide. PLoS One 8:83044
Part II
Experimental Manipulation in Salamanders
Chapter 6
Newt Lens Transdifferentiation: From Lentectomy
to Immuno-FISH
Nobuyasu Maki
Abstract
Newt lens regeneration is achieved by a unique cellular regulation of transdifferentiation where the dorsal
iris pigmented epithelial cells (PECs) dedifferentiate and redifferentiate into lens cells. Recent studies have
shown that nuclear architecture of PECs is dynamically changed and unique epigenetic regulation in
somatic nucleus is crucial in the lens transdifferentiation. Immuno-FISH, detection of protein and gene
loci in nucleus, is one of the effective tools to analyze nuclear architecture of PECs. In this chapter a whole
process from lentectomy to immuno-FISH is described.
Key words Lens regeneration, Transdifferentiation, Dedifferentiation, Epigenetics, Reprogramming,
Salamander, Immuno-FISH
Introduction
It is a generalized conception that differentiation is an irreversible
event and once cells are terminally differentiated, they lose their
multipotency and proliferation ability so that the differentiated
cells never change into other types of cells in vivo. An apparent
counterexample to this concept is transdifferentiation of iris pigmented epithelial cells (PECs) during newt lens regeneration
(Fig. 1) [1]. After lens removal, the PECs lose their original characteristics by shedding their pigment granules (about day 4).
At almost the same time, an initial cell cycle reentry of PECs occurs.
PECs continue depigmentation and proliferation and finally change
to transparent cells, called as dedifferentiated cells, by day 8 and
form a lens vesicle by day 1012. After day 14, lens differentiation
occurs from dorsal iris. Even though the dedifferentiation and proliferation take place in both dorsal and ventral irises, lens differentiation occurs only in dorsal iris. Lens transdifferentiation has been
demonstrated by clonal culture experiment using newt PECs [1].
Nuclear architecture of PECs dynamically changes during
transdifferentiation [13]. The original PECs have a small and
81
82
Nobuyasu Maki
Fig. 1 Illustration of lens regeneration process and changes in nuclear architecture. (a) About 4 days after
lentectomy, PECs begin to shed their pigments and reenter cell cycle. The transparent dedifferentiated cells are
found by day 8. After day 14, the dorsal dedifferentiated cells redifferentiate into lens cells. However, the ventral PECs never differentiate into lens even though these cells show depigmentation and cell cycle reentry. (b)
Structural change in the nucleus during lens transdifferentiation. The nucleus of original PECs is small and
shrunken in morphology. During dedifferentiation, the PEC nucleus swells and its nucleoli become large. Blue,
nucleus. Red, nucleolus. Illustration in (b) is reproduced from [9] with permission (Color figure online)
shrunken nucleus measuring about 10 m in a diameter. During

the dedifferentiation of PECs, the nucleus swells and the dedifferentiated cells measure about 20 m in a diameter. In parallel with
the nuclear swelling, the nucleoli of PECs have also enlarged during dedifferentiation. These dynamic changes in nuclear architecture suggest that nuclear regulation plays a key role in newt lens
transdifferentiation. Indeed, gene expression analysis has been suggested that newt transdifferentiation shares the mechanisms in
somatic nuclear reprogramming by nuclear transfer into oocyte
(SCNT) [4] or by forced expression of stem cell factors (as known
for iPS) [5]. Oocyte-type linker histone, by which somatic-type
linker histone H1 is replaced after SCNT [6], and three of iPS factors, Sox2, Klf4, and c-Myc, are expressed in the transdifferentiation [7]. Therefore, studying the regulation of nuclear architecture
and epigenetics during lens regeneration will provide significant
advances not only in understanding newt cellular plasticity but also
in regenerative biology and medicine.
Newt Lens Transdifferentiation: From Lentectomy to Immuno-FISH
83
Fig. 2 Immuno-FISH using NS antibody and 18S rDNA probe against PECs before (a) and 6 days after (b)
lentectomy. NS is accumulated in nucleoli of dedifferentiating PECs. Nuclei were counterstained with Hoechst
33258. High-power view of the nucleolus indicated by arrowheads is shown in the inset. Outline of nucleus is
indicated by dashed line. Reproduced with permission from Developmental Dynamics [2]
The newt genome DNA contains many types of repetitive

sequences, and these sequences localize specific chromatin regions
such as centromere and rDNA [8]. To understand changes in
nuclear architecture during lens transdifferentiation, we established the immuno-FISH method using those repetitive sequence
probes against the whole nucleus in tissue sections (Fig. 2) [2].
In this chapter the entire process from sample preparation, including lentectomy, to immuno-FISH staining, detecting the loci of
nucleostemin (NS) protein and the 18S rDNA, is described. The
basic techniques and tips for lens regeneration experiments are also
described in detail.
Materials
2.1 Animal
Maintenance
1. Newts: Adult newts (Cynops pyrrhogaster) were collected in the

northern part of Okayama Prefecture in Japan. All animal care
and use protocols were in compliance with the Animal
Experiment Handbook at Osaka University.
2. Food: Frozen bloodworm.
3. Plastic container for animal maintenance (35 25 12 cm).
2.2
Lentectomy
1. Special forceps for lentectomy (Fig. 3a, see Note 1).

2. Surgical blade: Feather #11 (see Note 2).
3. Blade holder: Feather #3.
84
Nobuyasu Maki
Fig. 3 Process of lentectomy. (a) The special forceps for lentectomy. The tip of the
forceps is rounded and smoothen with a whetstone. Upper, side view. Lower, top
view. (b) Newt held between the thumb and forefinger. (c) Illustration of the process of lentectomy. Incision of the cornea (13). Holding the lens with forceps
(4 ). Removing of lens (5)
4. Plastic container for anesthesia (12 16 5 cm).

5. Anesthetic solution: Prepare 0.25 % ethyl 3-aminobenzoate
methanesulfonate in 70 % PBS.
6. Stereomicroscope with a double arm fiber illuminator system.
2.3 Sampling
and Tissue Sectioning
85
1. Anesthetic solution: see Subheading 2.2.

2. Fixation solution: methanolacetic acid (3:1) solution.
3. 100, 95, 90, 80, and 70 % ethanol.
4. Xylene.
5. Paraffin: Paraplast X-TRA tissue embedding medium.
6. Plastic dish.
7. Slide glass: Poly-L-lysine coating slide glass.
8. Paraffin oven.
9. Rotary microtome.
2.4
Probe Labeling
1. 18S rDNA plasmid (0.25 g/L, GenBank accession no.

AB239574).
2. Nick Translation Kit (Roche #976776, Mannheim, Germany):
A mixture of dATP, dGTP, and dTTP, 10 buffer, and an
enzyme mixture are included in this kit.
3. 1 mM Biotin-16-dUTP (Roche #1093070).
4. 4 M ammonium acetate.
5. tRNA and ssDNA mixture: 100 mg of E. coli tRNA (Roche,
#10014) and 100 mg of denatured salmon sperm DNA
(Sigma-Aldrich, #D-7656) are dissolved in 10 mL of Milli-Q
water.
6. Deionized formamide.
2.5
FISH Procedure
1. Decolorization buffer: Prepare fresh 6 % hydrogen peroxide in

PBS.
2. Permeabilization buffer: Prepare a solution containing 0.05 %
Triton X-100 and 0.05 % saponin in 2 SSC.
3. RNase A solution: Prepare 10 g/mL RNase A solution in 2
SSC.
4. Denaturing solution: Prepare 70 % formamide in 2 SCC.
5. 2 hybridization mix: 4 SSC, 4 mg/mL BSA (Roche
#711454), 20 % dextran sulfate.
6. Wash buffer: 50 % formamide, 2 SSC.
7. TN buffer: 0.1 M TrisHCl, pH 7.5, 0.15 M NaCl.
8. TNT buffer: 0.1 M TrisHCl, pH 7.5, 0.15 M NaCl, 0.05 %
Tween-20.
9. TNB buffer: 0.1 M TrisHCl, pH 7.5, 0.15 M NaCl, 0.5 %
blocking regent (Perkin Elmer, FP1020).
10. Sheep anti-DIG antibody (Roche Diagnostics).
11. Affinity-purified antibody against NS.
86
Nobuyasu Maki
12. Hoechst solution: Prepare 8 g/mL Hoechst 33258 in 2

SSC.
13. Fluorescence mounting medium.
Methods
3.1 Animal
Maintenance
1. Up to ten newts are kept in a plastic container containing 3.5 L

of rearing water at 22 C.
2. Feed the newts with red bloodworms twice a week.
3. Change the rearing water everyday.
3.2
Lentectomy
1. Keep newts in the anesthetic solution until they are anesthetized (about 10 min).
2. Hold the newt neck between the thumb and forefinger.
3. Put the surgical blade into the cornea with the edge side up
(Fig. 3c-1).
4. Carefully insert the blade between the cornea and iris until the
tip of the blade reaches the opposite side (Fig. 3c-2).
5. Incision the cornea by drawing the blade upward. About
two-thirds of the cornea diameter is cut in this operation
(Fig. 3c-3).
6. Insert the forceps through the opening of the cornea (Fig. 3c-4,
see Note 3).
7. Hold the surface of the lens with the forceps (see Note 4).
8. Carefully pull the lens out from the eyeball (Fig. 3c-5).
9. Return the newts to the rearing water. About 1020 min after
returning to the water, newts begin to awake from anesthesia.
3.3 Sampling
and Tissue Sectioning
1. Anesthetize newts as described in, Subheading 3.2, step 1.

2. Cut off a head and remove a jaw from the head. The eyeballs
are fixed with a head in methanolacetic acid (3:1) solution at
4 C for 12 h (see Note 5).
3. The fixed eyeballs are removed from the head.
4. Wash the eyeballs with 100 % methanol for 10 min, three
times.
5. Cut ventral side of eyeball to create an opening to the posterior
chamber in 100 % methanol (see Note 6).
6. Place the eyeballs in xylene for 10 min.
7. Place the eyeballs in xyleneparaffin (1:1) solution at 60 C for
10 min.
8. Place the eyeballs in paraffin at 60 C for 60 min, three times.
87
9. Embed the eyeballs in a plastic dish (see Note 7).

10. Paraffin-embedded eyeballs are sectioned at 20 m.
11. Place the sections onto the surface of water dropped on a slide
glass at 42 C.
12. Dry the sections at 42 C overnight (see Note 8).
13. Place the slides in xylene for 10 min, three times.
14. Rehydrate the sections through the following ethanol series for
5 min each, 100, 100, 95, 90, 80, and 70 % ethanol.
15. Wash the slides in PBS for 5 min, three times.
3.4
Probe Labeling
1. Mix following reagents: 2.0 L of plasmid DNA (0.5 g),

12 L of a dATP, dGTP, dTTP mixture, 4 L of 10 buffer,
2.2 L of Biotin-16-dUTP, 12.8 L of Milli-Q water, and 7 L
of enzyme mixture.
2. Incubate at 15 C for 2 h.
3. Heat inactivation at 65 C for 10 min.
4. Cool down to room temperature.
5. Add 4 L of the tRNA and ssDNA mixture, 5.4 L of 4 M
ammonium acetate, and 66 L of ethanol.
6. Mix by inverting tube.
7. Incubate at 80 C for 20 min.
8. Centrifuge at 20,000 g for 10 min.
9. Remove the supernatant and dry the precipitate.
10. Dissolve the precipitate in 40 L of formaldehyde.
12. On ice for 3 min (see Note 9).
3.5
Immuno-FISH
1. To decolorize PECs, put the deparaffinized slides

(Subheading 3.3) in the decolorization buffer for 1 h under
fluorescent light irradiation (see Note 10).
2. Wash the slides in PBS for 5 min, three times.
3. Permeabilization: Incubate in the permeabilization buffer for
60 min.
4. Rinse with 2 SSC for 15 min, three times.
5. RNA degradation: Incubate in the RNase solution at 37 C for
60 min.
6. Rinse with 2 SSC for 15 min, three times.
7. Denaturing of dsDNA in nucleus: Incubate in the denaturing
solution at 60 C for 2 min (see Note 11).
8. Immediately place into the ice-cold denaturing solution.
88
Nobuyasu Maki
9. Wipe the excess denaturing solution (avoid contacting tissue).

10. Add equal volume of 2 hybridization mix to the probe solution prepared in Subheading 3.4 and mix well (see Note 12).
11. Apply the hybridization mixture onto the specimens (10 L for
cm2).
12. Cover solution with a piece of parafilm.
13. Incubate in a humid chamber with the wash buffer at 37 C
overnight.
14. Wash in the wash buffer at 37 C for 30 min twice.
15. Wash in 1 SSC for 30 min three times at room temperature.
16. Wash in TN buffer for 5 min.
17. Block with TNB for 60 min.
18. Incubate with sheep anti-DIG antibody and affinity-purified
anti-CpNS antibody diluted with TNB.
19. Wash in TNT for 15 min, three times.
20. Incubate with Alexa 488-conjugated anti-sheep antibody and
Cy3-conjugated anti-rat antibody diluted with TNB.
21. Wash in TNT for 15 min, three times.
22. Wash in 2 SSC for 5 min.
23. Counterstain nuclei with the Hoechst solution for 5 min.
24. Wash in TN buffer for 5 min.
25. Mount with DACO fluorescence mounting medium.
Notes
1. During lentectomy, a lens epithelial cell layer is held with forceps. To hold it firmly and to avoid tissue damage, the tip of
the forceps should not be sharp. With a whetstone, the tip of
the forceps (e.g., INOX No. 5) is rounded and smoothen
(Fig. 3a). When the forceps is closed, both ends of the tips
should be attached together.
2. To insert a surgical blade into the eyeball through the cornea,
the tip of the blade should be sharp. For this purpose Feather
surgical blade #11 is suitable (the blade which has a rounded
tip such as Kai #11 cannot be used).
3. Lens can be extruded by pushing the eyeball with forceps.
However, this method may cause a damage on the iris. So the
method presented in this chapter is highly recommended.
Because of its transparency, the position of the lens in the eyeball
is visually indistinguishable. Thus, the position of the lens must
be realized based on the structure of the newt eye during the
operation (see Fig. 3). Too much insertion of the forceps causes
lens surface damage and makes it difficult to hold the lens.
89
4. At first, touch the eyeball with both tips of the forceps, and
then close the forceps very carefully without any other
movement.
5. The lens-regenerating eye is very fragile. To avoid tissue damage during its collection, eyeballs are fixed before dissection.
Because a paraformaldehyde fixation causes strong signal
reduction in newt FISH and immunohistochemical analysis, a
methanolacetic acid (3:1) solution is used.
6. This opening in the ventral side is necessary to avoid a crush of
eyeballs during the xyleneparaffin exchange and serve as a
mark indicating a dorsoventral orientation in sections.
7. The paraffin-embedded samples can be stored at 4 C.
8. After drying the slides can be stored at 4 C.
9. This probe solution can be stored at 20 C for several months.
10. Because of the pigment granules in PECs, this treatment is
performed.
11. To obtain FISH signals, the optimum temperature is
70 C. However, to retain an antigenicity of NS, this denaturing treatment is performed at 60 C. Denaturing condition
must be determined for each antigen.
12. Because the 2 hybridization solution is viscous, widening the
tip by cutting it is recommended.
Acknowledgments
This work is supported by JST PRESTO and a grant, KAKENHI
(14514364), to N.M. I would like to thank Panagiotis A. Tsonis for
critical reading and Rinako Maki for producing the illustrations.
References
1. Maki N, Kimura H (2013) Epigenetics and
regeneration. Curr Top Microbiol Immunol
367:237252
2. Maki N et al (2007) Rapid accumulation of
nucleostemin in nucleolus during newt regeneration. Dev Dyn 236:941950
3. Maki N, Tsonis PA, Agata K (2010) Changes in
global histone modifications during dedifferentiation in newt lens regeneration. Mol Vis
16:18931897
4. Jullien J et al (2010) Characterization of somatic
cell nuclear reprogramming by oocytes in which
a linker histone is required for pluripotency gene
reactivation. Proc Natl Acad Sci U S A 107:
54835488
5. Takahashi K, Yamanaka S (2006) Induction of
pluripotent stem cells from mouse embryonic
6.
7.
8.
9.
and adult fibroblast cultures by defined factors.

Cell 126:663676
Maki N et al (2010) Oocyte-type linker histone
B4 is required for transdifferentiation of somatic
cells in vivo. FASEB J 24:34623467
Maki N et al (2009) Expression of stem cell pluripotency factors during regeneration in newts.
Dev Dyn 238:16131616
Murakami T et al (2007) Establishment of
high-resolution FISH mapping system and its
application for molecular cytogenetic characterization of chromosomes in newt, Cynops pyrrhogaster (Urodela, Amphibia). Chromosome
Res 15:471484
Eguchi G (1980) Lens regeneration: transdifferentiation of tissue cells. Iwanami shoten,
Tokyo
Chapter 7
Studying Newt Brain Regeneration Following Subtype
Specific Neuronal Ablation
Abstract
The realization that neuronal injury does not result in permanent functional or cellular loss in all
vertebrates has fascinated regenerative biologists. Neuronal regeneration occurs in a subset of species,
including lizards, teleost fish, axolotls, and newts. One tool for studying neuronal regeneration in the
adult brain is intraventricular injection of selective neuronal toxins, which leads to loss of subpopulations
of neurons. To trace cells involved in the regeneration process, plasmids encoding reporter proteins can
be electroporated in vivo into the cells of interest. This protocol describes methods to label the ependymoglial cells of the brain of the red spotted newt Notophthalmus viridescens and follow their response after
ablation of dopaminergic neurons.
Key words Neurogenesis, In vivo electroporation, 6-OHDA, Dopaminergic neurons, Neuronal
regeneration
Introduction
A resurgence of interest in vertebrate brain regeneration has
occurred over recent years, which has coincided with increased
understanding of adult neurogenesis and stem cell biology within
mammals [1]. The mammalian brain regenerates poorly after neuronal loss, but the persistent presence of neural stem cells and
ongoing adult neurogenesis has offered hope that cell replacement treatments for neural injury and disease could be developed
either via transplantation of cells or endogenous regeneration [2].
Hence, an increased understanding of how successful neuronal
regeneration occurs could lead to improvements in cell regenerative therapies in humans.
Injury in adult neuronal regenerative models has been caused
through two main methods. Mechanical injuries for example have
included the removal of part of the optic tectum in Notophthalmus
viridescens, severing the retinal axon in the lizard Gallotia galloti,
cerebellar lesion paradigm in teleost fish and traumatic stab lesion
91
92
in the pallium of the zebrafish [36]. However, there are limited

comparable injury models in mammalian systems, and due to the
complexity of the removed tissue it is hard to determine the regeneration mechanisms related to any one neuronal type. The second
method of neuronal injury utilizes neuronal toxins to ablate specific neuronal subtypes. 6-hydroxydopamine (6-OHDA) mediated
ablation of dopaminergic neurons, which play a central role in
Parkinsons disease, has been used to model Parkinsons disease in
the mammalian brain for over 30 years [7]. Similarly, 6-OHDA has
been demonstrated to ablate dopaminergic neurons in the newt
(Fig. 1a, b) [8].
6-OHDA does not cross the bloodbrain barrier, thus to ablate
neurons in the brain, the drug should be injected directly in to the
neuronal population of interest. Generally, a 6-OHDA injection is
an inexpensive and reliable method for catecholaminergic neuron
ablation. In this protocol the 6-OHDA is injected into the third
ventricle of the newt and causes a bilateral ablation of tyrosine
hydroxylase positive neurons in the ventral diencephalic/mesencephalic region [8, 9]. Tyrosine hydroxylase is a rate-limiting enzyme
in the production of dopamine and is often used as a marker for
catecholaminergic neurons.
In all brain regenerative models studied so far injury induced
neurogenesis is driven by the proliferation and subsequent differentiation of ventricular localized glia cells, which in the newt are
termed ependymoglial cells [1]. One method to effectively label
these cells in vivo is electroporation of DNA plasmids (Fig. 1c).
Plasmid preparation for electroporation is significantly simpler
than creating transgenic lines or the production of virus used in
viral based transfection methods. In vivo electroporation in
amphibians has been used for a number of years including in the
regenerating spinal cord and in juvenile axolotl and frogs [10, 11].
The protocol described here was adaptive from [12].
Electroporation generally results in multiple copies of the
plasmids entering the cells resulting in a transient transfection or
transient expression of the reporter protein, and like other chemical based methods of transient transfection expression of the
reporter protein declines over time. Furthermore, as the plasmid
DNA does not generally integrate into the genome there is no
guarantee that progeny of the transfected cell will express the
reporter protein. One method used to prolong expression in cells
during regeneration has been to use the Gal4-VP16 enhancer
system [9, 11, 13]. Here the GAL-VP16 gene is under the control of either a tissue specific promoter or a general promoter
depending on the experimental design. The expression of the
reporter protein is driven by the enhancer sequence Gal4UAS
that Gal4-VP16 binds to. When the promoter is turned off,
reporter gene expression is prolonged because of the presence of
Gal4-VP16 protein that remains in the cell. An alternative strategy
Neuronal Ablation and Electroporation
93
Fig. 1 Illustrations of the applications and equipment needed for intraventricular injection. (a and b) Midbrain
dopaminergic neurons in a control newt, Notophthalmus viridescens (a) and 5 days after injection of 6-OHDA
(b). The neurons are labeled with an antibody against Tyrosine hydroxylase (red ) and the nuclei are labeled
with the DNA dye DAPI (blue). (c and d) GFAP-positive ependymoglial cells (red) lining the third ventricle of a
newt that has been electroporated with a plasmid encoding GFP (green) under a CMV promoter. (e) Overview
of the equipment. (1) Stereomicroscope on bloom arm, (2) FemtoJet, (3) Stereotactic instrument, (4) Quick
drying dental cement, and (5) Micro drill. (f) The universal capillary holder arm of the FemtoJet is attached to
stereotactic instrument using a V clamp. (g) Glass needle in the universal capillary holder ready for injection.
The barrel of the needle is marked with a marker pen. Scale bars 50 M
94
to prolong expression uses the Tol2 transposon system [14]. This

system has been employed to trace cells during limb regeneration
for 2 months after electroporation [15], and has the advantage of
integrating the plasmid DNA in to the genome of the transfected
cell. Two plasmids are electroporated in a ratio of 1:1, the first
encoding the gene for Tol2 transposase. The second plasmid
encodes a promoter and reporter protein flank by Tol2 transposon sites. The sequence flanked by the Tol2 transposon sites is
removed from the plasmid and inserted into the genome by Tol2
transposase. Both this methods can be combined with tissue specific promoters to give cell type specificity.
To specifically drive expression of a reporter protein in the
ependymoglial cells in the newt, the human glial fibrillary acidic
protein (GFAP) promoter has been used [9]. However, when a
plasmid encoding GFP driven by the CMV promoter was injected
into the ventricle of the newt brain followed by electroporation,
the ependymoglial cells act as a barrier reducing the penetration of
the plasmid to the brain parenchyma, resulting in 99 % of transfected cells being ependymoglial cells (Fig. 1c, d) [9].
Materials
2.1 Equipment
for intraventricular
Injection
Figure 1eg is a graphic depiction of how the equipment is set up.

1. Small animal stereotactic device adapted for neonatal mouse
and rodents with V clamp to hold a probe.
2. Small support rough 3 8 1 cm ideal a plastic lid or small
plastic box.
3. Two small plastic boxes that are at least 45 cm high and that
have a lid with air holes, small enough that the newts cannot
escape through.
4. Electric dental-drill
15,000 RPM.
or
micro-drill
maximum
speed
5. Tungsten carbon dental bur with a round head 0.5 mm in

diameter.
6. Eppendorf Femtotips (Eppendorf) or borosilicate glass capillaries (Harvard Apparatus: GC100F-10), and a Flaming/Brown
type micropipette puller (Harvard Apparatus) (see Note 1).
7. Stereotactic dissection microscope on boom arm.
8. Microinjector (Eppendorf: FemtoJet or similar).
9. Microloader tips.
10. Microdissection tools: Dumont #4 Forceps and Spring Scissors
with 6 mm curved blades.
2.2 Reagents
for intraventricular
Injection
95
1. Tank water. This can either be tap water or the salt solution
used to house the animals.
2. 0.1 % MS-222 (Sigma). Dissolve 1 g MS-222 in 1,000 mL of
tank water.
3. Quick drying dental cement (Harvard Dental).
2.3 Equipment
for In Vivo
Electroporation
1. Electroporator (Nepagene: NEPA21).
2.4 Reagents
Required for In Vivo
Electroporation
1. Sterilized 10 mM TrisHCl adjusted to a pH 8.5.
2.5 Reagents
for 6-OHDA Neuronal
Ablation
1. Sterilized 0.9 % saline solution. 0.9 g NaCl dissolved in 100 mL

water.
2. Electrodes: tweezers with round platinum plate electrodes

5 mm diameter (Nepagene CUY650P5).
2. Plasmid purification Kit (OriGene: PowerPrep HP Plasmid

Maxiprep System).
2. Ascorbic acid. Make fresh and keep on ice. 0.2 mg is dissolved

in 1 mL of 0.9 % saline solution.
3. 6-OHDA (Sigma cat no: H4381). Dissolve 6 mg of 6-OHDA
in ascorbic acid/saline solution and keep on ice until the time
of injection. Alternatively aliquots can be stored at 20 C for
6 months.
Methods
3.1 Intraventricular
Injection of Plasmids
1. Prepare the plasmid solution for injection using PowerPrep

HP Plasmid Maxiprep System from OriGene (see Note 2) following the manufacturers instructions with one exception.
Resuspend the plasmid DNA in 50 L of 10 mM TrisHCl
pH 8.5 to maximize DNA concentration. DNA concentration
should be between 5 and 10 mg/mL.
2. Back fill a glass needle with microloader tips (see Note 3).
3. Setup the equipment (Fig. 1eg). Attach the universal capillary
holder arm of the FemtoJet to the stereotactic instrument
using the same V clamp used to attach a probe. Load a needle
containing DNA into the capillary arm and secure the correct
dental bur in the micro drill. For needles created using micropipette puller the tip of the needle usually needs to be trimmed
to allow fluid to come out (see Note 4).
4. Place a newt in 0.1 % MS-222 and wait for a minimum of
15 min before assessing the level of anesthesia. To determine if
the newt is anesthetized pinch the leg of the newt or place it on
its back. If the newt does not move within 510 s continue
with the procedure. If the newt moves place it on its feet in
96
0.1 % MS-222 and wait for a further 5 min before repeating

the assessment.
5. Once the newt is anesthetized, dry the head with a paper towel
and place the newt on the plastic support and secure it using
the ear bars and the snout bar to the stereotaxic instrument.
The plastic support allows the ear bars to be firmly pushed
against the temples of the newt.
6. Place a small piece of damp tissue over the newt to stop it drying out under the microscope.
7. Using the dental drill, make a 12 mm diameter hole on the
skull of the newt at the junction between the parietal and frontal bones in the cranial midline. The drilling is performed
under observation through a stereomicroscope. The hole does
not need to go through the skull but split/crack the join
between frontal bones to allow the glass needle to pass through
(see Note 5).
8. Using the microscope, position the glass needle over the crack in
the skull and push the glass needle through the meninges using
the stereotaxic instrument to a depth of 1 mm (see Note 6).
9. Inject 500600 nL of the plasmid solution into the brain by
monitoring the drop in the meniscus of the fluid in the barrel
of the needle between the pen marks (see Note 1). Wait for
30 s before removing the needle and then unfasten the newt
from the stereotactic instrument. The newt should be electroporated within 5 min.
3.2 In Vivo
Electroporation
1. Check that the electroporator is set up correctly and the electrodes are clean. The newt is electroporated in unidirectional
manner at 150 mV/cm pore forming pulse and 110 mV/cm
transfer pulse with a decay of 5 % between the pulses. The newt
head is approximately 0.9 cm in width. To electroporate horizontally the machine is set to give one pore forming pulse at
135 mV 50 ms on 950 ms off, followed by five 50 ms pulses at
99 mV with 950 ms gap between each pulse.
2. Place the plastic support holding the newt on the bench. Dip
the electrodes and the head of the newt into tank water. Place
a lid of a 5 cm petri dish on top of the body of the newt to
secure it during the electroporation.
3. Use the hole in the skull as a guide to position the electrodes
on the side of the newt head, so that the current will pass
through this region of the brain. Once the head is gripped
firmly with the electrodes, start the electroporator.
4. Mix the fast drying cement and cover the drilled hole. The
cement takes about 10 min to dry.
5. Allow the newt to recover in tap water or tank solution. Place
the newt in a container with shallow water (15 cm in depth).
97
Use tissue paper to support the head of the newt so that it is

out of the water, allowing the cement to dry and the newt to
breathe freely while it regains consciousness.
6. Wait until the newt is moving freely before transferring it to a
tank that has a water depth of at least 15 cm.
7. Protein reporter expression driven by a CMV promoter is
visible after 15 h of electroporation.
3.3 Intraventricular
Injection of 6-OHDA
Wait for at least 23 days after electroporation before proceeding

to 6-OHDA injections.
1. Load the needle with 6-OHDA using the microloader tips.
2. Setup the intraventricular injections equipment and anesthetize the newts as described in Subheading 3.1, steps 24.
3. Anesthetize the newt and secure it to the stereotactic instrument as described Subheading 3.1, step 5.
4. Remove the dental cement covering the hole in the skull created
previously. Use forceps to pull the edge of the cement away from
the skull, and dry the head with tissue paper and cotton tips. Use
fine forceps and cotton tips to remove the remaining cement
with gentle scrapping action until the crack/hole used for the
previous injection becomes visible (see Note 7).
5. Inject 200 nL of toxin through the same hole using the needle
attached to the stereotactic device as described in
Subheading 3.1, step 9.
6. Mix fresh cement and cover the hole. Allow the newts to
recover in the shallow water as described in Subheading 3.2,
steps 5 and 6.
Notes
1. The micropipette puller is used to manufacture glass needles.
Mark the barrel of the needles every 2 mm with a marker pen.
These marks can be used to gauge the volume of the fluid
injected. The glass capillaries from Harvard Apparatus reference GC100F-10 have an inner diameter of 0.58 mm. Thus,
the volume of fluid held in 1 mm of the barrel part of the
needle is equal approximately to 200300 nL.
2. The purity of the DNA is critical to the success of the electroporation. Plasmid preparation using other kits can have reduced
efficiency and may have contaminates which can kill the ependymoglial cells.
3. Plasmid DNA with a concentration above 5 mg/mL can be
very viscous and difficult to pipette. Patience is required, but
the electroporation efficiency is substantially increased with
high DNA concentration.
98
4. Once the needle is loaded test to see if any fluid comes out.
If not, first check that the tubing is connected correctly. Next,
try increasing the injection pressure and thirdly use scissors to
cut the tip increasing the gauge of the needle. The injection
pressure is dependent on how viscous the solution is and the
gauge of the needle and can range from 100 to 2,000 hPa. The
fluid should come out at a slow and steady rate, and to inject
500 nL can take up to 30 s.
5. To drill the hole in the skull maintain a continuous rpm and
gently press the drill tip down on to the skull. Raise the drill tip
at 12 s intervals to check the progress of the drilling.
6. The penetrance to the meninges is determined by the size and
shape of the needle. Try several small sharp movements up and
down with the needle. If this does not work, try a different
needle. Care is needed not to break the needle at this point.
7. In some cases neuronal ablation is performed without electroporation. If this is the case, a hole is drilled in the skull as
described in Subheading 3.1.
Acknowledgement
This work was supported by a grant from the Swedish Research
Council to MK.
References
1. Tanaka EM, Ferretti P (2009) Considering the
evolution of regeneration in the central nervous system. Nat Rev Neurosci 10:713723
2. Kokaia Z, Martino G, Schwartz M, Lindvall O
(2012) Cross-talk between neural stem cells
and immune cells: the key to better brain
repair? Nat Neurosci 15:10781087
3. Zupanc GKH, Srbulescu RF (2011) Adult
neurogenesis and neuronal regeneration in the
central nervous system of teleost fish. Eur J
Neurosci 34:917929
4. Lang DM, Monzn-Mayor M, Bandtlow CE,
Stuermer CA (1998) Retinal axon regeneration in the lizard Gallotia galloti in the presence of CNS myelin and oligodendrocytes.
Glia 23:6174
5. Okamoto M, Ohsawa H, Hayashi T et al
(2007) Regeneration of retinotectal projections after optic tectum removal in adult newts.
Mol Vis 13:21122118
6. Kroehne V, Freudenreich D, Hans S et al
(2011) Regeneration of the adult zebrafish
7.
8.
9.
10.
11.
brain from neurogenic radial glia-type progenitors. Development 138:48314841

Simola N, Morelli M, Carta AR (2007) The
6-hydroxydopamine model of Parkinsons disease. Neurotox Res 11:151167
Parish CL, Beljajeva A, Arenas E, Simon A
and behavioural recovery in a salamander lesioninduced regeneration model. Development
134:28812887
Berg DA, Kirkham M, Beljajeva A et al (2010)
Efficient regeneration by activation of neurogenesis in homeostatically quiescent regions of
the adult vertebrate brain. Development 137:
41274134
Haas K, Jensen K, Sin WC et al (2002)
Targeted electroporation in Xenopus tadpoles
in vivofrom single cells to the entire brain.
Echeverri K, Tanaka EM (2002) Ectoderm to
mesoderm lineage switching during axolotl tail
regeneration. Science 298:19931996

12. Barnab-Heider F, Meletis K, Eriksson M et al
(2008) Genetic manipulation of adult mouse
neurogenic niches by in vivo electroporation.
Nat Methods 5:189196
13. Kster RW, Fraser SE (2001) Tracing transgene expression in living zebrafish embryos.
Dev Biol 15:329346
99
14. Kawakami K (2007) Tol2: a versatile gene transfer

vector in vertebrates. Genome Biol 8(Suppl 1):S7
15. Sandoval-Guzmn T, Wang H, Khattak S et al
(2014) Fundamental differences in dedifferentiation and stem cell recruitment during skeletal muscle regeneration in two salamander
species. Cell Stem Cell 14:174187
Chapter 8
The Accessory Limb Model: An Alternative Experimental
System of Limb Regeneration
Tetsuya Endo, David M. Gardiner, Aki Makanae, and Akira Satoh
Abstract
Accessory limb model (ALM) was developed as an experimental model and functional assay for limb
regeneration. The ALM provides several ways to identify pathways and test for signaling molecules that
regulate limb regeneration. Here, we summarize the history of the ALM and describe the specific details
involved in inducing ectopic blastemas and limbs from a skin wound on the side of the arm.
Key words Salamander, Axolotl, Nerve, Limb regeneration, Slow-release sustained bead
Introduction
Limb regeneration is one of the impressive biological phenomena
that have been studied in two urodele amphibians, axolotls and
newts. Limb amputation results in formation of a regenerationspecific structure called the blastema, which consists of undifferentiated cells. Blastema cells are derived from stump tissues and
appear to be lineage restricted such that regenerated muscle is
derived from myogenic progenitors, and connective tissue cells are
derived from cells in the connective tissues of the stump. Once a
blastema has formed, it starts restoring the original structure [1].
It is the early stages of blastema induction that are unique to limb
regeneration. Therefore, understanding early phases of limb regeneration that lead to blastema formation is important in order to
understand the regeneration potency in axolotls.
Historically, studies of limb regeneration were based on an
amputation model, and the progression through the stages of blastema formation, growth, and differentiation was described.
However, amputation causes wide-ranging injuries to the tissues at
the amputation plane, and it is not possible to determine which of
the multitude of responses that are triggered are required to induce
limb regeneration. In addition, since regeneration is a default
101
102
Tetsuya Endo et al.
response to total limb amputation, it is also difficult to assay

candidate factors for the ability to induce a regenerative response.
To address these problems, we revisited the phenomenon reported
in earlier studies that a limb can be induced to form from nonregenerative skin wound without limb amputation [2], taking
advantage from wounds which heal without forming a scar [3, 4].
We refined the surgical procedure and were able to induce ectopic
blastemas and limbs reproducibly and at a high frequency [2]. As a
consequence, studies of limb regeneration can be conducted using
two experimental systems, the amputation model and the ALM.
As mentioned above, the ALM is based on earlier studies indicating that there are three essential sources of signaling in limb
regeneration: the wound epidermis, nerves, and cells with positional information from the side of the limb that is opposite to the
wound [5]. Since covering the amputation plane with uninjured,
full-thickness skin (epidermis and dermis) inhibits limb regeneration [6], it appears that a direct interaction between the wound
epidermis and underlying stump tissues is required. The wound
epidermis in limb regeneration thickens to form the apical epithelial cap (AEC), which signals to the underlying mesenchymal cells,
resulting in the formation and sustained growth of the blastema.
The ability of the AEC to induce blastema growth is dependent on
signaling from nerves, and this interaction does not occur if the
limb is denervated, resulting in failure to regenerate the limb.
When the limb is amputated either experimentally or in nature, the
interactions between the wound epithelium, nerves, and blastema
cells are very important [5].
In contrast to amputation-induced limb regeneration, the
formation of an accessory limb de novo requires specific surgical
manipulations in order to provide the necessary signals [5]. In
the early experiments by Bodemer [7], the lateral side of the
proximal limb was extensively traumatized, and brachial nerves
were severed at the distal level and rerouted to the wounded site.
It was subsequently discovered that traumatizing deep tissue
could be replaced by grafting a limb/non-limb tissue to develop
a limb structure, such as bone, muscle, or internal organs [8].
Later, it was shown that grafting a piece of skin from the opposite
side of the contralateral limb to the nerve-deviated site is enough
to induce a limb [912]. Egar [9] also reported that the removal
of 12 mm square of skin at the site of a surgically deviated nerve
increased the frequency of blastema induction which was interpreted to occur as a result of increasing the chance that the wound
epithelium and the cut edge of the nerve interacted. This inference was consistent with the observation that the AEC is highly
innervated, and the interaction between the nerve and wound
epithelium is necessary to induce gene expression of an AEC
The Accessory Limb Model: An Alternative Experimental System
103
marker [13, 14]. In addition to migration of epidermal cells and

AEC formation, there is also a directed migration of dermal
fibroblasts into the wounded site to form the blastema as well as
to regenerate the dermis at the end of regeneration of the skin
wound [15]. In amputation-induced limb regeneration, dermal
fibroblasts are a major source of the blastema and redevelop into
cartilages and connective tissues [16, 17]. As with amputations,
dermal fibroblasts immediately migrate from the vicinity area of
the skin window into the center of the wound in the ALM [2].
Given that the signals necessary to induce limb pattern formation
in the ALM can be provided by grafting a piece of full-thickness
skin from the side of the limb that is opposite to the nervedeviated wound [912], it is likely that migration from the grafted
skin and surrounding skin generates positional diversity in dermal
fibroblasts, and such diversity is necessary for blastemas to
undergo pattern formation [18]. Taken together, signals from
both a deviated nerve and a grafted piece of skin are required to
form a limb de novo. Nerves transition the initial phase of skin
wound healing to the phase of blastema formation. If there is sufficient positional diversity derived from grafted fibroblasts from
circumferentially different positions, there is sufficient information to transition to the phase of pattern formation. Therefore,
the ALM enables us to examine functions of nerves and skin graft
separately, leading to the description of the progressive steps of
regeneration [2].
As the ALM allows us to assay for specific signals that regulate
progression from one step to the next, it is now possible to investigate the function of the AEC, nerves, and positional interactions
leading to limb regeneration. One way to do this is to test for the
ability of proteins delivered on beads to influence the behavior of
cells in wounds. The use of beads is widely accepted and has contributed in fields in developmental biology and regeneration. We
describe the microsurgical techniques associated with the ALM
and the preparation of gelatin beads for grafting in the context of
regeneration.
Materials
2.1 Obtaining
Axolotls
and Husbandry
1. Animals: Axolotls are either purchased from colonies such as

Ambystoma Genetic Stock Center at the University of
Kentucky, Lexington, or spawned in the laboratory.
2. Animals are maintained at 25 C on a 12-h light-dark cycle and
fed every 23 days.
3. Axolotls of 512 cm (snout-to-tail tip; juveniles or young
adults; see Fig. 1a, b) are preferred because they regenerate a
104
Tetsuya Endo et al.
Fig. 1 The axolotl and the anatomy of the forelimb. (ac) A juvenile leucistic axolotl. Front view (a) and dorsal
view (b). (c) Left side view of the animal at the forelimb level. The left forelimb is seen from the anterior side.
(d) The anatomy of the left forelimb at the middle of the forearm level as it would appear in transverse section
at the level of the black circle indicated in (c) (modified from [20])
limb relatively fast and are easy to handle. Leucistic and albino
mutants are useful since it is easier to visualize tissues through
their unpigmented skin.
2.2 Axolotl
Maintenance
and Surgery
1. Holtfreters solution buffered with Tris (HBT solution):

Dissolve 0.46 g NaCl, 0.05 g KCl, 0.1 g CaCl2, and 5.0 g
Trizma preset crystals (pH 7.2) in 1 L of dechlorinated tap
water (see Note 1).
2. 40 % HBT solution: Dilute the stock HBT in dechlorinated
tap water.
3. Tricaine methanesulfonate (MS222): Prepare 0.1 % solution in
40 % HBT and adjust pH to 7.27.4 with Tris (pH 9.0).
4. Surgical supplies: Fine forceps (Dumont #5 or similar), angled
ophthalmic scissors with 2.5 mm cutting edge, and tungsten
needles. Sterilize the surgical instruments with 70 % ethanol or
in a glass bead sterilizer.
5. Dissection and stereo fluorescence microscope.
2.3
Bead Preparation
1. Gelatin: Type B, ~225 g bloom, stored at room temperature

and in dry air condition (see Note 2).
2. Olive oil.
3. Siliconized Petri dish: Add few drops of silicon solution (e.g.,
Sigmacote) and swirl the dish to coat evenly. Air-dry the dish
105
at room temperature. Wash the dish with deionized water

(DDW) before use.
4. Glutaraldehyde fixative: 210 mM in deionized water
containing 0.1 % Tween 20 (see Note 3).
5. Glycine: Prepare 10 mM in DDW.
6. Proteins (e.g., FGF2) (see Note 4).
Methods
The procedure described here induces an accessory limb on
the anterior side of the left upper arm (for limb orientation, see
Fig. 1c, d). An accessory limb can be induced at other proximaldistal levels or from any position around the circumference of the
limb with appropriate modification of the procedure. Overview of
the ALM surgeries and resulting phenotypes are shown in
Fig. 2ad.
Fig. 2 Induction of an accessory limb in axolotls. (a) The surgical procedure that induces an ectopic blastema
from an anterior skin wound by deviating a nerve. (b) An induced blastema by the (a) surgery. (c) The surgical
procedure that induces an accessory limb from an anterior skin wound by deviating a nerve and grafting
posterior skin. (d) An accessory limb induced by the (c) surgery. Host limbs in (a)(c) and the accessory limb
in (d) are seen from the ventral side
106
3.1
Tetsuya Endo et al.
Skin Wounding
1. Put an animal into MS222 solution for anesthesia and leave it

for 1020 min.
2. Place a piece of tissue wipe on the surgical stage and moisten it
with 40 % HBT solution.
3. Place the anesthetized animal on the surgical stage, turning the
left side up (Fig. 3a).
4. Cover the animal with the moist wipe to protect from
dehydration.
5. Orient the left forelimb for surgical manipulation.
6. Pull up the skin on the anterior side at the middle of the upper
arm with forceps, and make a small incision carefully with ophthalmic scissors. If the animals are leucistic or albino, a thick
blood vessel is visible through the skin (Fig. 3a, see also Fig. 1d).
7. Put the tip of the scissors into the incision and excise the piece
of skin (1.01.5 mm 1.01.5 mm for blastema induction
without a skin graft, 1.01.5 mm 2.03.0 mm for limb
induction with skin graft) by expanding the incision (Fig. 3b)
(see Note 5). Attention needs to be paid not to damage hypodermal muscles, nerves, and blood vessels.
3.2
Nerve Deviation
1. Raise up the left arm so that the ventral side of the limb is up
(Fig. 3c). If the animals are leucistic or albino, two flexor nerve
bundles are visible through the skin (see Fig. 1d).
2. Make an incision on the ventroposterior side from the shoulder level to the elbow level (Fig. 3d).
3. Bisect the flexor nerves distally (at the elbow level).
4. Pull out the free tip of the nerves carefully with forceps (Fig. 3e).
Pay attention not to rupture the ventral brachial artery that is
attached to the flexor nerves by connective tissues.
5. Pass the cut end of the nerve underneath the ventroanterior
skin to the wound (Fig. 3f). Fix the skin back to the original
position to close the ventroposterior incision.
6. Turn the left arm back to see the anterior wound. Position the
cut edge of the nerve in the middle of the wound along
the transverse plane of the limb (Fig. 3g). Trim the distal tip of the
nerve, if it is too long.
7. These procedures (Subheadings 3.1 and 3.2) are sufficient to
induce a blastema (Fig. 2a, b) but insufficient to induce a limb.
To obtain a patterned limb, steps described in Subheading 3.3
are necessary.
3.3
Skin Grafting
1. To obtain a piece of skin for grafting, turn the animal left side
down.
2. Hold the right arm up so that the posterior side of the limb
is visible.
107
Fig. 3 A series of pictures of the surgery that induces an accessory limb. (a) For
left forelimb surgery, the animal is laid down, turning the left side up. A thick blood
vessel is visible on the anterior side of the forearm. (b) A square skin wound is
made on the anterior side of the middle of the forearm. (c) The limb is turned up
to expose the ventral side. (d) An incision is made in the ventroposterior skin to
access the ventral nerve bundle. (e) The ventral nerve bundle is cut at the elbow
level and pulled free of the connective tissues. (f) The cut end of the nerve bundle
is passed underneath the ventroanterior skin to the wound. (g) The limb is turned
down to see the anterior wound. The cut end of the nerve bundle is trimmed and
placed in the middle of the wound. (h) A piece of skin from the opposite side of the
limb (posterior skin is grafted to the anterior wound) is removed from the contralateral limb and grafted to the skin wound. g grafted skin
108
Tetsuya Endo et al.
3. Excise a 1.01.5 mm 1.01.5 mm piece of skin from the

posterior side of the upper arm (see Note 6).
4. Turn the animal left side up and expose the anterior wound.
5. Place the skin graft onto the anterior wound with the dermal
side down (Fig. 3h).
6. Place a moist wipe over the anterior wound, paying attention
not to touch the skin graft directly with the wipe.
7. Place the animal on ice or in the refrigerator for 24 h to allow
the graft to heal into place.
8. Gently place the animal back in 40 % HBT solution.
9. Well-patterned limb is observable about 60 days after the
surgery (Fig. 2c, d).
3.4 Preparation
of Beads
Bead generation is based on a procedure by Tabata et al. [19]. We

modified this procedure for experimental use in amphibian limb
regeneration.
1. Warm 50 mL olive oil up to 4060 C in a 200 mL glass
beaker and stir with a stir bar.
2. Dissolve 0.5 g gelatin in distilled water by heating on a hot
plate with stirrer or a water bath maintained at 100 C.
3. Add the gelatin solution into the warm olive oil to generate an
emulsion. Keep stirring the olive oil during this step (Fig. 4a)
(see Note 7).
4. Continue to stir the emulsion for 2 h at room temperature.
5. Place the emulsion in the refrigerator at 4 C and continue stirring for another 2 h. This cooling process makes the gelatin
solution solidify and form microspheres that can be seen in the
beaker.
6. Add 50 mL acetone into the beaker and continue stirring the
acetone-oil-bead mixture for 1 h at 4 C.
7. Transfer the mixture into 2 50 mL centrifuge tubes (Fig. 4b)
and centrifuge at 250 g for 5 min; discard the supernatant.
8. Add 50 mL acetone and invert the tubes several times to mix
the solution and centrifuge at 250 g for 5 min.
9. Discard the supernatant and add 50 mL isopropanol to each
tube, invert few times, and centrifuge at 250 g for 5 min
(Fig. 4c).
10. Wash the beads with DDW.
11. Fix the beads in 210 mM glutaraldehyde-Tween 20 solution
overnight at 4 C with constant stirring. Fixation results in
hardening of the beads (see Note 3).
12. Centrifuge the solution in a 50 mL tube at 250 g for 5 min
and collect the beads.
109
Fig. 4 Steps involved in making gelatin beads. (a) Gelatin solution is poured into warmed olive oil. (b) Acetone
is added into the gelatin-oil emulsion. (c) Beads are washed by isopropanol. (d) Beads can be observed in the
bottom of the tubes
13. Add deionized water and wash the beads by inverting few
times.
14. Centrifuge again at 250 g to remove the supernatant.
15. Transfer the beads in a glass beaker with 100 mL of 10 mM
glycine/DDW solution to neutralize the remaining
glutaraldehyde.
16. Stir the solution at room temperature for 1 h.
17. Centrifuge the solution in 50 mL tube at 250 g for 5 min and
discard the supernatant.
18. Wash the beads with DDW (shake well) and centrifuge as
described in step 17. Repeat this procedure three times.
19. Store the beads in DDW at 4 C (Fig. 4d). The beads are stable
for 1 month.
3.5 Protein
Absorption into
the Beads
1. Pipette 35 mL of deionized water in a 35 mm Petri dish.

2. Transfer beads into the Petri dish by a plastic pipette. Do not
transfer a large amount of beads. If an excess amount of beads
is transferred, water in the Petri dish becomes cloudy, which
makes bead selection difficult.
110
Tetsuya Endo et al.
Fig. 5 Equipment and instruments required for grafting gelatin beads. (a) Surgical tools. Sizes of forceps and
scissors depend on animal size. (b) A tungsten needle is melted into a glass Pasteur pipette. Tip of the needle
is sharpened by electrolysis. (c) A bead is poked by the tungsten needle. (d) Beads are placed in the center of
a dish and allowed to dry out, at which point they are shrunken and usually have a yellow color. (e) Proteins
are dropped on the beads and absorbed by the beads. A damp wipe is placed along a margin of the dish to
prevent dehydration of the beads
3. Select beads with the appropriate size for the experiment.

Stick the bead with a tungsten needle (Fig. 5b, c) and transfer
it into a new 35 mm siliconized Petri dish (Fig. 5d). Select
beads of 200400 m diameter which are ideal for implantation in axolotls.
111
Fig. 6 A series of pictures of the surgery to graft a gelatin bead. (a) Skin is excised from a limb and a small
piece of skin is grafted from the contralateral side of a limb. g grafted skin. Boxes indicate the border of the
wound and the graft. (b) A small tunnel is created by forceps. (c) A bead is inserted underneath the wound
epithelium through the tunnel using a tungsten needle. A black arrow indicates the direction of the tunnel. (df)
The bead is left in the tunnel by removing the tungsten needle gently. White arrows indicate the grafted beads.
(d) Bright field image. (e) Fluorescence image of (d) showing the autofluorescence of the grafted bead. (f)
Merged image of (d) and (e)
4. Allow the beads to dry out completely by removing the lid on

the plastic dish. Dried beads can be stored at room temperature for a couple of days.
5. Drop proteins of interest onto the dried beads. The beads will
begin to swell as they rehydrate. Allow the beads to absorb the
proteins for at least 2 h on ice or in a refrigerator. Place a wet
tissue wipe along the brim of the dish (Fig. 5e) to prevent
dehydration of beads.
6. The beads impregnated with proteins can be stored in 4 C for
23 days (see Note 8).
3.6 Surgery
and Bead Grafting
1. Anesthetize animals as described in Subheading 3.1.

2. Create a skin wound (usually 2 3 mm square).
3. Prepare and graft a skin graft as described in Subheading 3.3
(Fig. 6a).
4. Allow the graft to heal for 72 h.
5. Make a small incision by the wound (usually 2 mm long).
6. Create a small tunnel to the destination by insertion of fine-tip
forceps (Fig. 6b).
7. Pick up a bead from the dish by a tungsten needle and insert it
to the wound bed through the tunnel (Fig. 6cf) (see Note 9).
112
Tetsuya Endo et al.
8. Place the animals on ice for at least 2 h to allow the grafted

beads to heal into place.
9. Return the animals to 40 % HBT.
3.7 Observation
of Phenotypes
1. Grafted gelatin beads can be readily seen under a fluorescent

microscope due to their strong autofluorescence (Fig. 6df).
2. A limb blastema is observable in an axolotl (10 cm) 1 week
after implantation of beads soaked in FGF2 or FGF8.
3. Formation of a well-patterned limb induced by a skin graft is
completed in about 2 months.
Notes
1. We prefer to use Trizma preset crystals, pH 7.2 (Sigma-Aldrich
#T8508).
2. It might be appropriate to use type A gelatin depending on the
electrical charge of the protein being used. For example, type
A gelatin is for acidic FGF (FGF1).
3. This fixative needs to determine the stiffness of the beads.
Usually, 2 mM of glutaraldehyde is sufficient for experiments
in axolotls.
4. Proteins are purchased and reconstituted in accordance with
the manufacturers protocol. Usually the proteins are aliquoted
into 1 L each in siliconized microtubes. The aliquoted proteins are stored at 80 C.
5. The size of the wound should be adjusted to approximately the
same size as the transverse dimension of the limb (i.e., larger
wounds on larger animals).
6. It is important not to disorient the skin graft when it is moved
to the wound. To prevent that, prepare 2 510 mm fine lens
paper and place it next to the skin graft. Pick up the skin graft
and flip it onto the lens paper, so that the epidermal side is facing the lens paper. When leucistic or albino mutants are used,
put some dye (e.g., carbon ink) on the skin graft (the dermal
side) to facilitate visualization.
7. The diameter of the expected beads cannot be predicted
because of variability between researchers making the beads.
The size of the bead depends upon the stirring speed and temperature of gelatin solution. Gelatin prepared at higher temperature appears to produce smaller beads. Therefore, the
optimal speed of a stirrer to obtain the desired diameter should
be determined empirically in each laboratory.
8. Proteins typically maintain activity for over 1 week, but usually
maximum activities can be expected within the first couple of
113
days. It is strongly recommended that the beads are used on

the day when the protein is initially added to the beads.
9. The presence of the grafted bead can be confirmed by its autofluorescence (Fig. 6df). However, depending on animal color
(e.g., black or golden), autofluorescence of the bead can be hard
to identify because of strong autofluorescence of the animals.
Acknowledgments
This work was supported by Grant-in-Aid for Scientific Research
on Innovative Areas (KAKENHI #23124508 to AS and
#22124006 to TE).
References
1. Bryant SV, Endo T, Gardiner DM (2002)
Vertebrate limb regeneration and the origin of
limb stem cells. Int J Dev Biol 46:887896
2. Endo T, Bryant SV, Gardiner DM (2004) A
stepwise model system for limb regeneration.
Dev Biol 270:135145
3. Seifert AW, Kiama SG, Seifert MG, Goheen
JR, Palmer TM, Maden M (2012) Skin shedding and tissue regeneration in African spiny
mice (Acomys). Nature 489:561565
4. Levesque M, Villiard E, Roy S (2010) Skin
wound healing in axolotls: a scarless process.
J Exp Zool B Mol Dev Evol 314:684697
5. Goss RJ (1969) Principles of regeneration.
Academic, New York
6. Mescher AL (1976) Effects on adult newt limb
regeneration of partial and complete skin flaps
over the amputation surface. J Exp Zool 195:
117128
7. Bodemer CW (1958) The development of
nerve-induced supernumerary limbs in the
adult newt, Triturus viridescens. J Morphol
102:555581
8. Bodemer CW (1959) Observations on the
mechanism of induction of supernumerary
limbs in adult Triturus viridescens. J Exp Zool
140:7999
9. Egar MW (1988) Accessory limb production
by nerve-induced cell proliferation. Anat Rec
221:550564
10. Lheureux E (1977) Importance of limb tissue
associations in the development of nerveinduced supernumerary limbs in the newt
Pleurodeles waltlii Michah (authors transl.).
11. Maden M, Holder N (1984) Axial characteristics of nerve induced supernumerary limbs
12.
13.
14.
15.
16.
17.
18.
19.
20.
in the axolotl. Rouxs Arch Dev Biol 193:

394401
Reynolds S, Holder N, Fernandes M (1983)
The form and structure of supernumerary
hindlimbs formed following skin grafting and
nerve deviation in the newt Triturus cristatus.
Satoh A, Graham GM, Bryant SV, Gardiner DM
(2008) Neurotrophic regulation of epidermal
dedifferentiation during wound healing and
limb regeneration in the axolotl (Ambystoma
mexicanum). Dev Biol 319:321335
Stocum DL (2011) The role of peripheral
nerves in urodele limb regeneration. Eur J
Neurosci 34:908916
Gardiner DM, Muneoka K, Bryant SV (1986)
The migration of dermal cells during blastema
formation in axolotls. Dev Biol 118:488493
Kragl M, Knapp D, Nacu E, Khattak S, Maden
M, Epperlein HH, Tanaka EM (2009) Cells
keep a memory of their tissue origin during
axolotl limb regeneration. Nature 460:6065
Muneoka K, Fox WF, Bryant SV (1986)
Cellular contribution from dermis and cartilage to the regenerating limb blastema in axolotls. Dev Biol 116:256260
Makanae A, Satoh A (2012) Early regulation
of axolotl limb regeneration. Anat Rec 295:
15661574
Tabata Y, Hijikata S, Muniruzzaman M, Ikada
Y (1999) Neovascularization effect of biodegradable gelatin microspheres incorporating
basic fibroblast growth factor. J Biomater Sci
Polym Ed 10:7994
Bryant SV (1976) Regenerative failure of double half limbs in Notophthalmus viridescens.
Nature 263:676679
Chapter 9
High-Efficiency Electroporation of the Spinal Cord
in Larval Axolotl
Abstract
Axolotls are well known for their remarkable ability to regenerate complex body parts and structures
throughout life, including the entire limb and tail. Particularly fascinating is their ability to regenerate a
fully functional spinal cord after losing the tail. Electroporation of DNA plasmids or morpholinos is a valuable tool to gain mechanistic insight into the cellular and molecular basis of regeneration. It provides among
other advantages a simple and fast method to test gene function in a temporally and spatially controlled
manner. Some classic drawbacks of the method, such as low transfection efficiency and damage to the tissue,
had hindered our understanding of the contribution of different signaling pathways to regeneration. Here,
we describe a comprehensive protocol for electroporation of the axolotl spinal cord that overcomes this
limitations using a combination of high-voltage and short-length pulses followed by lower-voltage and
longer-length pulses. Our approach yields highly efficient transfection of spinal cord cells with minimal tissue
damage, which now allows the molecular dissection of spinal cord regeneration.
Key words Electroporation, Spinal cord, Regeneration, Axolotl
Introduction
In the late 1700s, Lazzaro Spallanzani found the salamander tail to
be an eminent model to study regeneration. Due to the transparency of their regenerating tail tissue Spallanzani could describe for
the first time the remarkable process of spinal cord regeneration
[1]. The behavior of the cells lining the central canal of the spinal
cord in response to injury is an integral aspect of spinal cord regeneration in salamanders. Following amputation of the tail, the spinal
cord grows posteriorly as a simple neuroepithelial tube of selfrenewing stem/progenitor cells. After a period of rapid expansion,
the tube undergoes renewed neurogenesis to faithfully reconstruct
tissue architecture and function [25]. Thus, in the view of current
interest in regenerative medicine, salamanders are an unparalleled
system to elucidate cellular and molecular mechanisms involved in
spontaneous recruitment and expansion of neural stem/progenitor
115
116
cells in response to injury. Recently, significant efforts have been

put into developing genetic, genomic, and transgenesis tools for a
mechanistic understanding of regeneration [69] that have now
made Ambystoma mexicanum (the axolotl) a premier organism for
the molecular genetic analysis of spinal cord regeneration.
A key technical aspect for the molecular analysis of spinal cord
regeneration is the ability to overexpress genes of interest.
Electroporation has proven to be a highly valuable tool in this context due to the ability to rapidly target DNA plasmid constructs to
the spinal cord. Electroporation is a technique which employs an
electric field to transfer charged nucleic acids or other macromolecules into cells [10]. The exact mechanism is not fully known but,
in essence, successful electroporation depends on two major processes. First, the application of a strong electric field induces the
formation of transient and reversible pores in the otherwise hydrophobic cell plasma membrane. Then, electric pulses facilitate the
entry of highly charged molecules such as DNA or RNA into the
cell by electrophoresis [11]. Inside the cell, the electroporated
DNA is transported into the nucleus, where it will be transcribed
by the endogenous transcriptional machinery. Electroporation is a
versatile tool and can be fine-tuned depending on the aim of the
cellular and/or molecular analysis. For instance, in small and transparent axolotls, electroporation of GFP expression plasmids into
single or small groups of spinal cord cells has been valuable to
identify and track in vivo resident spinal cord cells during regeneration [6, 12, 13]. DNA plasmids and morpholinos [14] can also be
used to test gene function, without going through the lengthy
process of generating transgenic animals or using viral vectors,
which are limited in insert size and can trigger immunological
responses. The expression of regular expression plasmids and morpholinos is transient, but can be observed more than 21 days after
electroporation depending on the cell type (our own observations). This is sufficient to cover the entire process of spinal cord
regeneration in larval axolotls. For cell fate or lineage tracing studies, expression vectors such as the Tol2 transposon system can be
used for stable gene expression by integrating the ectopic genes
into the host genome [15].
Previous studies in the axolotl reported the electroporation of
charged nucleic acids into small groups of spinal cord cells [6, 14].
However, electroporation as a method to study gene function in
the axolotl spinal cord has remained elusive because often large
numbers of electroporated cells are required within the tissue to
detect an effect. Here we report a new strategy of in vivo spinal
cord electroporation in the axolotl which yields highly efficient
transfection of resident spinal cord cells with minimal tissue damage. Our strategy involves (1) microinjection of DNA encoding
the gene of interest into the central canal of the spinal cord and (2)
application of two sets of electric pulses, the so-called poring and
Spinal Cord Electroporation in Axolotl
117
transfer pulses, in which voltage and duration have been optimized

to maximize efficiency and minimize tissue damage. Different from
what has been previously described, our approach yields highly
efficient transfection of resident spinal cord cells with minimal tissue damage opening a new door for simple and efficient gene function studies in the axolotl spinal cord.
Materials
1. Axolotls, 2.22.5 cm snout to tail tip (see Note 1).
2. 10 Phosphate buffered saline (PBS) stock: to prepare 1 L of
10 PBS, dissolve the following reagents in 800 mL of deionized water: 88 g of NaCl, 7 g of NaH2PO4, and 2.3 g of
KH2PO4. Use HCl to adjust the pH to 7.4 and add deionized
water up to 1 L. For 1 PBS solution, dilute 10 stock in
deionized water. Autoclave to sterilize. Store PBS at room
temperature.
3. DNA plasmid: we use the pCAGGs-Cherry-nls plasmid (ubiquitous chicken -actin promoter with a CMV enhancer driving
nuclear Cherry expression) diluted in PBS at a concentration
of 1.5 g/L (see Note 2).
4. DNA Plasmid Maxi Kit (see Note 3).
5. Fast Green solution: make 5 Fast Green solution by dissolving 12.5 mg of Fast Green FCF powder in 10 mL of 1 PBS.
6. 10 TBS: to make 1 L, add 24.2 g of TRIS and 90 g of NaCl
in 990 mL of distilled water. Mix well and adjust the pH to 8.0
by adding 10 mL of HCl 37 %. Store at room temperature for
up to 12 months.
7. Holtfreters solution 400 % (wt/vol): Mix 2.875 g of KCl,
5.36 g of CaCl22H2O, 11.125 g of MgSO47H2O, and
158.4 g of NaCl. Fill up to 10 L with distilled water. Store at
room temperature for up to 6 months.
8. Benzocaine 10 % (wt/vol): To make benzocaine stock solution, dissolve 50 g of benzocaine in 500 mL of 100 % ethanol.
Store at room temperature up to 12 months.
9. Benzocaine 0.03 % (vol/vol): To make 10 L, mix 500 mL of
10 TBS, 500 mL of 400 % Holtfreters, and 30 mL of 10 %
benzocaine. To anesthetize the animals, dilute the 0.03 % solution to 0.008 % in tap water.
10. Polymethyl methacrylate platform and SYLGARD silicone
elastomer (Dow Corning), for stably holding the animal during microinjection (see Note 4).
11. Microloader tips, for loading the microinjection capillaries.
118
12. Sharp and ring forceps, for breaking the microinjection needles
and handling the animals.
13. Borosilicate glass capillaries (1.2 mm O.D., 0.94 mm I.D.).
14. Pressure injector (e.g., PV830 Pneumatic PicoPump, World
Precision Instruments).
15. A stereomicroscope with 3-axis micromanipulator attachment.
16. Electroporation plate: petri dish, UltraPure Agarose, PBS,
scalpel.
17. Tweezer electrodes with round 10 mm platinum plate electrodes (CUY650P10, Nepa Gene).
18. NEPA21 electroporator (Nepa Gene).
19. Cups to house the animals.
Methods
3.1 Preparation
for Microinjection
and Electroporation
1. Make a 2 % (wt/vol) agarose solution in PBS. Heat in a microwave oven to dissolve, swirling to ensure proper mixing.
2. Pour the gel in a 60 mm petri dish and allow to cool down at
room temperature. When the gel solidifies, cut out three wells
with a surgical scalpel to make an electroporation plate
(Fig. 1a). The two parallel wells will hold the electrodes for
electroporating the tail; the third well, the body of the axolotl
(Fig. 1b). Cut a thin line from the third well passing through
the agarose between the two parallel wells. This cut will keep
the tail straight and parallel to the electrodes during electroporation (Fig. 1c) (see Note 5).
Fig. 1 Making of the electroporation plate for holding and protecting the tail during electroporation. (a) Cartoon
illustrating the top view of the electroporation plate. Two wells, 40 mm spaced apart, will hold the electrodes.
The thin cut, 20 mm away from each of these wells, will keep the tail of the axolotl in place and protected from
the electric current, as shown in (b) and, in a lateral view, in (c)
119
3. Dilute DNA plasmid to 1.5 g/L in PBS (see Notes 1 and 6).
Mix the diluted plasmid with Fast Green FCF solution at a
30:1 ratio (see Note 7).
4. Generate microinjection needles on a standard Flaming/
Brown micropipette puller or similar instrument (see Note 8).
5. Set the pressure injector at 2 psi eject pressure and the duration
switch on gated mode (see Note 9).
6. Set up the electroporation parameters. The NEPA21 electroporator allows the configuration of two electrical pulses in one
single electroporation: the poring pulse and transfer pulse. Use
one bipolar poring pulse of 70 V and 5 ms length with a 50 ms
interval and no voltage decay (total two pulses) followed by four
bipolar transfer pulses of 40 V and 50 ms with 999 ms interval
and 10 % voltage decay (total of eight pulses) (see Note 10).
7. Fix the electrode tweezers 7 mm apart (see Note 11). Connect
the lead wires from the electrode tweezers to the electroporator power supply. Place a 100 mL glass bottle or dish filled
with PBS near the work area to submerge the electrodes before
and between each electroporation.
8. Fill the electroporation plate with ice-cold PBS before the start
of the procedure (see Note 12).
9. Anesthetize axolotls in 0.008 % benzocaine. 2.22.5 cm axolotls will take 510 min to fall asleep.
10. Prepare individual cups with tap water.
3.2 Microinjection
into the Spinal Cord
Make sure the microinjection and electroporation stations are set

up before starting the experiment (Fig. 2a). For best outcome,
operate swiftly.
1. Back-load the microinjection needle with a few microliters of
DNA solution using a microloader tip. Insert the microinjection needle in the micropipette holder and mount on the
micromanipulator (see Note 13).
2. Ensure that each axis of the coarse and fine drive unit of the
micromanipulator is located at the midpoint position to maximize the working range. Set the micromanipulator arm holding the needle at an angle of 60 with respect to the stage plate
of the stereomicroscope (Fig. 2b) (see Note 14).
3. Lay an axolotl on the silicone bed of the microinjection platform, parallel to the stage plate of the stereomicroscope.
Overlay the tip of the needle with the spinal cord at the injection level and, using sharp forceps, carefully break the tip end
(Fig. 2c) (see Note 15).
4. Insert the microinjection needle gently through skin and muscle to reach the central canal of the spinal cord (see Note 16).
Fig. 2 Setup for microinjection and electroporation of the spinal cord of larval axolotls. (a) Microinjection (1)
and electroporation stations (2) showing the pressure injector (PI), micromanipulator (MN), NEPA21 electroporator (EP), the custom-made electroporation plate (Ep) and commercial electrode tweezers (ET). (b) Lateral
view of the manipulator arm showing the 60 angle respect to the stage plate of the microscope. (c) Image of
the microinjection needle superposed to the spinal cord in the axolotl tail. The opening of the microinjection
121
5. Press the footswitch to pressure-inject the DNA solution into

the central canal. Hold down the footswitch until the brain
ventricles and the end of the spinal cord are filled with green
dye (Fig. 2d) (see Note 17).
3.3 Electroporation
of the Tail/Spinal Cord
1. Using round forceps, transfer the axolotl to the electroporation plate filled with ice-cold PBS (Fig. 2f) (see Note 18).
2. Electroporate the tail by applying one bipolar square-wave
pulse of 70 V and 5 ms with 50 ms interval followed by four
bipolar square-wave pulses of 40 V and 50 ms with 999 ms
interval and 10 % voltage decay (Fig. 2g).
3. After electroporation, place the axolotl in its individual cup
with tap water and allow it to recover (see Note 19).
3.4 Confirming
Electroporation
Efficiency
1. Four days post-electroporation, anesthetize the animals and

examine electroporation efficiency and tissue integrity under a
fluorescence microscope (Fig. 3a) (see Note 20).
2. Amputate the tail using a surgical scalpel, preferably at the
same anteriorposterior level in each axolotl. The myotome
number caudal to the cloaca can be used as a reference.
Normally, we perform tail amputations within the 12th to
15th myotome (Fig. 3b) (see Note 21).
3. Return the axolotl to a cup for recovery.
4. Over the next days, follow up the process of spinal cord regeneration as intended (Fig. 3d).
Notes
1. This protocol has been carefully optimized to 2.22.5 cm axolotls. In these animals the electroporation efficiency is the
highest, with the least tissue damage. The same procedure can
be used in larger axolotls, although electroporation parameters
will need to be modified to achieve the best results. Below we
recommend some modifications to our original electroporation conditions that can be used as a starting point.
Fig. 2 (continued) needle should not be bigger than approximately half the thickness of the spinal cord. (d)
View of an axolotl after a successful microinjection into the central canal of the spinal cord. The brain ventricles
and spinal cord are filled with Fast Green. (e) View of the caudal end of the spinal cord after microinjection. The
central canal must be filled with green dye. (f) Top view of an axolotl in the electroporation plate prior to the
procedure. Importantly, the animal is immersed in ice-cold PBS and the tail protected by the agarose. (g) Image
showing tweezer electrodes during the electroporation of the axolotl tail
122
Fig. 3 Highly efficient spinal cord electroporation in a larval axolotl. (a) Schema placing the procedure of spinal
cord electroporation in the context of a typical regeneration experiment in axolotl. (b) Combined bright-field
and fluorescent image of the tail of an axolotl 4 days post-electroporation. The expression of the fluorescent
reporter plasmid pCAGGS-Cherry-nls in the spinal cord suggests a high-efficient transfection of spinal cord
cells. The tail has been amputated at the level of the myotome 12. (c) Cross-section of the electroporated
spinal cord shown in (a), 4 days post-electroporation. (d) Combined bright-field and fluorescent image of the
same animal depicted in (a) after 4 days of regenerative outgrowth. Scale bars in (a) and (c) are 0.5 mm;
50 m in (b)
2. We suggest using a reporter gene with your plasmid of interest

for visualizing electroporation efficiency. When preparing two
or more plasmids, mix them with a molar ratio of 1:1. We recommend to keep the DNA solution close to 1.5 g/L. Higher
DNA concentrations become too viscous and are difficult to
inject, given the small opening of the microinjection needle
required for injecting into the central canal of the spinal cord.
3. Normally, we purify plasmid DNA using QIAGEN Plasmid
Maxi Kit and following manufacturers instructions. It is
important to dissolve the DNA at a relatively high concentration. Our DNA stocks have a concentration of 68 g/L in
double-distilled water, and are stored at 20 C.
4. The platform for microinjection we use is custom-made (MPICBG workshop, Dresden, Germany). However, a silicone bed
in a petri dish will help keeping the animal in place during the
microinjection procedure.
5. Besides maintaining the animal in place, the electroporation
plate is important to allow the delivery of high-current electric
pulses with minimal tissue damage. Tissue exposed directly to
the electric field is more susceptible to overheat. Therefore, fill
the dish with enough agarose to cover the entire axolotl tail
123
but do not fill it to the brim. For best results, change the electroporation plate after 6080 electroporations.
6. Deionized water does not conduct the electrical pulses efficiently, therefore, dilute the DNA in PBS. For each 2.22.5
axolotl, calculate on 1.5 L of DNA solution per spinal cord.
7. Fast Green FCF is an organic dye that is not taken up by living
cells. Here it is used to visualize the injection of DNA into the
central canal and gauge the amount of solution injected.
8. It is key to produce a microinjection needle tip thin enough to
slip into the central canal of the spinal cord but sturdy enough
to penetrate through the skin and muscle of the tail. Perform a
ramp test as instructed by the manufacturer to determine the
heat value inherent to the glass capillary tube. In our hands, the
following pull cycle parameters (Heat: (ramp test value), Pull:
100, Velocity: 100, Time: 100) provide thinly tapered tips that
will accommodate DNA concentrations up to 2 g/L.
9. Using gentle pressure and manually determining pulse
length provides the best control over the injection.
10. The poring pulse is aimed to open pores in the cell membrane
with minimum damage, and the transfer pulse to deliver
charged DNA into the cells. Based on our experience, the
above-mentioned parameters are the best compromise between
electroporation efficiency and tissue damage in larval axolotls
(2.22.5 cm snout-to-tail length). For larger animals, increase
the voltage to 50 V and the number of pulses to 5.
11. For larger animals, start with a 6 mm gap between electrodes.
If the tail tissue gets damaged, increase the distance to 7 mm.
12. The ice-cold PBS helps preventing excessive heating of the
electroporated tail. Change PBS regularly, so it stays cold.
13. Bring the microloader tip as deep as possible into the microinjection needle, and then eject/push the DNA solution to avoid
the formation of air bubbles. If bubbles form, gently tap the
needle to get rid of them. The animals will not like an air bubble into the spinal cord or brain ventricles. If it happens, sacrifice the animal.
14. Bring the micromanipulator next to the stereomicroscope so
that the tip of the microinjection needle appears in the middle
of the field of view under low magnification. This will help to
operate comfortably during microinjection.
15. In small and transparent axolotls, the spinal cord can be clearly
identified as the brown tubular structure above the notochord.
The opening of the tip should be in a 45 angle and be not
bigger than half the thickness of the spinal cord at the level of
injection (Fig. 2c). To avoid disrupting the spinal cord as much
as possible, we recommend to inject the DNA solution 23 mm
posterior to the planned amputation or injury site.
124
16. This is a critical step. The spinal cord sits only a few micrometers
under the tail muscles, and a fine move of the fine drive unit
of the micromanipulator will bring the tip to the central canal.
Confirm this by gently depressing the footswitch and observing how the DNA solution spreads out. If the tip of the microinjection needle is inside the central canal the solution will
flow inside the spinal cord. If it is not, make tiny movements
bringing the needle tip back and forth while keeping the
footswitch pressed. Stop when you see the green dye flowing
inside the tube. If the DNA solution does not flow, dip the
ring forces in PBS and bring the tip of the microinjection
needle in the PBS film that forms on those. Then, activate
the footswitch to unclog the needle without the need of breaking the tip.
17. Sometimes the DNA solution spreads out in a tube-like manner and gives the false impression that is inside the central canal
of the spinal cord but is, instead, in the meningeal space. This
will result in only the outer neuronal cells being electroporated. Inspect the caudal-most end of the spinal cord. It will be
filled up with the green solution if the injection was successful
(Fig. 2e).
18. It is important to carry out this step as quickly as possible to
avoid the diffusion of injected DNA solution.
19. Examine the animals few hours after electroporation. If the tail
appears visibly curled or burned, sacrifice the animal. We recommend not to change the water of the animals during the
next 34 days to avoid damaging the tails.
20. The expression of the reporter plasmid can be readily observed
2 days post-electroporation. However, we recommend to wait
4 days before proceeding with the experiment for maximum
expression, and to allow the animals to fully recover from the
electroporation.
21. During the initial optimization/training electroporations, we
recommend to fix the piece of amputated tail to quantify the
efficiency of electroporation in tissue sections (Fig. 3c).
References
1. Spallanzani L (1766) Lettre to C. Bonnet
dated A Bomporto, prs de Modene ce 21
Septembre 1766. Edizione Nazionale delle
opere di Lazzaro Spallanzani edn.
2. Holtzer SW (1956) The inductive activity of
the spinal cord in urodele tail regeneration.
J Morphol 99:140
3. O'Hara CM, Egar MW, Chernoff EA (1992)

Reorganization of the ependyma during axolotl spinal cord regeneration: changes in intermediate filament and fibronectin expression.
Dev Dyn 193:103115
4. Nordlander RH, Singer M (1978) The role of
ependyma in regeneration of the spinal cord in
5.
6.
7.
8.
9.
the urodele amphibian tail. J Comp Neurol

180:349374
McHedlishvili L, Mazurov V, Grassme KS,
Goehler K, Robl B, Tazaki A, Roensch K,
Duemmler A, Tanaka EM (2012) Reconstitution
of the central and peripheral nervous system
during salamander tail regeneration. Proc Natl
Acad Sci U S A 109:E2258E2266
Echeverri
K,
Tanaka
EM
(2003)
Electroporation as a tool to study in vivo spinal
cord regeneration. Dev Dyn 226:418425
Khattak S, Sandoval-Guzman T, Stanke N,
Protze S, Tanaka EM, Lindemann D (2013)
Foamy virus for efficient gene transfer in
regeneration studies. BMC Dev Biol 13:17.
doi:10.1186/1471-213X-13-17
Khattak S, Schuez M, Richter T, Knapp D,
Haigo SL, Sandoval-Guzman T, Hradlikova K,
Duemmler A, Kerney R, Tanaka EM (2013)
Germline transgenic methods for tracking cells
and testing gene function during regeneration
in the axolotl. Stem Cell Rep 1:90103
metamorphosis, transgenesis and tamoxifen-
10.
11.
12.
13.
14.
15.
125
mediated recombination. Nat Protoc 9:

529540
Neumann E, Schaefer-Ridder M, Wang Y,
Hofschneider PH (1982) Gene transfer into
mouse lyoma cells by electroporation in high
electric fields. EMBO J 1:841845
Mir LM (2014) Electroporation-based gene
therapy: recent evolution in the mechanism
description and technology developments.
Methods Mol Biol 1121:323
Echeverri K, Tanaka EM (2002) Ectoderm to
mesoderm lineage switching during axolotl tail
regeneration. Science 298:19931996
McHedlishvili L, Epperlein HH, Telzerow A,
Tanaka EM (2007) A clonal analysis of neural
progenitors during axolotl spinal cord regeneration reveals evidence for both spatially
restricted and multipotent progenitors.
Schnapp E, Tanaka EM (2005) Quantitative
evaluation of morpholino-mediated protein
knockdown of GFP, MSX1, and PAX7 during
tail regeneration in Ambystoma mexicanum.
Dev Dyn 232:162170
Kawakami K (2007) Tol2: a versatile gene
transfer vector in vertebrates. Genome Biol
8(Suppl 1):S7
Chapter 10
Pseudotyped Retroviruses for Infecting Axolotl
Abstract
The ability to introduce DNA elements into host cells and analyze the effects has revolutionized modern
biology. Here we describe a protocol to generate Moloney murine leukemia virus (MMLV)-based,
replication-incompetent pseudotyped retrovirus capable of infecting axolotls and incorporating genetic
information into their genome. When pseudotyped with vesicular stomatitis virus (VSV)-G glycoprotein,
the retroviruses can infect a broad range of proliferative axolotl cell types. However, if the retrovirus is
pseudotyped with an avian sarcoma leukosis virus (ASLV)-A envelope protein, only axolotl cells experimentally manipulated to express the cognate tumor virus A (TVA) receptor can be targeted by infections.
These strategies enable robust transgene expression over many cell divisions, cell lineage tracing, and cell
subtype targeting for gene expression.
Key words Axolotls, Salamander, MMLV, VSV-G, ASLV-A, Limb regeneration
Introduction
The astonishing regenerative abilities of axolotls and other
salamanders have been the subject of intense experimentation
over several centuries. However, a researchers ability to unlock
biological secrets is direct function of the power of the tools
operational in the experimental system. In axolotls, a major hurdle has been the lack of a robust gene expression tool. Recent
advances have permitted the creation of transgenic axolotls [1]
and even transgenic axolotls with inducible gene expression [2, 3].
However, obtaining stable lines of transgenic animals is a lengthy
endeavor perhaps best reserved for genes of special and intense
interest. In other model systems, transgenesis has been complemented with faster methods for examining gene function. Axolotl
researchers have long used electroporation to introduce exogenous
DNA to cells in vivo. However, this method is transient as rapidly
dividing cells, such as those in the regenerating limb blastema,
partition the introduced DNA into daughter cells, resulting in an
eventual diminishing of the expression across the tissue.
127
128
Additionally, electroporation in other salamanders has been

documented to lead to deleterious and possibly confounding
effects, such as muscle cell dedifferentiation [4]. Hence, alternative approaches for fast, robust, and potentially permanent exogenous gene expression are required.
An efficient means of permanent gene transfer is the use of a
virus that incorporates its genetic material into the host genome,
such as a retrovirus. Retroviruses have been used as very powerful
tools to deliver genes into many mammalian cells and tissues that
are difficult to transfect with other methods since the viral vector
was established in early 1980s [5]. We have recently successfully
applied this tool in axolotls [6]. Because retroviral genomes,
including engineered elements, incorporate into the host genome,
stable inheritance of these elements occurs as cells divide. Hence,
all daughter cells continue to harbor the elements and, thus, retain
the ability to express the transgene. This perdurant expression contrasts to other methods of expression such as plasmid electroporation [7]. Therefore, retroviral infections offer researchers a
profound ability to track even highly proliferative cells and to
robustly express transgenic elements of interest for prolonged periods of time without risk of diminishing expression.
This protocol provides details for generating a Moloney murine
leukemia virus (MMLV)-based retrovirus that can be engineered
to carry any gene of interest and can infect axolotl cells in vivo and
in vitro. MMLV is gammaretrovirus that contains positive sensed,
single-stranded RNA genome that replicates through DNA intermediate [8]. During the replication process, viruses randomly integrate
their genetic information into the host genome. The viral genome
contains three proteins, gag, pol, and env; one nucleic acid packaging signal, ; and other cis-acting elements. Engineered retroviral
vector maintains cis-elements but excludes sequences of proteins
that can be supplied separately during the virus preparation process. This design results in generation of replication-incompetent
MMLV. Pseudotyped retrovirus can also be generated by providing
plasmids expressing a different envelope protein, which binds a particular cell surface receptor that mediates the specificity of cell that
virus can infect. For example, VSV-G envelope protein enables pseudotyped retrovirus to infect almost any type of eukaryotic cell [9]. On
the other hand, pseudotyped retroviruses with ASLV-A envelope
protein infect only cells expressing avian TVA receptor [10]. The
latter design enables tissue-specific expression of a gene of interest
if TVA is expressed using a tissue-specific promoter. By creating batteries of transgenic animals expressing TVA in specific tissue types,
researchers can easily produce viruses and test their effects in many
different tissue types without altering the viral genome for each tissue of interest.
To generate pseudotyped retrovirus, mammalian 293T cells
are transfected with three plasmids: (a) an engineered retroviral
129
vector that contains a gene of interest, a packaging signal, and

other cis-regulating elements; (b) a helper plasmid containing retroviral gag and pol open reading frames (ORFs); and (c) a plasmid
containing the ORF of envelope protein such as VSV-G or
ASLV-A. A concentration step is used to produce high-titer viruses.
We further describe the methodology for infecting live axolotls
with these retroviruses.
Materials
Before starting this protocol, please consult the safety department
of your institution. Each institution/country may have specific
regulations for handling pseudotyped retroviruses.
2.1 Plasmid
Components
1. A pQCXIX (Clontech)-based retroviral vector (see Notes 1

and 2).
2. A helper plasmid that contains ORF of retroviral gag and pol
[11].
3. A plasmid that contains ORF of VSV-G envelope protein [12]
or ASLV-A envelope protein [13].
2.2 Virus Preparation

Components
1. Cell culture medium for 293T cells: 10 % heat-inactivated fetal

bovine serum (FBS) (see Note 3), 1 (100 U/mL) penicillinstreptomycin (P/S), in high glucose Dulbeccos Modified
Eagles Medium (DMEM). Open a new bottle of DMEM and
take out 50 mL of media into a 50 mL conical tube. This
serum-free DMEM can be used in the transfection described
later. Add 50 mL heat-inactivated FBS and 5 mL 100 P/S
into 450 mL DMEM. Store at 4 C.
2. Poly-D-lysine (PDL)-coated tissue-culture plates: Prepare
0.1 mg/mL PDL by adding 50 mL of sterile tissue-culture
grade water to a conical tube containing 5 mg PDL. Store
reagent at 20 C. Once thawed, PDL can be stored at 4 C.
3. Polyethylenimine (PEI) transfection reagent: Make 1 mg/mL
PEI solution in water, adjust the pH to 7.0 with HCl, and use
a 0.22 m filter to sterilize the solution. Make aliquots in sterile 1.5 mL microcentrifuge tubes and store the reagents at
80 C. Once thawed, aliquots can be stored at 4 C for 23
months.
4. Medium for virus collection: 10 % NuSerum and 1 (100 U/mL)
penicillin-streptomycin in high glucose DMEM. Filter sterilize
and store at 4 C for 1 month.
2.3 Injection/
Infection Components
1. Axolotl water, 4 L: Dissolve 7.2 g sodium chloride (NaCl),

960 mg magnesium sulfate heptahydrate (MgSO47H2O),
328 mg calcium chloride dihydrate (CaCl22H2O), and
130
192 mg potassium chloride (KCl) into 4 L deionized water.

Sodium bicarbonate (NaHCO3) is used to adjust the pH to the
range of 6.757.25 (see Note 4).
2. 0.1 % Tricaine-S in axolotl water: Dissolve appropriate amount
of Tricaine-S in axolotl water to equal 0.1 %, and then adjust
pH up to 7.0 using sodium bicarbonate. Filter sterilize or use
immediately.
3. 1 % fast green solution: Prepare by adding 0.1 g fast green in
10 mL H2O. The solution is sterilized by passing through a
0.22 m filter and then stored at 4 C.
4. 10 % diluted bleach solution: Prepare in water and fill into
squirt bottle or spray bottle for cleaning surfaces potentially
contaminated with retrovirus.
2.4 Equipment
and Supplies
1. 0.45 m filtration system, Centricon Plus-70 Centrifugal

Filter Units (NMWL 10 kDa).
2. Ultracentrifuge tubes (Beckman Coulter Ultra-Clear Thinwall
Tube Cat no. 344059 for SW41Ti rotor or Cat no. 344058 for
SW28 rotor).
3. Ultracentrifuge (e.g., Beckman Coulter Optima L-90K and
SW41Ti or SW28 bucket rotor and their accessories such as
sleeves, caps, and sleeve holder).
4. Microcapillary needle puller.
5. Microinjection apparatus with accessories (microcapillary needles, microloader tips for loading virus into capillary needles).
Methods
3.1 Preparation
of Plasmids
1. Clone gene of interest into engineered retroviral vector such as

pQCXIX. A ubiquitous promoter such as CMV or CAGGs will
drive robust gene expression in any infected cell. A fluorescent
tag is also recommended so the infected cells can be visualized
to (a) determine the location of infection and to (b) determine
the titer of virus described in this protocol.
2. Purify all plasmids mentioned in Subheading 2.1 by commercial kit such as QIAGEN Plasmid Maxi Kit to reach sufficient
amount.
3.2 Maintaining/
Splitting 293T Cell
Line (See Note 5)
1. Aspirate and discard old media.

2. Add 610 mL fresh complete 293T media to old plate.
3. Aspirate media against cell surface multiple times to detach
cells.
4. Add 1 mL of cells to new plate containing 10 mL fresh media.
5. Place plate of 293T cells in a humidified incubator at 37 C
with 5 % CO2.
3.3
Virus Preparation
131
DAY 1: Split 293T cells in the ratio of 1:20 from one confluent
plate. For each gene of interest, six 10 cm culture plates are used
for Day 1.
1. Aspirate and discard old media.
2. Add 10 mL fresh complete media to old plate.
3. Aspirate media against cell surface to detach cells.
4. Add 0.5 mL of cells to each new plate containing 10 mL fresh
media.
5. Place all plates in a humidified incubator at 37 C with 5 %
CO2.
DAY 4: Split one 10 cm plate from Day 1 to two PDL-coated
10 cm plates. For each gene of interest, twelve 10 cm plates are
used for Day 4 (see Note 6).
6. Aspirate old media against cell surface to detach cells.
7. Split media to two PDL-coated (see Note 7) plates containing
5 mL fresh media.
8. Place all plates in a humidified incubator at 37 C with 5 % CO2.
DAY 5: Transfect 293T cells via PEI.
9. Mix plasmid DNA and PEI in serum-free DMEM in 15 mL
conical tubes and vortex briefly. For each plate, 6 g of retroviral vector, 3 g of retro gag pol (helper) plasmid, 1 g of coat
protein plasmid (VSV-G or ASLV-A), 25 L of PEI (1 mg/mL),
and 250 L of serum-free DMEM are used. We use 12 plates
in this protocol; therefore, multiply the components by 12.5.
Mix serum-free DMEM and DNA first, and then add PEI
dropwise to the premixed DNA/DMEM solution.
10. Incubate the DNA/PEI mixture for 1015 min.
11. Meanwhile, replace old media with 10 mL fresh complete
medium for each plate.
12. Evenly apply DNA/PEI mixture dropwise onto the surface of
cells.
13. Swirl plates gently and place plates back to incubator.
DAY 6: Replace media with 5 mL 10 % NuSerum medium for each
plate.
14. Aspirate and discard old media (see Notes 8 and 9).
15. Add 5 mL fresh media containing 10 % NuSerum for each
plate.
16. Place all plates in a humidified incubator at 37 C with 5 %
CO2.
132
DAY 7: Collect and freeze first batch of media containing virus.

17. Collect media at 48 h post-transfection by tilting the plates to
pull the media and using a tissue-culture pipette to gently
aspirate the virus-containing media into sterile conical tubes.
Collect a total of 60 mL media for each gene of interest and
split the medium into two 50 mL conical tubes (see Notes
1012).
18. Add 5 mL fresh media containing 10 % NuSerum to each
plate.
19. Store collected media at 80 C (see Note 13).
DAY 8: Collect media containing virus.
20. Collect medium at 72 h post-transfection as in step 17.
21. Plates containing 293T cells can be properly disposed after disinfection (see Note 14).
22. Store collected medium at 80 C or start the concentration
process with tubes collected from the previous day.
3.4 Concentrate
Virus
1. Thaw frozen media containing virus in 37 C water bath.

2. Place tubes on ice immediately after the last piece of frozen
media are thawed.
3. Spin down at 4 C and 840 g for 5 min to pellet cell debris.
4. Apply all supernatant (~120 mL) to a sterile 0.45 m filter
system in tissue-culture hood (see Note 15).
5. Add 0.45 m filtered media to Millipore Centricon Plus-70
centrifugal filter units.
6. Spin Plus-70 concentrator at 2,500 g for 40 min at 4 C.
7. Repeat step 6 until all media were filtered (see Note 16).
8. Meanwhile, expose ultracentrifuge tubes, sleeves holding ultracentrifuge tubes, and caps of the sleeves to UV light for
2030 min in a laminar flow tissue-culture hood (see Note 17).
9. Recover concentrated supernatant by inverting Plus-70 concentrator and spinning the unit for 5 min at 931 g and 4 C.
10. Collect the concentrated supernatant in the conical portion of
the container and add the concentrated supernatant to
ultracentrifuge tube.
11. Add the media that passed through the filter, collected in step 7,
to ultracentrifuge tube for total volume of 13 mL (see Note 18).
12. Make a dummy tube for balancing if necessary.
13. Balance tubes by weighting each set of ultracentrifuge tube,
sleeve holding the tube and its cap all together.
14. Ultracentrifuge at 4 C, 12,30013,200 g for 3 h in SW41Ti
or SW28 bucket rotor.
133
15. Discard supernatant by dumping out most of the medium

with one movement. Keep the tube upside down at an angle
(see Note 19).
16. Aspirate excess media by using vacuum aspirator. If the tube
holds 13.2 mL, aspirate the droplet on the top of the tube. If
the tube holds 38.5 mL, aspirate the media clinging to the wall
by a zigzag motion up to half of the tube (see Note 20).
17. Place each tube back into the sleeve and cap each sleeve.
18. Put all capped sleeves containing tubes at 4 C overnight to
help with resuspension of virus (see Note 21).
19. The following day, shake the virus in the entire contraption
(tubes/sleeves/caps) for 2 h on a platform/orbital shaker in a
cold room until virus is well resuspended (see Note 22).
20. In the tissue-culture hood, gently mix virus by pipetting up
and down using a P20 pipette. Avoid generating bubbles.
21. Aliquot (see Note 23) and freeze aliquots at 80 C.
3.5 Test the Titer
of Virus
To test the titer by using this protocol, an ORF of a fluorescent

protein must be cloned into the retroviral vector (see Note 24).
DAY 1
1. Seed 293T cells in one 6-well plate per virus in the ratio of
1:20 per well from a 10 cm confluent plate (see Note 25).
DAY 2
2. Make serial dilution of virus from 1:103 to 1:108 in 1 mL complete medium in 1.5 mL microcentrifuge tubes. Add 1,200 L
complete medium to microcentrifuge tube containing 1.2 L
of concentrated virus (vial 1; 1:103 dilution). Mix well. Take
120 L medium from vial 1 to a microcentrifuge tube containing 1,080 L medium (vial 2; 1:104 dilution). Repeat the process till having virus dilution from 1:103 to 1:108.
3. Remove old media from each well of the 6-well plate. For each
well, add 1 mL of media from each tube containing diluted
virus.
4. Place plates in a humidified incubator at 37 C with 5 % CO2.
DAY 4
5. Identify and count the number of fluorescent colonies by
observing infected cells under fluorescence microscope (see
Note 26).
6. Calculate the titer from the number of observed colonies and
the amount of virus applied to that well. Record this
information.
134
Fig. 1 Infecting axolotls with retrovirus. (a) Arrangement of unopened glass capillary needles in a 15 cm petri
dish. Note that the needles are suspended from the surface by a strip of modeling clay. Lidding the dish keeps
the needles from collecting dust. (b) Unopened needle filled with retrovirus and fast green, which allows for
visualization during injection. Note the long taper of the needle. Filled needles can be broken with forceps at
the tip to open. (c) Juvenile axolotl with a right upper forelimb blastema immediately following infection.
Ventral side is up. (c) Higher magnification of (c). Note that injection of the virus has been confined to the
blastema and does not extend into the stump
3.6 Infect Limb

Blastemas
1. Pull microcapillary needles (Fig. 1a, see Note 27).

2. Anesthetize axolotls by placing the animal in 0.1 % tricaine in
axolotl water (see Note 28).
3. Thaw virus on ice (see Note 29).
4. Add 1/10 volume of 1 % fast green (final concentration 0.1 %)
to thawed virus (see Note 30).
5. Backfill virus into microcapillary needle by microloader pipette
tips (Fig. 1b, see Note 31).
6. Inject viral solution into blastema by microcapillary needle
attached to pneumatic injector (Fig. 1c, c, see Notes 32
and 33).
7. Place animal back in container with fresh axolotl water
( see Note 34).
8. Monitor animal on subsequent days to confirm expression
(Fig. 2).
135
Fig. 2 In vivo expression of EGFP following infection with QC-EGFP retrovirus. (a, a) Bright-field and fluorescent images of a right forelimb at 5 days postinfection, 19 days post-amputation. (b, b) Bright-field and
fluorescent images of same limb on live animal after full regeneration. Amputation plane was mid-humerus.
Scale bar is 1 mm
Notes
1. The ORF of a gene of interest should be cloned after an appropriate promoter (for example, for ubiquitous expression, CMV
can be used). For a single gene without a marker, a stop codon
is included. However, we recommend using the 2A system to
simultaneously allow for visualizing cells. In this strategy, the
ORF can be cloned without a stop codon and instead followed
directly by 2A and a fluorophore sequence. 2A encodes
18-amino acid self-cleaving peptide that is operational in axolotl [6]; hence, the engineered virus will express one transcript
and a single polypeptide that is then cleaved into the protein of
interest and the fluorophore.
2. A control virus should be prepared in parallel. For example,
QCMV-EGFP, which expresses EGFP alone under the CMV
promoter, can be used as a negative control.
3. To heat inactivate serum, incubate thawed FBS in 56 C water
bath for 30 min. Shake the bottle every 10 min.
136
4. Our laboratory makes a large volume of stock axolotl water by

adding 720 g sodium chloride (NaCl), 96 g magnesium sulfate
heptahydrate (MgSO47H2O), 32.8 g calcium chloride dihydrate (CaCl22H2O), and 19.2 g potassium chloride (KCl) into
400 L deionized water. Sodium bicarbonate (NaHCO3) is
used to adjust the pH to the range of 6.757.25.
5. Split 293T cells twice a week in the ratio of 1:61:10.
6. PDL (poly-D-lysine) coating is recommended beyond normal
tissue-culture plate coating, especially if the 293T cells are not
very adherent. This coating can be omitted if the 293T cells
firmly attach to the plates and remain attached through virus
collection/media change steps.
7. To coat plates with PDL, aspirate 5 mL or more PDL (0.1 mg/
mL) into a plate. Gently rock the plate to ensure all the surface
of plate is covered. Leave 1 mL PDL solution in each plate and
aspirate the excess solution for next plate. Incubate all plates
covered with PDL for 5 min. Aspirate remaining PDL in plates.
Thoroughly rinse plate surface with sterile cell culture grade
water. Allow plates to dry in tissue-culture hood, with lids ajar,
for at least 30 min before use. PDL solution can be reused with
proper storage.
8. The transfection rate can be inspected by visualizing the fluorescence if an ORF of fluorescent protein was cloned into the
retroviral vector.
9. The medium will now contain live virus and should therefore
be handled carefully and according to institutional guidelines.
10. Take caution as the media contains live virus. Use gentle aspiration and avoid bubbles as much as possible as they can have
a deleterious effect on the virus.
11. Place tubes on ice temporarily.
12. Volume increases when medium freezes. Do not add more
than 40 mL of media into one 50 mL tube to prevent leakage
of medium and/or bursting of tube in freezer. Split the media
evenly into two tubes so they are well balanced for centrifugation in Subheading 3.4, step 3.
13. Conical tubes can either be stored upright in 80 C freezer or
buried in a dry ice chest. To enable retrieval from a dry ice
chest, place conical tubes inside plastic bags, and tie a label to
each bag using a very long string; leave the label end of string
outside of the dry ice chest.
14. Proper decontamination of materials and disposal of infected
cells should be performed in pursuance of your institutions
guidelines for biohazardous waste.
137
15. Be sure to use 0.45 m instead of 0.22 m filter. If a 0.22 m

filter is used, virus will be trapped in the filter and cannot be
recovered.
16. Keep the pass through media for step 11.
17. This ensures the materials for concentrating virus will be sterile. Virus need not be sterile for use in axolotls (though sterility
is preferred), but preparations with bacterial contamination
will be impossible to titer in cultured cells.
18. The ultracentrifuge tube for SW41Ti rotor holds total volume
of 13.2 mL and the tubes for SW28 rotor holds 38.5 mL.
19. Dump the supernatant in one swoop into a waste beaker in the
hood. At the end of the protocol, decontaminate the contents
pursuant to your institutions protocol and dispose.
20. Avoid aspirating off the viral pellet at the bottom of the tube.
The viral pellet is usually visible as translucent or colored precipitate but may sometimes be difficult to discern from plastic
tube.
21. At this point, it is not necessary or recommended to add media
to the pellet. Residual media clinging to the wall of each tube
following aspiration will drip down the insides of the tube and
collect with the viral pellet overnight. Be careful to keep the
tubes upright in the refrigerator or cold room; use a tube stand
to ensure they do not fall over.
22. Shake tubes at a medium speed that is strong enough to resuspend virus but not to jostle the tubes out. Secure the tubes by
placing them in racks inside a bucket. We advise using a rack
inside a rectangular ice bucket and filling the bucket with ice to
minimize jostling and ensure the virus is kept cold.
23. Around 50 L of concentrated virus is recovered, though the
final volume depends on how much residual media was aspirated from the sides of the tube. Set aside 1.2 L of concentrated virus in one microcentrifuge tube for testing of the viral
titer later. Multiple freeze-thaw cycles decrease viral titers.
Estimate the required volume of virus for each experiment and
make aliquots. The best infections may be achieved with fresh
virus prepared without freezing.
24. Other methods may be designed to detect infected cells. These
methods may include detection via histological procedures
such as enzymatic activity or antibody stains or qRT-PCR.
25. When first learning to prepare virus, it is advisable to reserve
and freeze some unconcentrated virus so that it can be tested
for activity when the concentrated preparations are titered.
To do this, simply save a small aliquot (100150 L) of fresh
virus-containing media after the initial filtering step removing cell debris. Prepare separate plates or wells for infecting
138
293T cells with unconcentrated virus. Apply 10100 L of

unconcentrated virus, and count infected colonies to compare to concentrated titer. If virus is produced but lost in
concentration, this will become apparent in this comparison.
26. Infected cells form colonies from single cells; therefore, identify number of colonies instead of cells for each well. The duration of viral infection required to detect fluorescence may vary
depending on co-expressed proteins. Be consistent between
preparations so viral titers prepared from different batches are
comparable. Do not wait so long that the number of cells/
colony becomes very large. The ideal colony size to count is
48 cells. To determine the titer of virus, find a well with a
countable number of colonies (i.e., there are many colonies
but not too many to count, and the colonies are far enough
apart that they can be individually discerned). For example, if
there are eight colonies in the well of 1:108 dilution, the titer
for the virus is approximately 8 108.
27. Practice and instrument calibration are necessary to produce
perfect glass capillary needles. We use a Sutter Instruments
P-87 machine. This machine pulls two closed-end needles
from each capillary tube. Following pulling, we line the needles up inside a large petri dish with a bar of modeling clay to
keep them from breaking.
28. The time required for axolotls to be fully anesthetized depends
on the size of the animal. Handle animals pursuant to your
institutions animal care guidelines.
29. Avoid having the virus thawed for lengthy amounts of time
before injection as this could diminish infectivity.
30. Virus is sensitive to bubbles. Therefore, mix virus and fast
green by gently stirring pipette tip inside microcentrifuge tube
instead of pipetting solution up and down, which generates
bubbles easily.
31. Take the upmost care to squirt the virus as close to the tip of
the glass capillary needle as possible. Eject the virus in one
pipette movement without releasing. Avoid bubbles within the
virus column in the glass capillary as they can make injecting
with low pressure impossible. Insert the filled needle into the
holder of the pneumatic device. A forceps is used to break a
piece of the needle tip off under a stereodissection microscope.
Be careful not to break too much of the tip off; needles can
always be broken again, but if too much has been broken off,
the virus will be ejected too quickly and can be wasted or can
lead to air being injected into the animal.
139
32. Place the animal on a silicone pad. For blastemas, the animal
can be placed on its ventral side and the limb pulled away from
the animal atop the pad. Alternatively, animals can be placed
on their sides with limbs resting atop the bodies. Be sure to
keep axolotls moist throughout the procedure. This can be
accomplished by performing the procedure quickly or by dabbing the body with axolotl water/tricaine while on the silicone pad.
33. Practice with your specific pneumatic device will be necessary
to become adept at delivering virus. The idea is to fill the area
of interest with the virus-containing fast green solution and to
do it with minimal damage to the animals tissue, minimal
waste/leakage, and minimal carryover to other tissues. Low
pressure is advisable, but too low can result in clogged needles
from slimy tissue becoming impacted at the ejection site or
from virus clogging the needle. Too high will result in premature ejection of the virus, too much virus, and possibly in the
injection of air (which is not good for the animals).
34. Normally, axolotls can be immediately returned to housing
containers and fresh axolotl water. There is no worry that virus
will leak out provided the needles and injection entries were
quite small. However, when first learning the procedure, axolotls can be kept asleep postinfection for 1 h to ensure the
injection site is not disrupted. To do this, gently transfer the
injected animals to a prepared hydration chamber (for example, a large petri dish with tricaine-soaked filter paper).
Following the resting period, transfer the axolotls to fresh
water in normal housing. Throughout the procedures, proceed in compliance with your institutions biosafety guidelines.
This may involve temporarily housing the infected animals in a
BL2-area until the virus is no longer infectious or until a
predetermined time dependent upon your institution.
Decontaminate all areas exposed to the virus. Wear appropriate
personal protective gear (PPE) as VSV-G-coated retroviruses
are capable of infecting human cells.
Acknowledgements
This work was supported by start-up funds from Brigham and
Womens Hospital (J.L.W.). The authors would like to thank
Christina DeMaso in Dr. Connie Cepkos lab (Harvard Medical
School) for sharing similar protocols used in infecting mammalian cells.
140
References
1. Sobkow L et al (2006) A germline GFP transgenic axolotl and its use to track cell fate: dual
origin of the fin mesenchyme during development and the fate of blood cells during regeneration. Dev Biol 290:386397
2. Whited JL, Lehoczky JA, Tabin CJ (2012)
Inducible genetic system for the axolotl. Proc
Natl Acad Sci U S A 109:1366213667
3. Khattak S et al (2013) Germline transgenic
methods for tracking cells and testing gene
function during regeneration in the Axolotl.
Stem Cell Reports 1:90103
4. Atkinson DL et al (2006) Cellular electroporation induces dedifferentiation in intact newt
limbs. Dev Biol 299:257271
5. Cone RD, Mulligan RC (1984) Highefficiency gene transfer into mammalian cells:
generation of helper-free recombinant retrovirus with broad mammalian host range. Proc
6. Whited JL et al (2013) Pseudotyped retroviruses for infecting axolotl in vivo and in vitro.
7. Echeverri
K,
Tanaka
EM
(2003)
Electroporation as a tool to study in vivo spinal
cord regeneration. Dev Dyn 226:418425
8. Maetzig T et al (2011) Gammaretroviral vectors: biology, technology and application.

Viruses 3:677713
9. Yee JK, Friedmann T, Burns JC (1994)
Generation of high-titer pseudotyped retroviral vectors with very broad host range.
Methods Cell Biol 43:99112
10. Young JA, Bates P, Varmus HE (1993)
Isolation of a chicken gene that confers susceptibility to infection by subgroup A avian leukosis and sarcoma viruses. J Virol 67:
18111816
11. Ory DS, Neugeboren BA, Mulligan RC
(1996) A stable human-derived packaging
cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes. Proc Natl Acad Sci U S A 93:
1140011406
12. Beier KT et al (2011) Conditional expression
of the TVA receptor allows clonal analysis of
descendents from Cre-expressing progenitor
cells. Dev Biol 353:309320
13. Landau NR, Littman DR (1992) Packaging
system for rapid production of murine leukemia virus vectors with variable tropism. J Virol
66:51105113
Chapter 11
Thyroxine-Induced Metamorphosis in the Axolotl
(Ambystoma mexicanum)
Abstract
The axolotl (Ambystoma mexicanum) has remained an important model for regeneration and developmental
biology for over a century. Although axolotls in captive-bred colonies usually exist in an aquatic form, they
retain the ability to undergo metamorphosis following exposure to thyroid hormone. Here we present a
robust method for inducing metamorphosis in adult axolotls that results in high survivability and produces
terrestrial animals that can be maintained in long-term captivity.
Key words Metamorphosis, Thyroxine, T4, Thyroid hormone, Axolotl, Ambystoma, Salamander,
Regeneration
Introduction
Amphibian metamorphosis produces a suite of behavioral,
morphological, physiological, biochemical, and genetic changes
associated with the transition from a larval to adult form [13].
These changes are mediated by alterations in circulating thyroid
hormones (T3triiodothyronine and T4thyroxine) and their
interaction with thyroid hormone receptors in target cells [3, 4].
Among urodeles, however, paedomorphosis has evolved in several lineages to produce species that fail to undergo an obvious
metamorphosis in natural populations [5]. Instead, these species become sexually mature while retaining many larval traits.
Although the biochemical changes that mediate the failure to
undergo metamorphosis in these paedomorphic lineages have not
been identified, some urodeles, including Ambystoma mexicanum
(axolotl) and Ambystoma tigrinum (tiger salamander), retain the
ability to undergo metamorphosis following exposure to thyroidstimulating hormone (TSH), T3 and T4 [2, 3, 69].
141
142
In order to induce metamorphosis in axolotls, two basic

methods using hormones are usually employed: peritoneal injection of the hormone [7] or addition of the hormone to the rearing
water [2]. While the majority of studies using induced metamorphosis of the axolotl have focused on aspects of metamorphosis
itself, some recent studies have sought to use captive terrestrial
axolotls to explore mechanisms regulating regeneration [10, 11].
For these studies, animals must be healthy, actively eating, and able
to survive in captivity for more than a year. Although more time
intensive than single peritoneal injections, using the method presented here, >50 % of completely metamorphosed animals survive
in long-term captivity.
Materials
1. Axolotls (see Note 1).
2. Round plastic containers (diameter = 21.5 cm, height = 15 cm).
3. Plastic shoeboxes with lids (width = 33.5 cm, depth = 19.5 cm,
height = 9 cm).
4. L-Thyroxine (100 M) stock T4 solution: Add 100 mg
L-thyroxine (T4) (Sigma; Cat. no: T2376) in 10 mL 0.4 M
NaOH in a 15-mL conical tube. Vortex the tube for 30 s and
incubate the tubes in a water bath maintained at 37 C for
5 min. Repeat vortex and heat cycle until L-thyroxine is completely dissolved. This solution is now 13 mM T4. Take 5 mL
of T4 solution and add to 645 mL of sterile water to make
100 M stock solution. The remaining 5 mL of 13 mM T4 can
be wrapped in foil and stored at 4 C.
5. L-Thyroxine (T4) working solution (50 nM): Make
50 nM T4 as needed by mixing 100 M T4 stock solution
with 40 % modified Holtfreters solution at 1:2,000 dilution
(see Note 2).
6. 40 % modified Holtfreters solution: For a 1,136-L
(300-gallon) container, add 1,589.7 g NaCl, 90.8 g NaHCO3,
22.7 g KCl, 181.7 g MgSO47H2O, and 90.8 g
CaCl42H2O. Add all the dry components into the container
and fill to volume with sterile water. Mix with circulation until
all components have gone into solution. Add 75.7 mL Amquel
and 75.7 mL Novaqua to this solution. Solution is now ready
to use (see Note 3).
7. California blackworms (Lumbriculus species).
8. Night crawlers (earthworms).
Thyroxine-Induced Metamorphosis in the Axolotl (Ambystoma mexicanum)
143
Methods
1. To facilitate successful metamorphic transition, feed animals
California blackworms every day for 1 week prior to the first
addition of T4 working solution (normal feeding schedule is
every 3 days).
2. After 1 week, transfer axolotls into plastic containers with
working T4 solution (one animal per container). The amount
of T4 solution should fill the container (see Note 4).
3. Remove and replace working T4 solution every 3 days.
4. Feed animals after each changing with a generous portion of
California blackworms (approximately 2025 worms). Since
they will stop eating during metamorphosis, the goal is to get
them to eat as much as possible.
5. Obvious morphological changes are rarely visible until approximately 2 weeks after T4 exposure. The first visible changes
occur in the third week and include noticeable weight loss,
dorsal ridge recession, tail fin recession, and eye protrusion
(Fig. 1) (see Note 5).
6. Concomitant with the above morphological changes, the gills
begin to disappear. It is critical to begin lowering the water
level as this happens. The water level should be reduced an inch
per water changing. When the gills have nearly disappeared,
Fig. 1 Pictorial representation of morphological changes occurring during thyroxine-induced metamorphosis

in adult axolotls. The first obvious changes are visible 23 weeks following thyroxine exposure. The dorsal fin
begins to regress in a cranial to caudal direction, as does the ventral portion of the tail fin (red arrows). Four
weeks after exposure, the gills have begun regressing and the dorsal and anal fins continue to disappear. The
eyes begin to protrude from the head. The gills, dorsal, and anal fins have almost entirely disappeared in the
fifth week (red arrows). By the sixth week, animals have metamorphosed to a completely terrestrial form
144
place two pieces of bunched-up paper towel at the bottom of

the containers (see Note 6).
7. After 45 weeks, the gills have completely disappeared and T4
administration is no longer required. Transfer each axolotl to a
plastic shoebox container with lid, paper towel, and 1 in. of
40 % modified Holtfreters solution. Feed each animal or
of an earthworm (see Note 7).
8. From this point on, animals can be maintained on paper towels
in 1 in. of 40 % Holtfreters solution. Animals should be offered
food every 3 days (see Note 7).
Notes
1. In our experience, wild type and albino color morphs exhibit
higher survivability than white mutants. We have used this
method successfully on animals ranging in size from 7 cm TL
to >20 cm TL adults.
2. We typically add 50 mL of T4 stock solution to a 44-gallon
container (e.g., large Rubbermaid trash bin) to make 100 L
working solution (with 40 % modified Holtfreters solution).
The working T4 solution can be used for several days when
morphing a large number of animals.
3. Although we maintain our colony of axolotls at a relatively
constant water temperature of 1820 C, for metamorphosis we
use Holtfreters solution that is at room temp (~2325 C).
4. It is imperative that plastic containers used for induced metamorphosis are kept separately from normal housing containers
because T4 can induce metamorphosis at extremely low concentrations. Once containers are exposed to L-thyroxine, they
should be clearly labeled.
5. As the skin matures to an adult phenotype, it is shed frequently
and this will cause the water to appear dirty. In our experience,
this does not require an increase in water changing frequency.
6. Paper towels provide a surface to help the axolotls reach the
surface and acquire oxygen along with helping to keep the
containers moist. Axolotls will eat significantly less at this point
during metamorphosis and may refuse to eat at all. To help
encourage consumption, place 510 blackworms directly in
front of their mouth.
7. Resumption of feeding is critical for metamorphs to survive in
captivity. A behavioral change is associated with transition to a
terrestrial mode of feeding. Every animal must be offered food,
although every axolotl may not eat at every feeding. This is
normal. Patience is required while feeding metamorphs.
Thyroxine-Induced Metamorphosis in the Axolotl (Ambystoma mexicanum)
145
Earthworms should be offered with a tweezer and placed to

the left or right of the axolotls nostril to encourage eating.
A light tap in front of the eyes can sometimes encourage the
animal to bite for food. When animals are reluctant to eat
earthworms, we offer blackworms.
Acknowledgments
This work was supported by the Office of the Vice President of
Research at the University of Kentucky.
References
1. Dodd M, Dodd J (1976) The biology of metamorphosis. In: Lofts B (ed) Physiology of the
Amphibia, vol 3. Academic, New York,
pp 467599
2. Page RB, Monaghan JR, Samuels AK, Smith JJ,
Beachy CK, Voss SR (2007) Microarray analysis
identifies keratin loci as sensitive biomarkers for
thyroid hormone disruption in the salamander
Ambystoma mexicanum. Comp Biochem
Physiol C Toxicol Pharmacol 145:1527
3. Rosenkilde P, Ussing AP (1996) What mechanisms control neoteny and regulate induced
metamorphosis in urodeles? Int J Dev Biol
40:665673
4. Brown DD (1997) The role of thyroid hormone in zebrafish and axolotl development.
Proc Natl Acad Sci U S A 94:1301113016
5. Shaffer HB, Voss SR (1996) Phylogenetic and
mechanistic analysis of a developmentally integrated character complex: alternate life history
modes in ambystomatid salamanders. Am Zool
36:2435
6. Norris DO, Platt JE (1974) T3-induced and
T4-induced rates of metamorphosis in immature and sexually mature larvae of Ambystoma
7.
8.
9.
10.
11.
tigrinum (Amphibia caudata). J Exp Zool

89:303310
Prahlad KV, DeLanney LE (1965) A study of
induced metamorphosis in the axolotl. J Exp
Zool 160:137145
Taurog A (1974) Effect of Tsh and long-acting thyroid-stimulator on thyroid I-131metabolism and metamorphosis of Mexican
Axolotl (Ambystoma mexicanum). Gen Comp
Endocrinol 24:257266
Taurog A, Oliver C, Eskay RL, Porter JC,
McKenzie JM (1974) The role of TRH in
the neoteny of the Mexican axolotl
(Ambystoma mexicanum). Gen Comp
Endocrinol 24:267279
Monaghan JR, Stier AC, Michonneau F, Smith
MD, Pasch B, Maden M, Seifert AW (2014)
Experimentally induced metamorphosis in
axolotls reduces regenerative rate and fidelity.
Regeneration 1(1):214. doi:10.1002/reg2.8
Seifert AW, Monaghan JR, Voss SR, Maden M
(2012) Skin regeneration in adult axolotls: a
blueprint for scar-free healing in vertebrates.
pone.0032875
Chapter 12
Generation of Aneurogenic Larvae by Parabiosis
of Salamander Embryos
Abstract
Limb regeneration of salamanders is nerve dependent, and the removal of the nerves in early stages of limb
regeneration severely curtails the proliferation of the blastemal cells and growth of the regenerate. The
removal of the neural tube from a developing salamander embryo results in an aneurogenic larva and the
aneurogenic limb (ANL) develops independently without innervation. Paradoxically, the limb in an ANL
is capable of regeneration in a nerve-independent manner. Here, we describe a detailed method for the
generation of ANL in the spotted salamander, Ambystoma maculatum, for regeneration studies.
Key words Newt, Axolotl, Limb regeneration, Nerve dependence
Introduction
Innervation of tissues and organs is a fundamental requirement in
vertebrates as well as invertebrates. In a classical perspective, the
nerves are associated with neurotransmission, whereas in a context
like organ regeneration, the nerves exert dependence on the tissues. The nerve dependence is established during embryonic development and it persists throughout adult life. In tissue regeneration
of mammals, the recent findings indicate that regeneration of hair
follicle [1], digit tip [2], bone marrow [3], and earlobe [4, 5]
requires the presence of nerves. The nerve dependence of tissues
was discovered in relation to salamander limb regeneration [6] and
has been subjected to extensive experimental studies spanning
several decades. These studies revealed several salient features of
nerve dependence during salamander limb regeneration [79].
Transection of the salamander limb in an experimental context
invokes rapid wound healing, followed by dedifferentiation and
proliferation of progenitor cells from the local stump tissues, leading to formation of a limb blastema. The limb blastema is a heterogeneous collection of cells and the origin and nature of these cells
varies among salamander families [1012]. Despite these
147
148
differences in the origin of the blastemal cells, in all cases, blastemal

cell proliferation requires the presence of nerves in its immediate
proximity during the early stages of regeneration [8]. The growth
of nerve axons into the regenerating tissues of the limb occurs very
early, and the nerve branches reach both epithelial and mesenchymal populations [1315]. The cellular components of the nerve
which invade the tissues originate from ensheathing Schwann
cells and associated fibroblasts [16]. Transection of the nerve
prior to limb amputation does not prevent the formation of an
initial cohort of blastemal cells [17, 18], but the nature of the
wound epithelium is different, and the proliferation of blastemal
cells is severely curtailed, leading to failure of the limb regenerate
[16, 19]. A minimum threshold of nerve fibers is also required
within the limb tissues for regeneration [20]. Recently we have
shown that the Schwann cell-derived newt anterior gradient protein (AGP) is able to largely substitute for the presence of the nerve
in adult newts [21]. The AGP is a ligand for the taxon-specific
protein Prod1 [2224], which is expressed as a cell surface GPIanchored protein predominantly by dermal fibroblasts and blastemal cells [25]. In a denervated early limb regenerate, ectopic
expression of AG gene by electroporation leads to robust expression of the protein in the regenerate and this acts as a growth factor
for proliferating blastemal cells [21]. Proliferation of the blastemal
cells leads to restoration of the secretory functions of the wound
epithelium and induction of glandular cells. Remarkably, this cascade of events leads to completion of the regenerative process with
complete autopodial elements, though lacking in skeletal muscle.
During development of salamander embryos, the limb bud
develops at a later stage compared to other amniotes, and it
evolves semiautonomously [26]. The salamander embryos are
easily amenable to experimental manipulation, a feature which
was established by experimental embryology in the early twentieth century [27]. Therefore, the entire neural tube from the base
of the brain to the tail bud can be removed from a salamander
embryo by microsurgical methods, and the limb bud develops
and differentiates into a limb in an autonomous manner [2830].
This limb, which has never had peripheral innervation, is called
an aneurogenic limb (ANL). The ANL has exceptional properties in that, it can regenerate without innervation. However, if
the ANL is transplanted to the location of the normal limb in a
host larva, the brachial nerves grow into the transplanted ANL
and establish connections [31]. This leads to imprinting of the
nerve dependence in the ANL, which fails to regenerate in a
denervated context. Our recent experiments on the nature of
ANL have identified the cellular and molecular events associated
with ANL development and regeneration [32]. The AGP is
expressed at high levels in the larval epidermis during development and regeneration, but decreases when it is transplanted to a
normal larval host due to innervation. In an ANL limb, the high
Generation of Aneurogenic Larvae by Parabiosis of Salamander Embryos
149
level of secreted AGP acts in lieu of the nerve as a source of

growth factor during regeneration [32].
The autonomous nature of the limb bud development in salamander embryos is advantageous for experimental manipulation.
The limb bud is amenable to extensive surgical intervention, electroporation, orthotopic, and ectopic transplantation. Therefore, it
is possible to develop functional assays to delineate gene functions
and tissue interactions which occur during limb development and
regeneration. We have modified the previous protocol [28, 33, 34]
and describe here a detailed procedure for the generation of aneurogenic larvae during embryonic development of the spotted salamander, Ambystoma maculatum.
Materials
2.1 Obtaining
and Maintenance
of Embryos
1. The embryos of spotted salamander (Ambystoma maculatum)

are available seasonally from January to March. The supplier is
Charles D. Sullivan & Co., Nashville, TN, USA. Parabiosis is
possible using embryos of other salamanders like axolotl and
Pleurodeles waltl (see Note 1).
2.2 Reagents
for Embryo Storage
and Manipulation
1. Solution A: Dissolve 34 g NaCl in 200 mL sterile water.

2. Solution B: Dissolve 1.0 g KCl in 200 mL sterile water.
3. Solution C: Dissolve 1.6 g Ca(No3)2. H2O in 200 mL sterile
water.
4. Solution D: Dissolve 4.1 g MgSo47H2O in 200 mL sterile
water.
5. Steinberg solution: Mix 20 mL solution A, 10 mL each of
solution B, C, and D 750 mL of deionized water. Add 0.56 g
Tris buffer and 1 mL of 50 mg/mL gentamicin sulfate. Adjust
the pH to 7.88.0 using 5 N NaOH. Make up the solution to
1 L, sterilize using a 0.45 m filter, and store at 4 C.
6. Autoclaved tap water: Autoclave filtered tap water available in
an amphibian facility and store at room temperature.
7. 1 % KOH solution: Dissolve 10 g KOH in 1 L of deionized
water and at room temperature.
8. Saturated potassium nitrate (KNO3) solution: Prepare 250 mL
of saturated solution of KNO3 in deionized water and store at
room temperature.
9. MS 222 (tricaine methanesulfonate): Prepare 0.02 % solution
of MS 222 in Steinberg solution and store at 4 C.
2.3 Microsurgery
Tools
1. Dumont #5 forceps, tungsten needle holder, and microspatula

with flat tip (e.g., Fine Science Tools, cat no. 10091-12)
(Fig. 1d).
150
Fig. 1 Equipment and tools required for microsurgical methods. (a) Custom-built power supply unit with a 4.5
and 9 V D.C. supply. (b) Electrodes with connecting leads. A custom-made electrode holder for multiple tungsten needles (right) and single electrode holder (left upper panel) and negative electrode with platinum wire for
immersion in the electrolyte solution (left, bottom panel). (c) Electrolysis setup. The platinum electrode is
immersed in the beaker containing saturated solution of potassium nitrate, and the terminal is connected to
0 V connector. The tungsten wire is held by the crocodile plug, and the end is connected to desired voltage
terminal. Supply of higher voltage results in faster electrolysis. The low voltage is desirable for fine sharpening
of the needles. (d) Microsurgery tools: tungsten electrode holder, spatula for reshaping the FIMO clay, tweezers, and sharpened tungsten needles in its storage container
2. FIMO soft modeling clay (Eberhard Faber, Germany) (see

Note 2).
3. Tungsten wires: thickness 0.20.5 mm, available from fine
metal suppliers in 10 cm length. Cut the tungsten wire to
2.5 cm length using a diamond cutter.
4. Benchtop power supply unit: a custom-made or commercially
available variable power supply unit with 4.5 and 9 V power
output terminals (Fig. 1a). Custom-fabricated terminal leads
with small crocodile plugs. One end of the negative terminal is
fitted with fine platinum electrode (see Note 3).
5. Small gas torch.
6. Plastic Pasteur pipettes with varying tip diameter. This can be
prepared by cutting the tip of a 3.5 mL Pasteur pipette to make
it wider and quickly fire polishing it under the flame using a gas
torch. This procedure will produce a smooth pipette which is
essential to prevent any damage to the embryo.
151
7. Agar Petri dishes: Weigh 2.5 g agar in a conical flask, add

100 mL deionized water, and heat in a microwave oven to
dissolve. Allow the solution to cool, and add 0.1 mL 50 mg/
mL solution of gentamicin sulfate. Pour the solution into
60 mm Petri dishes to fill about 2/3 of the dish. Allow the agar
to solidify at room temperature. Add 1 mL Steinberg solution
to each dish and store at 4 C.
8. Tungsten needles: Tungsten needles are prepared by electrolysis [35]. Connect the terminals to the benchtop power supply
unit. Place a 2.5 cm tungsten wire to the crocodile clip at the
9 V positive terminal. Fill a 100 mL glass beaker with 80 mL
saturated KNO3 solution, and immerse the platinum electrode
from the negative terminal in this solution. The terminal can
be affixed to the side of the beaker using blue tack or a tape.
Immerse the tip of the tungsten wire in the solution to etch the
tip of the wire. Use a constant vertical motion at the tip of the
wire to create a tapered end to the tungsten needle. This process takes about 1520 min, and the sharpness of the needle can
be examined under a microscope (see Note 4). Rinse the needles in deionized water and store in a box. Multiple needles can
be created simultaneously using a multi-pin holder (Fig. 1b).
Methods
3.1 Maintenance
of Embryos
1. A. maculatum lays the eggs in clutches and each clutch usually

holds about 100 embryos. Transfer each clutch of eggs into a
plastic container containing 1 L of autoclaved tap water. The
embryos can be stored at 1015 C in a cold cabinet for
12 weeks. Change the water every 45 days (see Note 5).
2. To release the embryos from a clutch, immerse a clutch of eggs
for 30 s in 1 % KOH solution (see Note 6).
3. Quickly transfer the clutch into another container with autoclaved tap water to remove the KOH solution.
4. Repeat step 3 two times to remove any remaining KOH.
5. Transfer the clutch of eggs into a 15 cm Petri dish.
6. Using a blunt-tipped forceps, carefully separate the egg mass
into 23 workable portions. Move the forceps between the
embryos so that the embryos are not punched. Each embryo is
encapsulated in a separate capsule.
7. Work through each small portion of the clutch to release individual embryo from the jelly. A pair of student quality #5 forceps is sufficient for this purpose.
8. Transfer embryos to another large Petri dish.
9. Release each embryo from its individual jelly capsule using a
pair of sharp #5 forceps (see Note 7).
152
10. Transfer the embryo to a well in a 24-well microplate containing

1 Steinberg solution. Keep only one embryo per well.
11. Repeat steps 9 and 10 and transfer the microplates to an incubator maintained at 1416 C. Change the Steinberg solution
every 34 days. Periodically check the embryos, and remove
any dead or abnormal embryos (see Note 8).
3.2 Parabiosis
of Embryos
The embryos between stages 24 and 26 are suitable for parabiosis

(Fig. 2a).
1. Place a pair of embryos of identical developmental stage in the
parabiosis chamber containing 1 Steinberg solution.
2. Using a sharp tungsten needle, remove a rectangular piece of
flank epithelium from each larva (Fig. 2a). Care should be
Fig. 2 A. maculatum embryos at various stages of development. (a) A stage 26

embryo suitable for parabiosis. The epidermis from the marked area on the flank
can be removed for parabiosis. (b) A pair at stage 3637 of development. Note
the complete fusion, along the flank area. The dotted line on the aneurogenic
larva (right) indicates the area lacking the neural tube (c) Parabiotic pair at late
stage of growth. The host larva is at stage 46, whereas the aneurogenic larva is
at stage 4344. The forelimb of the aneurogenic larva is at 2-digit stage (arrowed)
153
taken not to remove large areas of the epithelium which

will result in the collapse of the embryo and leakage of the yolk
(see Note 9).
3. Bring both the embryos together using a flat spatula, and
adjust the embryos so that the wound surfaces face each other.
4. Bring edges of the modeling clay using a spatula from both
sides of the clay chamber. This procedure will make the chamber narrow, resulting in stabilizing the embryos together at
their wound surface. The edges of the molding clay should
touch the embryos so as to prevent any ciliary movement of
the embryos.
5. Repeat the steps 14.
6. Leave the parabiosis chamber at room temperature (18 C)
overnight to allow the fusion of the pairs. The chamber can be
covered with a lid and placed in a plastic box with moistened
tissue to prevent evaporation of the medium.
7. Gently remove the edges of the clay from all the chambers and
carefully add more Steinberg solution to the wells in excess to
float the parabiotic pairs.
8. Transfer the parabiotic pairs to a 12-well multiplate chamber
containing 1 Steinberg solution.
9. Raise the parabiotic pairs at 1618 C. Change the medium
every 34 days.
10. Transfer the larvae to a 6-well multiplate for growth.
3.3 Aneurogenic
Larvae
Aneurogenic larvae are generated by removal of the entire neural

tube between stages 29 and 32. The neural tube is removed from
one of the parabiotic pairs (Fig. 2b). The microsurgery is also
possible in individual embryos. The surgical procedures are
performed under a stereo microscope.
1. Remove a rectangular piece of agar, slightly larger than the size
of a parabiotic pair from the middle of the Petri dish.
2. Pick a pair of embryos with a wide-mouth pipette and place in
agar plate. The embryos are immersed in the Steinberg solution during the procedure.
3. Using a tungsten needle, gently make a vertical incision at the
base of the brain to remove the epithelium (see Note 10).
4. Run the needle all the way toward the base of the tail to remove
the epithelium.
5. Removal of the epithelium exposes the neural tube which lies
in the grove, and the epithelium is visible under the microscope as a faint opaque line. Run the needle through the line
from the base of the brain to the last somite to remove the
neural tube (see Note 11).
154
6. Remove the parabiotic embryos and place them in fresh

Steinberg solution in a 6-well multi-dish. Return the embryos
to an incubator maintained at 7 C to complete wound healing
for 57 days (see Note 12).
7. Transfer the embryos to 1214 C for growth.
3.4 Maintenance
of Aneurogenic Larvae
The host larvae are able to feed on brine shrimp during larval
growth (Fig. 2c). The brine shrimps can cause contamination and
fungal infections in the larvae if left for longer periods. Therefore,
it is essential to change the Stenberg solution few hours after feeding. Change the multi-well plates every 45 days.
Notes
1. The rate of limb development varies among different amphibian taxa. The limb development from bud stage to digit stage
is very slow in axolotl larvae compared to A. maculatum.
Therefore, in aneurogenic axolotl larvae, reinnervation of the
limb is possible due to slow growth.
2. In our experience, the modeling clay from FIMO works well.
Other brands which we tested were non-malleable or leaches
color and appear to be toxic to the developing larvae. It is also
possible to make parabiosis chambers from agar, gelatine, or
Dow Corning 184 elastomer. However, these chambers are
not as flexible as FIMO clay to hold the embryos together.
This drawback can be ameliorated by making small bridging
plates made of the same components or thin glass cover slips.
3. The negative platinum electrode is immersed in the electrolyte.
Platinum helps to prevent corrosion and prolong the longevity
of the electrode.
4. The voltage can be reduced to 4.5 V to create a sharp needle
with 23 m tip diameter. It takes longer to produce a fine tip
with reduced voltage, but the low voltage gives better control
in shaping the needle.
5. Long-term storage of the embryos at lower temperature is not
recommended. The embryos develop deformity, and many
embryos in the inner mass of the clutch eventually perish. In
our experience, the length of storage also depends on the stage
of development. Early stage embryos (stage 1015) withstand
lower temperature (710 C), whereas preferred temperature
for late stage embryos is above 10 C. At this storage, developmental progression occurs in the embryos.
6. This step is critical; do not prolong incubation in the KOH
solution. The embryos will perish or deformity may occur during development. If the clutch of eggs contains late stage
155
embryos (stage 30 or above), immersion may not be necessary.

This also depends on the size of the clutch.
7. Removal of jelly capsule from the embryo requires practice and
training is necessary to develop these skills before embarking
on large-scale experiments. Early stage embryos are more difficult to handle. Late stage embryos get released from the capsule with relative ease. Embryos can also maintain individually
without the removal of the capsule. The embryos hatch from
the capsule at late stage of the development.
8. Usage of multi-well plates eliminates cross contamination and
easy stacking of plates in the incubator. Aeration is not necessary for the development of salamander embryos. Periodical
changes of the Steinberg solution is necessary to avoid fungal
(most common) and bacterial contamination. In our experience, gentamicin is better than penicillin-streptomycin. The
larval growth is dependent on the temperature, and for synchronized growth, an incubator is essential (e.g., cooled incubator manufactured by LMS Ltd., United Kingdom). The
incubator can be fitted with light and timer for photoperiodic
control (12L:12D).
9. This is the most critical step in fusion of the embryos. Smaller
rectangular window results in separation of the embryos at
later stages of development, whereas large epithelial wound
leads to leak of the yolk and collapse of the embryo. The sharpness of the tungsten tip is critical for creating a rectangular
wound, and the epithelium can be removed by a fine no. 5
forceps or using the tip of another tungsten needle. The
embryos should be kept under the culture medium throughout the procedure.
10. The epithelium is very thin, and usually the tissue sticks to the
tungsten needle. A pair of needles is ideal for this procedure, so
that one can be used to remove the tissue from the tip of the
other needle.
11. Use a pair of tungsten needles during this procedure. Use one
needle to cut open the tissue and the other to remove the tissue debris from the tip of the needle. Very sharp tungsten needles are required for this procedure. Periodical resharpening of
the needles is recommended. The needle for removing tissue
debris can be can be blunt ended to avoid causing any damage
to the embryo.
12. In our experience, storage of the aneurogenic embryos at a
lower temperature after the surgery considerably decreases the
mortality. About 65 % of embryos survive by adopting this
procedure. The temperature is later increased to 12 C for
growth of the larvae.
156
Acknowledgements
We thank Professor Jeremy Brockes for advice and support. Our
work is funded by a Program Grant and MRC Research
Professorship to Jeremy Brockes. JP Delgado is funded by
Programa-Sostenibilidad 20132014, University of Antioquia,
Colombia.
References
1. Brownell I, Guevara E, Bai CB, Loomis CA,
Joyner AL (2011) Nerve-derived sonic hedgehog defines a niche for hair follicle stem cells
capable of becoming epidermal stem cells. Cell
Stem Cell 8:552565
2. Takeo M, Chou WC, Sun Q, Lee W, Rabbani
P, Loomis C, Taketo MM, Ito M (2013) Wnt
activation in nail epithelium couples nail
growth to digit regeneration. Nature 499:
228232
3. Yamazaki S, Ema H, Karlsson G, Yamaguchi T,
Miyoshi H, Shioda S, Taketo MM, Karlsson S,
Iwama A, Nakauchi H (2011) Nonmyelinating
Schwann cells maintain hematopoietic stem
cell hibernation in the bone marrow niche.
Cell 147:11461158
4. Buckley G, Metcalfe AD, Ferguson MW
(2011) Peripheral nerve regeneration in the
MRL/MpJ ear wound model. J Anat 218:
163172
5. Buckley G, Wong J, Metcalfe AD, Ferguson
MW (2012) Denervation affects regenerative
responses in MRL/MpJ and repair in
C57BL/6 ear wounds. J Anat 220:312
6. Todd TJ (1823) On the process of reproduction of the members of the aquatic salamander.
Q J Sci Lit Arts 16:8496
7. Kumar A, Brockes JP (2012) Nerve dependence in tissue, organ, and appendage regeneration. Trends Neurosci 35:691699
8. Singer M (1952) The influence of the nerve
in regeneration of the amphibian extremity.
Q Rev Biol 27:169200
9. Stocum DL (2011) The role of peripheral
nerves in urodele limb regeneration. Eur J
Neurosci 34:908916
10. Brockes JP, Kumar A (2002) Plasticity and
reprogramming of differentiated cells in
amphibian regeneration. Nat Rev Mol Cell
Biol 3:566574
11. Simon A, Tanaka EM (2013) Limb regeneration. Wiley Interdiscip Rev Dev Biol 2:
291300
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.

Lentz TL (1967) Fine structure of nerves in
the regenerating limb of the newt Triturus.
Am J Anat 121:647669
Salpeter MM (1965) Disposition of nerve
fibers in the regenerating limb of the adult
newt, Triturus. J Morphol 117:201211
Singer M (1949) The invasion of the epidermis of the regenerating forelimb of the urodele, Triturus, by nerve fibers. J Exp Zool
111:189209
Brockes JP (1984) Mitogenic growth factors
and nerve dependence of limb regeneration.
Science 225:12801287
Singer M, Craven L (1948) The growth and
morphogenesis of the regenerating forelimb of
adult Triturus following denervation at various stages of development. J Exp Zool 108:
279308
Gordon H, Brockes JP (1988) Appearance
and regulation of an antigen associated with
limb regeneration in Notophthalmus viridescens. J Exp Zool 247:232243
Mescher AL (1976) Effects on adult newt limb
regeneration of partial and complete skin flaps
over the amputation surface. J Exp Zool 195:
117128
Singer M, Rzehak K, Maier CS (1967) The
relation between the caliber of the axon and
the trophic activity of nerves in limb regeneration. J Exp Zool 166:8997
Kumar A, Godwin JW, Gates PB, Garza-Garcia
AA, Brockes JP (2007) Molecular basis for the
nerve dependence of limb regeneration in an
adult vertebrate. Science 318:772777
Garza-Garcia A, Harris R, Esposito D, Gates
PB, Driscoll PC (2009) Solution structure and
phylogenetics of Prod1, a member of the
three-finger protein superfamily implicated in
salamander limb regeneration. PLoS One 4:
e7123

23. Garza-Garcia A, Driscoll PC, Brockes JP
(2010) Evidence for the local evolution of
mechanisms underlying limb regeneration in
salamanders. Integr Comp Biol 50:528535
24. Morais da Silva S, Gates PB, Brockes JP (2002)
The newt ortholog of CD59 is implicated in
proximodistal identity during amphibian limb
regeneration. Dev Cell 3:547555
25. Kumar A, Gates PB, Brockes JP (2007)
Positional identity of adult stem cells in salamander limb regeneration. C R Biol 330:
485490
26. Galis F, Wagner GP, Jockusch EL (2003) Why
is limb regeneration possible in amphibians
but not in reptiles, birds, and mammals? Evol
Dev 5:208220
27. Harrison RG (1907) Experiments in transplanting limbs and their bearing upon the
problems of the development of nerves. J Exp
Zool 4:239281
28. Fekete DM, Brockes JP (1988) Evidence
that the nerve controls molecular identity
of progenitor cells for limb regeneration.
157
29. Yntema CL (1959) Blastema formation in

sparsely innervated and aneurogenic forelimbs
of ambystoma larvae. J Exp Zool 142:423439
30. Tassava RA, Olsen-Winner CL (2003)
Responses to amputation of denervated
ambystoma limbs containing aneurogenic limb
grafts. J Exp Zool 297:6479
31. Thornton CS, Thornton MT (1970)
Recuperation of regeneration in denervated
limbs of ambystoma larvae. J Exp Zool 173:
293301
32. Kumar A, Delgado JP, Gates PB, Neville G,
Forge A, Brockes JP (2011) The aneurogenic
limb identifies developmental cell interactions
underlying vertebrate limb regeneration. Proc
33. Hamburger VA (1966) A manual of experimental embryology. University of Chicago
Press, Chicago, IL
34. Johnson LG (2001) Patterns & experiments in
developmental biology. McGraw Hill, London
35. Hubel DH (1957) Tungsten Microelectrode
for recording from single units. Science 125:
549550
Chapter 13
In Vivo Modulation and Quantification of microRNAs
During Axolotl Tail Regeneration
Abstract
The ability to regenerate diseased, injured, or missing complex tissue is widespread throughout lower
vertebrates and invertebrates; however, our knowledge of the molecular mechanisms that regulate this
amazing ability is still in its infancy. Many recent papers have shown important roles for microRNAs in
regulating regeneration in a number of species. The ability to detect and quantify miRNA expression fluctuations at a single cell level in vivo in different cell types during processes like regeneration is very informative. In this chapter, we describe how to use a dual-fluorescent green fluorescent protein (GFP)-reporter/
monomeric red fluorescent protein (mRFP)-sensor (DFRS) plasmid to quantitate the dynamics of specific
miRNAs over time following miRNA mimic injection as well as during regeneration. In this bicistronic
vector, the mRFP allows for verification of miRNA expression, while the GFP functions as an internal
control to normalize miRNA expression and thus obtain quantitative results. In addition, we demonstrate
how this technique revealed dynamic miR-23a expression and function during tail regeneration.
Key words microRNAs, Axolotl, Sensor plasmids
Introduction
The ability to regenerate multiple body parts is a fascinating phenomenon that remains poorly understood at a molecular level [1
12]. While model systems like axolotls are desirable since they can
regenerate these tissues, lack of a full axolotl genome sequence
hinders classical genetic studies. Recent studies have shown that
small noncoding microRNAs (miRNAs) are highly conserved and
may play an important role in regulating gene expression after
injury in many species including axolotls [1319].
miRNAs are small noncoding RNAs that are approximately 22
nucleotides long [2022]. The major function of miRNAs is posttranscriptional regulation of gene expression. The canonical mechanism of action for miRNAs is to bind to a region of complementary
sequence in the 3 untranslated region (UTR) of the target
messenger RNA (mRNA). The binding of the miRNA to its target
159
160
Fig. 1 Schematic of DFRS plasmid. This dual miRNA reporter construct can be
used to analyze and quantify expression of endogenous miRNAs and to quantitatively evaluate the effect of modulators of microRNAs, like inhibitors or mimics.
The DFRS plasmid contains both GFP (control) and mRFP (reporter), each under
the control of their own SV40 promoter. Following the open read frame of mRFP
is a multiple cloning site (MCS) to allow addition of seed sequences for an miRNA
of interest
mRNA often leads to message degradation [23]. miRNAs play an

essential role in regeneration [19, 2426], yet dynamics of miRNA
expression during regeneration remains to be delineated. One tool
that allows us to explore temporal fluctuation of specific miRNAs
in a tissue of interest is the dual-fluorescent green fluorescent protein (GFP)-reporter/monomeric red fluorescent protein (mRFP)sensor (DFRS) plasmid (Fig. 1) [27, 28]. In addition to normal
bacterial expression components, the DFRS plasmid is a bicistronic
GFP (reporter) and mRFP (sensor) transiently expressed under the
control of two independent SV40 promoters. Sequences that are
complementary to an miRNA of interest can be cloned into the
3UTR of mRFP in the DFRS plasmid using a variety of restriction
enzymes for digestion followed by ligation [21].
Using microinjection and electroporation, the DFRS plasmid
can be injected into a tissue of interest. The expression of the
DFRS plasmid will not only confirm miRNA mimic uptake into a
specific cell but will also allow observation of changes in expression
levels of miRNA in a single cell in vivo. By live animal imaging, the
amount of mRFP can be normalized to GFP, with the changes in
mRFP negatively correlate with activity of the given miRNA, such
161
that the relative decrease in mRFP expression correlates with

increased miRNA expression in that cell. This can be used to model
temporal changes in expression of an miRNA of interest as regeneration progresses as well as spatial changes as miRNA expression
fluctuates relative to the regenerating tissue.
Materials
1. Fluorescent dissecting scope.
2. Pressure injector.
3. Micromanipulator.
4. Electroporator.
5. Electrodes.
6. Needle puller.
7. Axolotls.
8. miRNA DFRS plasmids.
9. miRNA mimic.
10. Anesthesia (0.01 % p-aminobenzene).
11. Fast Green.
12. Glass capillaries.
13. Sylgard-dissecting pad.
14. Insect pins.
15. Microloader pipette tips.
16. 1 PBS.
17. Tweezers.
18. Image J.
Methods
3.1 Preparation
of Plasmid Solution
for Injection
1. To prepare the plasmid solution for injection, dilute the dualfluorescent green fluorescent protein (GFP)-reporter/monomeric red fluorescent protein (mRFP)-sensor (DFRS) plasmid
to a final concentration of 0.5 g/L with 0.2 mg/mL Fast
Green and 1 phosphate buffered saline (PBS) (see Note 1).
3.2 Preparation
of Needles
1. Pull glass capillaries to form injection needles (see Note 2).

Following a ramp test, place a glass capillary into the needle
puller and input the following settings: Heat (Ramp value + 10),
Pull 60, Velocity 60, Time 250, and Pressure 500.
2. Load 24 L of plasmid solution from Subheading 3.1 into the
injection needle using a pipette with a microloader tip.
162
3. Insert and secure the loaded injection needle into the pressure
injector nozzle attached to the micromanipulator.
4. To open the needle, very gently break the very tip using a forceps. To ensure the needle is open, press the injection pedal to
observe release of the plasmid solution.
3.3 Injection
and Electroporation
of Animals
1. Set the pressure injector to 20 psi ejection pressure and 100 ms

timed ejection.
2. Place axolotls into anesthesia (see Note 3).
3. Once the axolotl is motionless and unresponsive to touch,
place the axolotl on a Sylgard-dissecting pad and stabilize the
axolotl by pinning the fin down with four insect pins. Assure
the axolotl remains moist by adding a drop of the anesthetic on
the axolotls head.
4. Visualize the target tissue using a dissecting microscope.
5. Using the micromanipulator, insert the injection needle into
the tissue of interest, such as muscle or spinal cord, and press
the injection pedal to release the plasmid solution (see Note 4).
6. While the axolotl is still pinned on the Sylgard-dissecting pad,
cover the axolotl with 1 PBS. Place the electrodes on either
side of the tail ensuring that either electrode is not in direct
contact with tissue.
7. Electroporate the axolotl with 5 pulses of 50 V, 50 ms each
(see Note 5).
8. Remove the insect pins and return the axolotl to water
( see Note 6).
3.4
Tail Amputation
1. Place axolotls into anesthesia (see Note 7).

2. Once the axolotl is motionless, place the axolotl in a petri dish
under a fluorescent dissecting microscope.
3. Visualize the DFRS plasmid-expressing cells by GFP expression. Align a scalpel immediately posterior to GFP-expressing
cells. Amputate the tail using a scalpel.
4. Image the axolotl about the amputation, and return to water.
5. Image the axolotl at desired time points during regeneration.
Be sure to use the same exposure time as well as other microscope settings as the first imaged time point (see Note 8).
3.5
Mimic Injection
1. Prepare the mimic solution so the final concentration of the

miRNA mimic is 10 M with 0.2 mg/mL Fast Green and 1
PBS (see Notes 911).
2. Load a new injection needle with 24 L of mimic solution
using a pipette with a microloader tip. Insert and secure the
needle into the pressure injector nozzle attached to the
163
micromanipulator. To open the needle, very gently break the

very tip using a forceps. To ensure the needle is open, press the
injection pedal to observe release of the plasmid solution.
3. Place axolotls into anesthesia.
4. Once the axolotl is motionless and unresponsive to touch,
place the axolotl on a Sylgard-dissecting pad and stabilize the
axolotl by pinning the fin down with four insect pins. Assure
the axolotl remains moist by adding a drop of the anesthetic on
the axolotls head.
5. Place the Sylgard-dissecting pad under a fluorescent dissecting
scope. Visualize the DFRS plasmid-expressing cells by GFP
expression, and adjust the position of the needle to inject
immediately adjacent to the DFRS plasmid-expressing cells as
to not damage the cell by puncture.
6. Release the mimic solution by pressing the pedal of the injector using the settings in Subheading 3.1 (see Note 12).
7. Cover the axolotl in 1 PBS and electroporate as in
Subheading 3.3.
8. Remove the pins and image the injected area of the axolotl
(Fig. 3a).
9. Return the axolotl to water.
10. Image the axolotl at desired time points (see Note 13).
3.6
Quantification
1. Open RFP and GFP channel images in separate windows in

image J (or similar program).
2. Synchronize windows by going to Analyze Tools
Synchronize Windows Synchronize All.
3. Select the freehand selection tool and trace the outline of the
DFRS plasmid-expressing cell.
4. Measure the fluorescence intensity of the GFP window by
going to Analyze Measure. Be sure the measurement output
contains Area, Integrated Density, and Mean. Repeat
the measurement on the RFP window (see Note 14).
5. Once each DFRS plasmid-expressing cell is measured, select a
region that has no fluorescence and measure the region from
each window. This will serve as a background.
6. Copy and paste the Image J results window into an excel worksheet (or similar program) for further analysis.
7. Calculate the corrected total cell fluorescence (CTCF) for both
RFP and GFP channels:
CTCF = Integrated Density (Area of selected cell Mean of background).
164
Fig. 2 Quantifying miR-23a dynamics in single cells during tail regeneration. (a) Control GFP expression (green)
and reporter mRFP expression (red) shown at 0, 24, 48, and 96 hour post amputation (hpa). Arrowheads indicate examples of cells that are expressing the DFRS plasmid and are used for quantification. Scale bar is
200 m. (b) Graphical representation of mRFP expression modulated by miR-23a in the spinal cord during
regeneration. mRFP expression is dynamic during the regenerative process, revealing that miR-23a expression is increased at 24 and 96 hpa, while miR-23a levels at 48 hpa are similar to steady state levels of miR23a (***P < 0.001, NS not significant)
Fig. 3 Determining the effect of microRNA mimic injection using miR-141a sensor. (a) Control GFP expression
(green) and reporter mRFP expression (red) shown at 0, 24, 48, and 96 hour post mimic injection (hpi).
Arrowheads indicate examples of cells that are expressing the DFRS plasmid and are used for quantification.
Scale bar is 200 m. (b) Graphical representation of mRFP expression modulated by miR-141a in the spinal
cord following mimic injection. Overall there is a general decrease in the amount of mRFP expression until
96 hpi, indicating that most DFRS plasmid-expressing cells also took up and processed injected miR-141
mimics (***P < 0.001, **P < 0.01, NS not significant)
8. Normalize expression levels by dividing the RFP CTCF by the

GFP CTCF.
9. Use the normalized RFP values to produce a graph (Figs. 2b
and 3b).
165
Notes
1. Adding Fast Green will allow visualization of the injection
under visible light and is an ideal way to localize injections to
the correct tissue site.
2. Needles can also be pulled manually or pre-pulled needles can
be ordered.
3. Animals used here are 23 cm in length, injection volumes and
electroporation conditions may need to be varied depending on
the size of animals used. For further details on how microinjection and electroporation are performed, refer to refs. 29 and 30.
4. The injection is successful if the Fast Green color can be visualized in the tissue of interest. If not, adjust the injection needle
using the micromanipulator and reinject.
5. The orientation of the electric field can be used to direct plasmid uptake to specific regions, or the electrodes can be inverted
and the axolotl can be electroporated a second time for bidirectional plasmid uptake [29, 30].
6. Fluorescence of mRFP and GFP can be visualized within 24 h
and can confirm a successful injection.
7. After visualization of mRFP and GFP, the tail can be amputated adjacent to the DFRS-expressing cells to examine the
expression patterns of the miRNA of interest (Fig. 2a).
8. If the expression of the miRNA of interest increases during the
regenerative process, a decrease in mRFP expression relative to
GFP will be observed (Fig. 2a, b).
9. Here we have demonstrated the effect of a mimic on microRNA
levels, and this same technique can also be used to assay the
quantitative effect of microRNA inhibitors in vivo.
10. For each individual microRNA mimic or inhibitor, the optimum concentration must be determined by testing different
concentrations.
11. After visualization of mRFP and GFP, an miRNA mimic can be
injected and targeted to the DFRS-expressing cells.
12. If Fast Green color appears in the desired location, remove the
needle. If the injection was not administered in the correct
location, adjust the position of the injection using the
micromanipulator and reinject.
13. Be sure to use the same exposure time as well as other microscope
settings as the first imaged time point. We have found that a significant decrease in relative mRFP fluorescence can be observed at
24 h after mimic injection. If the injected mimic is targeting the
binding site at the 3 UTR of mRFP, a decrease in the mRFP
expression relative to GFP can be observed (Fig. 3a, b).
14. Synchronizing the windows will allow the same area to be
measured in each channel.
166
Acknowledgements
We thank Davide De Pietri Tonelli and Antonio Giraldez for the
kind gift of the DFRS plasmids.
The authors are grateful for support from the Stem Cell
Training Grant (T32 HD060536 04) for this project as well as
funding from the Department of Genetics, Cell Biology and
Development at the University of Minnesota.
References
1. Kumar A, Brockes JP (2012) Nerve dependence in tissue, organ, and appendage regeneration. Trends Neurosci 35:691699
14. Yin VP, Poss KD (2008) New regulators of

vertebrate appendage regeneration. Curr Opin
Genet Dev 18:381386

Dev Biol 24:525549
15. Yi R, Fuchs E (2012) A miR image of stem

cells and their lineages. Curr Top Dev Biol
99:175199
3. Brockes JP, Kumar A (2005) Appendage

regeneration in adult vertebrates and implications for regenerative medicine. Science
310:19191923
16. Nakamura K, Maki N, Trinh A, Trask HW,

Gui J, Tomlinson CR, Tsonis PA (2010) miRNAs in newt lens regeneration: specific control
of proliferation and evidence for miRNA networking.
PLoS
One
5(8):e12058.
doi:10.1371/journal.pone.0012058
4. Tanaka EM, Reddien PW (2011) The cellular

basis for animal regeneration. Dev Cell 21(1):
172185
5. Tanaka EM (2003) Regeneration: if they can
do it, why cant we? Cell 113:559562
6. Elliott SA, Sanchez Alvarado A (2013) The
history and enduring contributions of planarians to the study of animal regeneration. Wiley
Interdiscip Rev Dev Biol 2:301326
7. Sanchez Alvarado A, Tsonis PA (2006)
Bridging the regeneration gap: genetic insights
from diverse animal models. Nat Rev Genet
7:873884
8. Gemberling M, Bailey TJ, Hyde DR, Poss KD
(2013) The zebrafish as a model for complex
tissue regeneration. Trends Genet 29:
611620
9. Poss KD (2010) Advances in understanding
tissue regenerative capacity and mechanisms in
animals. Nat Rev Genet 11:710722
10. Reddien PW, Sanchez Alvarado A (2004)
Fundamentals of planarian regeneration. Annu
Rev Cell Dev Biol 20:725757
11. Reddien PW (2013) Specialized progenitors
and regeneration. Development 140:951957
12. Bryant SV, Endo T, Gardiner DM (2002)
Vertebrate limb regeneration and the origin of
limb stem cells. Int J Dev Biol 46:887896
13. Wang J, Martin JF (2014) Macro advances in
microRNAs and myocardial regeneration.
Curr Opin Cardiol 29:207213
17. Diaz Quiroz JF, Tsai E, Coyle M, Sehm T,

Echeverri K (2014) Precise control of miR125b levels is required to create a regenerationpermissive environment after spinal cord injury:
a cross-species comparison between salamander
and rat. Dis Model Mech 7:601611
18. Thatcher EJ, Patton JG (2010) Small RNAs
have a big impact on regeneration. RNA Biol
7:333338
19. Sehm T, Sachse C, Frenzel C, Echeverri K
(2009) miR-196 is an essential early-stage
regulator of tail regeneration, upstream of key
spinal cord patterning events. Dev Biol 334:
468480
20. Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116:
281297
21. Aravin A, Tuschl T (2005) Identification and
characterization of small RNAs involved in
RNA silencing. FEBS Lett 579:58305840
22. Bartel DP (2009) MicroRNAs: target recognition
and regulatory functions. Cell 136:215233
23. Cai Y, Yu X, Hu S, Yu J (2009) A brief review on
the mechanisms of miRNA regulation. Genomics
Proteomics Bioinformatics 7:147154
24. Yin VP, Thomson JM, Thummel R, Hyde DR,
Hammond SM, Poss KD (2008) Fgf-dependent
depletion of microRNA-133 promotes
appendage regeneration in zebrafish. Genes
Dev 22:728733

25. Eulalio A, Mano M, Dal Ferro M, Zentilin L,
Sinagra G, Zacchigna S, Giacca M (2012)
Functional screening identifies miRNAs
inducing cardiac regeneration. Nature 492:
376381
26. Gonzalez-Estevez C, Arseni V, Thambyrajah
RS, Felix DA, Aboobaker AA (2009) Diverse
miRNA spatial expression patterns suggest
important roles in homeostasis and regeneration in planarians. Int J Dev Biol 53:493505
27. De Pietri Tonelli D, Calegari F, Fei JF, Nomura
T, Osumi N, Heisenberg CP, Huttner WB
(2006) Single-cell detection of microRNAs in
developing vertebrate embryos after acute
administration of a dual-fluorescence reporter/
sensor plasmid. Biotechniques 41:727732
167
28. Mishima Y, Abreu-Goodger C, Staton AA,

Stahlhut C, Shou C, Cheng C, Gerstein M,
Enright AJ, Giraldez AJ (2009) Zebrafish
miR-1 and miR-133 shape muscle gene expression and regulate sarcomeric actin organization. Genes Dev 23:619632
29. Diaz Quiroz JF, Echeverri K (2012) In vivo
modulation of microRNA levels during spinal
cord regeneration. In: Michael Conn P (ed)
Laboratory methods in cell biology: biochemistry and cell culture, vol 112. Elsevier,
Amsterdam, pp 235246
30. Echeverri
K,
Tanaka
EM
(2003)
Electroporation as a tool to study in vivo spinal cord regeneration. Dev Dyn 226:
418425
Part III
Salamander Cells in Culture
Chapter 14
Derivation and Long-Term Culture of Cells
from Newt Adult Limbs and Limb Blastemas
Abstract
Notwithstanding the key importance of in vivo models for understanding patterning and cellular
interactions in the regenerating tailed amphibian (salamander) limb, dissection of molecular mechanisms,
as in other species, can be greatly aided by robust in vitro models. This chapter focuses on derivation and
maintenance of cell lines from adult post-metamorphic salamanders and in particular cells derived from
normal and regenerating limbs. We also describe a protocol for nucleofecting newt cells that can be used
both to investigate the gene function in short-term studies and to establish stable cell lines.
Key words Axolotl, Blastema, Cell culture, Limb, Nucleofection, Regeneration, Transfection,
Salamander
Introduction
Cultures of mesenchymal cells from the late-bud stage blastemas
of 915-month-old axolotls were used by Boilly and Albert [1],
but they were not established as lines available to the scientific
community.
Long-term cultures of cells derived either from limb blastemas
or normal limbs from adult urodeles (tailed amphibian) with the
ability to undergo myogenic differentiation were first established
in 1988 [2]. The cell lines derived from the newt, Notophthalmus
viridescens, that have been more extensively used are a limb blastema cell line, originally named as BlH1 (blastema hind limb 1)
and more recently called B1H1, and two lines from normal hind
limbs derived either from ankle (A1) or thigh (TH4B) tissue [3, 4].
Both cell lines derived from normal limbs and limb blastemas
contain thin, well-spread, and large cells as well as smaller, thicker,
and often bipolar cells (Fig. 1a, b). All cells present in these cultures are much larger than mammalian cells, with nuclei up to
50 m in diameter. They have an average duplication time of
2 days, which can vary depending on the line and culture
171
172
Fig. 1 Newt cells cultured from normal limb and limb blastema maintained either at low/medium density (ac)
or at high density to induce myogenic differentiation (e, f ) express blastemal (c, d) and muscle markers (f),
respectively. (a, b) Live images of BlH1 and TH4 cells. (c, d) Newt cells stained for blastemal markers, 22/18
(c) and K8 (d). (e) Histological staining of cells grown at high density; some myotubes are indicated by arrowheads. (f) Myotube stained with the muscle marker, 12/101
conditions (e.g., batch of fetal calf serum). A correlation between

the larger size of newt cells and their relatively slow cell cycling
time, as compared to mammalian cells, and the size of the newt
genome (estimated to be up to tenfold larger than that of mammals) has been suggested [5].
Attempts at cloning the newt cell lines were not successful as,
at a clonal density, these cells would survive for a long time but
not divide. In contrast, satellite cells derived from cultured isolated myotubes could be expanded at clonal density [6]. It is not
known at this stage whether the culture conditions used to grow
satellite cell clones would allow one to obtain also clonal BlH1,
Derivation and Long-Term Culture of Cells from Newt Adult Limbs
173
A1, or TH4B cell lines. Nonetheless, although the established

newt cell lines have not been cloned, they appear to be relatively
homogeneous, as indicated by markers of hypomethylation,
immunoreactivity profile, and differentiation potential [2, 7, 8]. All
the newt lines generated express regeneration-associated molecules
such as the protein detected by the 22/18 monoclonal antibody
and keratins 8 and 18 [2, 7] (Fig. 1c, d). These proteins are downregulated in limb and blastemal cultures following differentiation
into muscle, mimicking their regulation in vivo. These cell lines,
though untransformed, have shown no sign of senescence in longterm cultures. In this respect, their behavior is similar to those of
newt cells derived from the iris pigment epithelium that can also
be expanded long-term [9, 10]. In contrast, cells derived from
adult newt heart and liver were found to have a relatively short life
in culture [2, 11]. Newt cells undergo myogenic differentiation
(Fig. 1e, f) when grown at high density [12]. However, cells with
self-renewing capability are always recovered upon passaging even
after being left for prolonged periods at high density, consistent
with the ability of newt muscle to dedifferentiate. This is not the
case when mammalian satellite cells or myoblasts are allowed to
grow at high density and undergo terminal differentiation, which
results in the loss of the progenitor cell population. Furthermore,
newt cells that have undergone myogenic differentiation can reenter the cell cycle upon serum stimulation [13, 14]. The newt cell
lines have been extensively used to study responses to retinoids
and growth factors [3, 4, 15, 16], cell differentiation and dedifferentiation [12, 13, 17, 18], and molecular mechanisms underlying
patterning [3, 4, 19, 20]. In addition, A1 cells have been used to
generate hybrid myotubes by fusing them with a mouse myoblast
cell line [21].
When starting to culture amphibian, and in general nonmammalian vertebrate cells, it is important to keep in mind that these are
cold-blooded animals. Therefore, their cells need to be cultured at
a lower temperature (2426 C) than their mammalian counterparts. It is also important to be aware of the fact that the osmolarity
of the amphibian blood is lower than that of mammalian blood
(approximately 225250 mOsm depending on the species) [2, 22];
hence, culture media require dilution to match the osmolarity of
the blood. When media utilizing a sodium bicarbonate buffer are
used, the percentage of CO2 in the tissue culture incubator needs to
be 2 % to maintain the pH at 7.47.6. The newt cells do not attach
to glass or plastic cell cultureware. Their adhesive properties also
differ from those of axolotl mesenchymal cells derived from skin
that can attach to the plastic in the absence of a substrate [23].
Newt cells can grow both on collagen and gelatine. Gelatine, however, has become the preferred method as it provides a cheaper and
more convenient alternative to collagen [2, 4].
174
Fig. 2 A1 and BlH1 newt cells nucleofected with either RFP (a) or GFP (b) constructs. Note that the high levels
of expression of the nucleofected gene are observed in both cell lines
This chapter describes how to establish cell lines from newt

blastemas and normal limbs and to maintain them as long-term
cultures. It is challenging to introduce plasmid DNA into newt
cells efficiently using lipid-based transfection reagents. Here we
describe a protocol for nucleofecting newt cells (Fig. 2) that can
be used both to investigate the function of a transfected gene in
short-term studies and to establish stable cell lines expressing
genes of interest or markers genes for cell tracking after cell grafting in vivo [20, 24].
Materials
Here we indicate the materials required and the sources we use,
but unless otherwise specified, equivalent reagents obtained from
other suppliers will work as well. Tissue culture flasks from Corning,
Nunc, or BD Falcon have all proven suitable for culturing newt
cells (plastic from other sources has given variable results).
2.1 Sources
of Adult Newts
Suppliers of adult newts can be purchased from Charles D. Sullivan &

Co., USA, NASCO Biology, USA, or Connecticut Valley Biological
Supply Company, USA. Newts may also be obtained from local
suppliers. Follow the national and institutional guidelines for the
import and use of animals for laboratory research.
2.2 Surgical Tools,

Anesthetics,
and Reagents
for Limbs and Limb
Blastema Harvest
All the surgical instruments are sterilized by autoclaving, by using

a glass bead sterilizer, or by flaming after dipping the tip of the
instrument in 80 % alcohol.
1. Dumont #5 forceps.
2. Surgical scissors.
175
3. 12 cm spring scissors.
4. Bone cutter.
5. Dissection board.
6. Sterile water: Aliquot commercially available HPLC grade
water in 250 mL bottles and autoclave. Store at room temperature (see Note 1).
7. Sterile glass Pasteur pipettes.
8. Sterile Petri dishes and 50 mL tubes.
9. Sodium hypochlorite solution: Prepare 1 % sodium hypochlorite solution in sterile water and adjust the pH to 8.8 with
1 N HCL.
10. Tricaine (ethyl 3-aminobenzoate methanesulfonate) (MS222): Prepare a 0.1 % solution using filtered water available in
the amphibian facility. Adjust the pH between 7.2 and 7.5
using 1 N NaOH. Prepare fresh before use.
11. Recovery solution for newts: Dissolve 10 g sulfamerazine
(Sigma, Cat. no. S0800) in 2 L of filtered water available in an
amphibian facility. Add 0.1 mL analgesic solution (Alvegesic
Vet, stock 10 mg/mL) and adjust the pH between 7 and 7.5
with 5 N NaOH.
2.3 Reagents
and Equipment
for Newt Cell Isolation
and Maintenance
Preparation of tissue culture solution and media and handling of

cells are carried out under sterile conditions in a class II biological
safety cabinet swiped with 70 % ethanol and turned on at least
15 min before starting the procedure. Use tissue culture grade
plastic and sterile glassware for all reagent preparation.
1. Sterile water (see Subheading 2.2, item 6).
2. Amphibian phosphate buffered saline (APBS). Add 25 mL of
sterile water to 100 mL of sterile tissue culture grade PBS. This
is to adjust the osmolarity of the medium to a level comparable
to that of amphibian blood (225 mosmol 5). Store at room
temperature.
3. Ca2+/Mg2+-free amphibian phosphate buffered saline (Ca2+/
Mg2+-free APBS). Use the procedure described in item 2, substituting Ca2+/Mg2+-free PBS to standard PBS.
4. 100 penicillin/streptomycin (10,000 units/mL of penicillin
and 10,000 g/mL of streptomycin): Defrost the stock solution and aliquot as convenient (e.g., 2 mL aliquots if routinely
preparing 200 mL of culture medium). Store at 20 C.
5. 1,000 gentamicin stock solution (35 mg/mL): Dissolve
350 mg of gentamicin sulfate salt in 10 mL of sterile water.
Filter-sterilize the solution using a 0.2 m syringe filter. Store
as 100 or 500 L aliquots at 20 C.
176
6. 100 glutamine stock solution (200 mM): Aliquot the stock

solution (e.g., 2 mL aliquots if routinely preparing 200 mL of
culture medium) and store at 20 C.
7. 100 insulin stock solution (0.5 mg/mL stock): Weigh 50 mg
insulin in a beaker and dissolve it by adding 50 mL of 0.1 M
HCl (1 mg/mL). Make up the solution to 100 mL with Ca2+/
Mg2+-free APBS to avoid precipitation. Sterilize the solution
by filtering it through a 0.2 m filter, aliquot (e.g., 2 mL aliquots if routinely preparing 200 mL of culture medium), and
store at 20 C.
8. Fetal calf serum (FCS): Defrost the stock bottle and place it in
a water bath at 56 C for 30 min to inactivate the complement.
Cool the bottle to room temperature, aliquot (e.g., 20 mL aliquots if routinely preparing 200 mL medium), and store at
20 C. There is great variability in the ability of FSC batches
to support newt cell growth. Hence, batch testing to select the
FCS is needed (see Note 2).
9. Amphibian minimum essential medium (AMEM; for growth
in a CO2 incubator): Dispense 130 mL minimum essential
medium (1 MEM), 20 mL of FCS, 2 mL of penicillin/streptomycin, 2 mL of glutamine, and 2 mL of insulin in a sterile
bottle (e.g., 75 cm2 tissue culture flask; sterile glass bottle with
a phenolic cap). Bring the volume up to 200 mL with sterile
water. This dilution gives amphibian cell culture medium of
the appropriate osmolarity (see Note 3).
10. Dissection medium: Dispense 65 mL of L-15, 1 mL of penicillin/streptomycin, and 100 L of gentamicin in a sterile bottle.
Bring the volume up to 100 mL with sterile water (see Notes 4
and 5).
11. Gelatine solution (0.75 %): Weigh 3.75 g of gelatine and add
it to 500 mL of sterile water pre-warmed in a glass bottle at
65 C in a water bath. Allow the gelatine to dissolve slowly at
65 C in a shaking water bath or by shaking the bottle manually from time to time. As soon as the gelatine has solubilized,
filter it while warm using a 0.45 m filter flask. Dispense 50 mL
aliquots (e.g., Falcon tubes) and store at 4 C.
12. Collagen (5 mg/mL). Collagen can be purchased already in
solution for convenience (First Link, Cat. no. 60-35-807,
replacing Vitrogen originally used). Store at 4 C in 510 mL
aliquots to reduce the possibility of contamination.
13. Gelatine-coated culture flasks/dishes: Warm the gelatine solution at 37 C in a water bath to liquefy. Pipette the gelatine
solution into the tissue culture flask or dish to be coated, and
swirl it to spread the gelatine evenly. Remove excess gelatine
solution and use it to coat the next flask/dish if required. As an
177
indication, 510 mL of gelatine solution can be used to coat

several 75 cm2 flasks. The gelatine-coated flasks/Petri dishes
can be used immediately without drying.
14. Collagen-coated culture flasks/dishes: Pipette the collagen
solution and coat as for gelatine coating (item 13). Dry the
collagen-coated dishes in a tissue culture cabinet (overnight is
usually sufficient). The collagen-coated dishes can be stored
wrapped in cling film for at least 2 weeks at 4 C.
15. Trypsin stock solution (2.5 %) for cell passaging (Invitrogen,
Cat. no. 15090-046). Aliquot the stock solution in 2 mL and
store at 20 C.
16. Trypsin working solution for cell culture (0.25 %): To prepare
the working solution, thaw a 2 mL aliquot and bring the volume up to 20 mL with Ca2+/Mg2+-free APBS. The solution
can be stored at 4 C for approximately 1 week.
17. Trypsin working solution for cell dissociation (0.05 %): To prepare the working solution, dilute the stock solution (item 15)
to 1:50 with Ca2+/Mg2+-free Pucks saline (original protocol)
or Ca2+/Mg2+-free APBS.
18. EDTA solution: Prepare 0.1 % EDTA in Ca2+/Mg2+-free APBS.
19. Sterilizing filters (syringe filters and filter flask; 0.2 m/0.45 m).
20. Cell strainer or nylon mesh (100 m size).
21. Freezing medium: Dispense 5 mL of dimethyl sulfoxide
(DMSO; sterile-filtered DMSO supplied in 5 mL vials is convenient; Sigma, Cat. no. D2650) into a 50 mL sterile tube
(e.g., Falcon tube). Bring the volume up to 50 mL with
AMEM and mix well. Store as 5 mL aliquots in sterile tubes at
20 C. The freezing medium can be stored for several months.
22. 1 C freezing container (Nalgene, Cat. no. 5100-0001); alternatively a cardboard or plastic box for microtube storage with
bottom and lid lined with cotton wool can be used.
23. Cryogenic vials.
24. Amphibian cell culture incubator: Set the incubator for
amphibian cell cultures at 25 C and 2 % CO2. The incubator
is humidified with sterile water containing copper sulfate (e.g.,
one teaspoonful of copper sulfate). Ideally, a CO2 incubator
with a cooling unit should be used to ensure a stable temperature and avoid any risk of overheating. If a standard incubator
is used, the tissue culture room needs to be maintained at
20 C. Amphibian cells can also be cultured in L-15 medium
that does not require maintaining the cells in a CO2 incubator.
However, for long-term cultures, a CO2 incubator is
preferable.
178
2.4 Equipment
and Reagents
for Nucleofection
of Newt Cells
1. Lonza Nucleofector 2b Device (basic model).

2. Ingenio 0.2 cm cuvettes (Cat. no. 50121).
3. Cell Line electroporation kit V (Lonza, Cat. no. VCA-1003)
or Ingenio electroporation solution (Mirus Bio LLC).
4. Fine-tip disposable pipettes.
5. Plasmid DNA.
6. 50 mL centrifuge tubes.
Methods
3.1 Newt Limb

Regeneration
Blastemas
1. Anesthetize the newts in tricaine solution for 710 min (2030

blastemas are usually sufficient for establishing blastemal
cultures).
2. Amputate the forelimb (amputation can be unilateral or bilateral depending on your animal license) at mid-humerus level
using 12 cm surgical spring scissors.
3. Gently pull the stump tissue slightly back with forceps to
expose the bone stump and trim the protruding bone with a
bone cutter or strong scissors. Bone protruding from the
stump will hamper wound healing and regeneration.
4. Trim the stump soft tissues to obtain a neatly cut surface using
a 12 cm spring scissors.
5. Move the amputated newts to the recovery solution.
6. After 24 h, transfer the animals to an aquarium set up at
24 C. Limbs will regenerate also at the lower maintenance
temperature (1820 C), but the process will be slower. In
animals kept at 24 C, the mid-bud blastema stage (conical
mound of cells at the tip of the stump) is reached by 1215 days.
As there is variability among batches of newts, animals must be
closely monitored and care taken to provide abundant live
food and maintain the temperature constant.
3.2 Tissue
Preparation
for Culturing
1. Kill the newt with an overdose of anesthetics (according to

your animal procedure approved directives).
2. Dip the whole body in 1 % sodium hypochlorite, pH 8.8, for a
couple of minutes (50 mL tubes are quite convenient for
small-/medium-sized newts). This time can be increased for
preparation of explants from normal limbs, as normal skin provides a strong barrier to the underlying tissue.
3. Rinse the body 45 times in sterile Ca2+/Mg2+-free APBS.
4. Remove the normal limb or the limb blastema with sterile
dissection tools.
5. Place the limb or limb blastema in cold dissection medium (see
Notes 4 and 5).
3.3 Dissociated
Cultures from Newt
Limb Blastemas
179
1. Follow steps 15 in Subheading 3.2.

2. Transfer the mid-bud blastemas into a dish containing EDTA
solution.
3. Incubate in the EDTA solution for 1015 min at room
temperature.
4. Mechanically remove the wound epidermis with fine sterile
forceps. It should peel off quite easily if sufficient time in
EDTA is allowed.
5. Cut each blastema in 45 pieces.
6. Transfer the blastema fragments into a screw cap vial (e.g., a
7 mL Bijou vial) containing 25 mL of 0.05 % trypsin solution.
Always use a freshly prepared solution.
7. Digest the blastema fragments overnight at 8 C.
8. Inactivate the trypsin by adding an equal volume of L-15.
9. Gently triturate the tissue suspension by passing it through
progressively smaller plastic pipettes (from 5 to 0.5 mL). An
autoclaved nylon mesh or cell strainer (100 m size) can be
used to remove undigested tissue fragments; however, it should
be noted that some of these fragments can attach as explants
and increase the cell yield.
10. Centrifuge the cell suspension for 5 min at 176 g in conical
centrifuge tubes.
11. Resuspend the pellet in AMEM.
12. Remove fragments of undigested tissue by passing the cell suspension through the 100 m pore cell strainer or nylon mesh.
This step can reduce the yield and can be skipped, particularly
when starting with a small number of blastemas.
13. Plate the cells onto either collagen- or gelatine-coated multiwell plates (e.g., 24- or 6-well plates) keeping the medium volume as low as possible to allow more rapid conditioning (see
Note 6).
14. Place the dishes in a humidified incubator with 2 % CO2
at 25 C.
15. Wait for the cells to attach. Do not remove the medium even if
there is abundant cell debris until adhering cells are observed.
This can take 23 days or much longer, as notwithstanding
high viability after dissociation, initial attachment is poor and
can take several days for cell growth to become apparent
(1020 days).
3.4 Explant Cultures

from Normal Newt
Limbs and Limb
Blastemas
1. Remove the normal limb skin keeping the limb immersed in

L-15 (see Note 7).
2. Remove wound epidermis from blastemas following steps 14
in Subheading 3.3.
180
3. Cut the limb tissue into small cubes of approximately 35 mm3

in L-15.
4. Gently place each fragment onto either collagen (as in the
original protocol) or gelatine-coated Petri dishes (3035
explants/10 cm dish) or multiwell plates (e.g., 24-well plates,
13 explants per well) and cover it with a drop of AMEM or
L-15 if using an incubator without CO2 (see Note 6).
5. Add just enough AMEM to cover the explants and put the dish
back in the incubator.
6. Leave the explants for a few hours or overnight in a humidified
incubator with 2 % CO2 at 25 C to promote attachment
ensuring they do not dry out.
7. Wait for cells to migrate out. This can take several days. After
34 days, remove floating explants (usually about 40 %), but
do not replace the whole medium.
8. Once cells have started to migrate out of the explants
(515 days), feed them by adding fresh medium.
9. Passage cells as described in Subheading 3.5 when they reach
approximately 70 % confluence or become tightly packed
around the explant. This can take about a month.
3.5 Long-Term
Maintenance of Newt
Cells
1. Do not allow cells to become overgrown as they will start to

differentiate.
2. For culture expansion, passage cells when they are 7090 %
confluent and split them either 1:2 or 1:3. Do not passage cells
that are less than 30 % confluent nor plate them at such a low
density, as they will struggle to grow. Newt cells require some
cell contact for optimal growth.
3. Rinse cells with Ca2+/Mg2+-free APBS prior to trypsinization
to remove Ca2+/Mg2+ ions as they affect trypsin activity.
4. Remove the Ca2+/Mg2+-free APBS.
5. Add a small volume of trypsin solution sufficient to cover
evenly the surface of your dish/flask.
6. Incubate for 46 min in the amphibian tissue culture
incubator.
7. Check your cells under the microscope and gently shake the
dish/flask to aid cell detachment.
8. When the cells start to detach, neutralize the trypsin by adding
AMEM or 60 % L-15 with 10 % FCS.
9. Remove all cells from the flask by gentle pipetting.
10. Transfer the suspension to a conical centrifuge tube.
11. Centrifuge the suspension at 176 g for 5 min in a standard
tissue culture centrifuge.
181
12. Remove the supernatant and resuspend the cells in 200

1,000 L of AMEM by gentle mixing; count them if necessary.
13. Dilute the cell suspension with AMEM as required and plate
onto gelatine-coated plastic. Newt cells are usually plated at an
approximate density of 6,000 cells/cm2 (see Note 8). When
grown under optimal conditions, they reach confluence in
710 days. After plating in fresh medium, cells can be fed, but
the medium should not be changed to avoid removing essential autocrine factors essential for their growth. Frequent full
changes of medium result in the arrest of cell proliferation.
3.6 Cryopreservation
of Newt Cells
Newt cells can be frozen when they are 70 % confluent. A 75 cm2

flask at 70 % confluence contains a sufficient number of cells for
freezing. Freezing less than 500,000 cells should be avoided as it
results in poor recovery after thawing.
1. Defrost the freezing medium and keep it on ice; it must never
be warmed above room temperature.
2. Trypsinize the cells as described in Subheading 3.5,
steps 211.
3. Resuspend the pellet in 200 L of AMEM.
4. Transfer the cell suspension to 1.2 mL of cold freezing medium
in a cryogenic vial (see Note 9).
5. Place the vial in a freezing box and keep it at 20 C for 23 h.
6. Transfer the vial to a 70/80 C freezer.
7. After 1624 h, move the vial into a liquid nitrogen storage
container (see Note 10).
3.7 Thawing
Newt Cells
The procedure for thawing newt cells is similar to that used for
mammalian cells, with much care needed to rapidly dilute and
eliminate the DMSO present in the freezing medium in order to
avoid toxic effects and maximize cell recovery.
1. Dispense 8 mL of cold AMEM or L15 in a conical centrifuge
tube.
2. Rapidly thaw the cells by immersing the vial in a water bath
at 37 C.
3. As soon as the cell suspension has thawed and is still cold,
dilute it in the 8 mL of medium in the centrifuge tube.
4. Spin the cell suspension at 62 g for 5 min. Decant the supernatant and resuspend the pellet in 5 mL of AMEM.
5. Transfer the cell suspension to a 75 cm2 (or smaller) gelatinecoated flask and place it in the amphibian cell incubator.
3.8 Nucleofection
of Newt Cells
1. Equilibrate 10 mL of complete AMEM in a tissue culture

flask or a centrifuge tube in an amphibian cell culture incubator
for 20 min. The cells must be transferred to this medium
182
immediately after nucleofection. The final volume of the

medium added depends on the culture flask or Petri dish used.
2. Warm up the Nucleofector solution at room temperature.
3. Turn on the Nucleofector device.
4. Select the following program based on the cell type: (a) newt
A1 cellsprogram number T-020; (b) newt B1H1 cellsprogram T-030.
5. Trypsinize the cells as described in Subheading 3.5, steps
211. A cell density of 7080 % confluence is optimal for all
amphibian lines (A1, B1H1).
6. Carefully remove all the supernatant with an aspirator, and any
small volume of medium remaining should be removed using
a pipette tip.
7. Resuspend the cells in 100 L of Nucleofector solution and
mix it gently without creating air bubbles (see Note 11).
8. Add 24 g plasmid DNA, and mix the solution.
9. Transfer the cell suspension to 0.2 cm electroporation cuvette
carefully through the sides of the cuvette without creating any
air bubbles. Use about 5 105 cells per 0.2 cm cuvette. Due to
the large size of amphibian cells, manufacturers recommended
number of cells is not required. Nucleofection can be successfully carried out also using a lower number of cells. However,
under these conditions cell death is higher.
10. Replace the cap of the cuvette and place it in the cuvette holder
of the Nucleofector Device.
11. Run the required program.
12. Immediately after completion of the program, take out the
cuvette and transfer the cell suspension to the equilibrated
complete medium.
13. Place the tube in the cell culture incubator for 30 min to allow
the cells to recover before plating them.
14. Nucleofected cells from each tube can be plated on 2 25 cm2
flasks or 34 35 cm cultures dishes.
15. Transfer the cells to the amphibian incubator.
16. Check for cell attachment and transfection rate. Expression of
transfected constructs should be detectable after 2448 h.
Cell survival rate after nucleofection is between 30 and 50 %.
Cells at passage 3045 show very good survival after nucleofection. High variability in cell survival has been noticed in
cells at high passage number (>60). Expression of marker
genes (eGFP, RFP; Fig. 2ab) in nucleofected newt cells is
6080 % (see Note 12).
17. Newt cells can be cultured for several weeks without loss of
marker gene expression. We have also generated newt cells
183
with selectable markers (e.g., puromycin) to establish stable

cell lines expressing marker genes. Heterogeneity in the level
of gene expression is observed in these cells.
Notes
1. Sterile water bottles should be designated for amphibian cell
culture only and prepared as follows: use new bottles, fill them
with distilled water, and autoclave; discard the autoclaved
water and then fill the bottles with HPLC grade water and
autoclave. Do not wash the bottles with detergents.
2. Amphibian cells do not grow equally well in all fetal calf sera
(FCS). Therefore, batch screening is essential. Usually testing
34 samples of serum from a supplier is sufficient for identifying a good growth promoting FCS. Once a suitable batch has
been identified, an appropriate number of 500 mL bottles
(e.g., 2040 depending on the volume of work anticipated) of
that FCS batch should be reserved. The FCS can be stored at
20 C for several years.
3. The culture medium can be stored at 4 C for a couple of
weeks. The medium should be brought to room temperature
before use. Do not warm it in a water bath at 37 C.
4. As L-15 medium is amino acid rather sodium bicarbonate
buffered, it effectively maintains a physiological pH when handling tissue and cells outside the CO2 incubator. Cells can be
cultured long-term in this medium if an incubator with 2 %
CO2 is not available.
5. Gentamicin is used at the dissection stage as it is rather effective in reducing contaminations, but it was found that its prolonged use affects cell growth. Hence, it should not be included
in the growth medium.
6. All of the lines currently in use were started by plating cells or
explants onto collagen-coated plastic, but as the newt limb cell
lines attach well also on gelatine, it is expected this would be a
suitable substrate for starting new lines.
7. Normal limb tissue is very difficult to dissociate, and only occasionally live cells are obtained following enzymatic digestion.
In contrast, blastemas are more easily dissociated but more
prone to contaminations.
8. If antibody staining and high-resolution imaging under oil
objective is anticipated, culturing of newt cells on Nunc 35 mm
Petri dishes is recommended. This will allow mounting of the
dishes with a round cover slip and easy trimming of the edges
of the plate with a pair of sharp scissors to accommodate the oil
objectives. Newt cells usually do not grow optimally on glass
184
coverslips. If plating the cells on a coverslip, coating with polylysine before gelatine coating helps cell attachment.
9. The presence of antibiotics in the freezing medium does not
appear to cause any adverse effect.
10. The cells can be kept at 70 C for a few days but ideally should
be transferred into liquid nitrogen within 24 h.
11. Efficiency of transfection using the Lonza kit and Mirus electroporation solution was assessed in parallel using various plasmid and comparable results obtained. Cuvettes with larger
volumes can also be used for nucleofection of cells.
12. The nucleofection approach described here is also applicable
to cells derived from the limb of axolotl, a paedomorphic
salamander.
References
1. Boilly B, Albert P (1988) Blastema cell proliferation in vitro: effects of limb amputation on
the mitogenic activity of spinal cord extracts.
Biol Cell 62:183187
2. Ferretti P, Brockes JP (1988) Culture of newt
cells from different tissues and their expression
of a regeneration-associated antigen. J Exp
Zool 247:7791
3. Corcoran JP, Ferretti P (1997) Keratin 8 and
18 expression in mesenchymal progenitor cells
of regenerating limbs is associated with cell
proliferation and differentiation. Dev Dyn
210:355370
4. Corcoran JP, Ferretti P (1999) RA regulation
of keratin expression and myogenesis suggests
different ways of regenerating muscle in adult
amphibian limbs. J Cell Sci 112:13851394
5. Sessions SK (2008) Evolutionary cytogenetics
in salamanders. Chromosome Res 16:
183201
6. Morrison JI, Borg P, Simon A (2010) Plasticity
and recovery of skeletal muscle satellite cells
during limb regeneration. FASEB J 24:
750756
7. Ferretti P, Fekete DM, Patterson M, Lane EB
(1989) Transient expression of simple epithelial keratins by mesenchymal cells of regenerating newt limb. Dev Biol 133:415424
8. Casimir CM, Gates PB, Ross-Macdonald PB,
Jackson JF, Patient RK, Brockes JP (1988)
Structure and expression of a newt cardioskeletal myosin gene. Implications for the C
value paradox. J Mol Biol 202:287296
9. Kosaka M, Kodama R, Eguchi G (1998) In
vitro culture system for iris-pigmented
10.
11.
12.
13.
14.
15.
16.
17.
epithelial cells for molecular analysis of transdifferentiation. Exp Cell Res 245:245251
Simon A, Brockes JP (2002) Thrombin activation of S-phase reentry by cultured pigmented
epithelial cells of adult newt iris. Exp Cell Res
281:101106
Bettencourt-Dias M, Mittnacht S, Brockes JP
J Cell Sci 116:40014009
Lo DC, Allen F, Brockes JP (1993) Reversal of
muscle differentiation during urodele limb
regeneration. Proc Natl Acad Sci U S A 90:
72307234
Tanaka EM, Drechsel DN, Brockes JP (1999)
Thrombin regulates S-phase re-entry by cultured newt myotubes. Curr Biol 9:792799
Tanaka EM, Gann AA, Gates PB, Brockes JP
(1997) Newt myotubes reenter the cell cycle
by phosphorylation of the retinoblastoma protein. J Cell Biol 136:155165
Beug S, Vascotto SG, Tsilfidis C (2006) Newt
orthologue of Growth arrest-specific 6
(NvGas6) is implicated in stress response during newt forelimb regeneration. Dev Dyn
235:711722
Giampaoli S, Bucci S, Ragghianti M, Mancino
G, Zhang F, Ferretti P (2003) Expression of
FGF2 in the limb blastema of two
Salamandridae correlates with their regenerative capability. Proc Biol Sci 270:21972205
Kumar A, Velloso CP, Imokawa Y, Brockes JP
(2000) Plasticity of retrovirus-labelled myotubes in the newt limb regeneration blastema.
Dev Biol 218:125136

18. Yun MH, Gates PB, Brockes JP (2014)
Sustained ERK activation underlies reprogramming in regeneration-competent salamander cells and distinguishes them from their
mammalian counterparts. Stem Cell Rep
3:1523
19. Cash DE, Gates PB, Imokawa Y, Brockes JP
(1998) Identification of newt connective tissue
growth factor as a target of retinoid regulation
in limb blastemal cells. Gene 222:119124
20. Blassberg RA, Garza-Garcia A, Janmohamed
A, Gates PB, Brockes JP (2011) Functional
convergence of signalling by GPI-anchored
and anchorless forms of a salamander protein
implicated in limb regeneration. J Cell Sci
124:4756
185
21. Velloso CP, Simon A, Brockes JP (2001)

Mammalian postmitotic nuclei reenter the cell
cycle after serum stimulation in newt/mouse
hybrid myotubes. Curr Biol 11:855858
22. Balls M, Worley RS (1973) Amphibian cells
in vitro. II. Effects of variations in medium
osmolarity on a permanent cells line isolated
from Xenopus. Exp Cell Res 76:333336
23. Roy S, Gardiner DM, Bryant SV (2000)
Vaccinia as a tool for functional analysis in
regenerating limbs: ectopic expression of Shh.
Dev Biol 218:199205
24. Yun MH, Gates PB, Brockes JP (2013)
Regulation of p53 is critical for vertebrate limb
regeneration. Proc Natl Acad Sci U S A
110:1739217397
Chapter 15
Culture and Transfection of Axolotl Cells
Jean-Franois Denis, Fadi Sader, Patrizia Ferretti, and Stphane Roy
Abstract
The use of cells grown in vitro has been instrumental for multiple aspects of biomedical research and especially
molecular and cellular biology. The ability to grow cells from multicellular organisms like humans, squids,
or salamanders is important to simplify the analyses and experimental designs to help understand the biology of these organisms. The advent of the first cell culture has allowed scientists to tease apart the cellular
functions, and in many situations these experiments help understand what is happening in the whole
organism. In this chapter, we describe techniques for the culture and genetic manipulation of an established cell line from axolotl, a species widely used for studying epimorphic regeneration.
Key words Axolotl, Cell culture, Electroporation, Limb regeneration, Lipofection, Salamander,
Transfection
Introduction
The ability to grow cells from multicellular organisms in vitro was
invented by R.G. Harrison at the beginning of the twentieth century. Over a century after this development, tissue culture has
become an intrinsic part of the experimental arsenal used in every
modern laboratory studying molecular and cellular biology, biochemistry, and genetics whether for biomedical or fundamental
reasons. The ability to grow cells in culture is important to help
our understanding of how different cell types proliferate or respond
to specific signals. Tissue culture is therefore an important complement to studying processes that occur in vivo. We are particularly
interested in the process of epimorphic regeneration in vertebrates
and the animals of choice for this are the urodele amphibians (the
most commonly used models are the axolotl and the newt).
Although cultures from human and mouse cells have been established with tremendous success, it is often a challenge to set up cell
cultures from lower vertebrates like salamanders.
The first, and presently the only, cell line available from an
Axolotl Limb is the AL-1 cell line (Fig. 1). It was established in the
187
188
Jean-Franois Denis et al.
Fig. 1 AL-1 cells transfected with plasmid containing the CMV-mCherry expression cassette. (ac) Transfection
with 0.5 g of plasmid using Lipofectamine 3000 at 37 C for 4 h. (a) Bright-field view of transfected cells
indicates that cells are attached and normal looking. (b) Same cells as (a) visualized with the mCherry filter.
(c) Overlay of bright-field and mCherry from (a) and (b) indicates that about 40 % of cells are transfected. (df)
Transfection using square wave electroporation of 5 g of plasmid. (d) Bright-field view of transfected cells,
less cells survive electroporation which explains the lower number of cells in the frame. (e) Same cells as (d)
visualized with the mCherry filter. (f) Overlay of bright-field and mCherry from (d) and (e) shows that about
50 % of cells are transfected. The cells were photographed with a 20 objective
laboratory of David Gardiner and Susan Bryant at the University of

California, Irvine, in the mid-1990s [1]. The AL-1 cells originate
from migrated cells of a skin tissue explant from a normal axolotl
limb. They display a fibroblastic morphology and attach and grow
well on tissue culture plastic (Fig. 1). AL-1 cells have been used to
test hormone response and pharmacological inhibitors [2] as well
as viral vectors [1]. These cells have been important to help understanding the function of transcription factors and their downstream
targets and to study tumor suppressor genes, such as p53 [3, 4]. In
addition, the AL-1 cell line has been very valuable for testing plasmid constructs prior to electroporating them in vivo into regenerating limbs [5]. Recently, stable lines from AL-1 cells expressing
fluorescent reporter genes have been developed by infecting them
with pseudotyped retrovirus [6].
In this chapter we describe how to grow and maintain the
AL-1 cell line as long-term cultures. Introduction of DNA into
amphibian cells is difficult and we have screened a panel of commercially available transfection reagents to transfect AL-1 cells.
Here we provide the details for the optimized transfection procedures for the transfection of plasmid DNA into AL-1 cells.
2
2.1
189
Materials
AL-1 Culture
1. Ultrapure water (e.g., we use Barnstead nanopure deionized

water of 18 M cm at room temperature).
2. Amphibian PBS (A-PBS): in 700 mL of ultrapure water, dissolve 8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4 anhydrous, and
0.24 g KH2PO4 anhydrous. Make up to 1 L with sterile water.
3. 100 insulin-transferrin-selenium (ITS; 1,000 mg/L insulin;
transferrin 550 mg/L; sodium selenite 0.67 mg/L (Life
Technologies, cat. no. 41400-045)). Keep stock solution
at 4 C.
4. 100 glutamine (200 mM stock): aliquot the stock solution
and store at 20 C.
5. 100 penicillin/streptomycin (PS; 10,000 units/mL of penicillin and 10,000 g/mL of streptomycin): defrost the stock
solution and aliquot as convenient (e.g., 2 mL aliquots if routinely preparing 200 mL of culture medium). Store at 20 C.
6. Fetal bovine serum (FBS) or fetal calf serum (FCS).
7. Leibovitzs L-15 medium (L-15). Prepare a 64.8 % L-15 solution with sterile water and adjust the pH to 6.4 with 0.1 M
HCl. Sterilize through a 0.22 m filter.
8. L-15 complete medium: add 94 mL of L-15 prepared as in
item 7, 5 mL FBS, 1 L-glutamine (1 mL of 100 stock), 0.2
ITS and P/S (see Note 1). Once the FBS, P/S, and ITS have
been added, the final L-15 percentage is 60 %. One advantage
of using L-15 medium is that it does not need to equilibrate
with atmospheric CO2 to maintain a constant pH. L-15 is
buffered by its complement of salts, free-base amino acids, and
galactose substituted for glucose to help maintain physiological pH control. Once the L-15 complete medium is prepared,
it can be kept at 4 C for 6 weeks without any adverse effects.
Longer storage may result in adverse effect on cell growth and
reattachment after passage.
9. Amphibian culture medium (AMEM; for growth in a CO2
incubator): dispense 130 mL minimum essential medium (1
MEM), 20 mL of FCS, 2 mL of penicillin/streptomycin, 2 mL
of glutamine and 2 mL of insulin in a sterile bottle (e.g., 75 cm2
tissue culture flask; sterile glass bottle with a phenolic cap).
Bring the volume up to 200 mL with sterile water. This dilution gives a medium of the appropriate osmolarity (approximately 225250 mOsm) for amphibian cell culture.
10. Trypsin-EDTA working solution (0.25 % Life technologies
cat. no. 25200-056): aliquot the stock solution and store at
20 C. We keep a working aliquot at 4 C for ease of use.
Trypsin-EDTA will stay active for 34 weeks at 4 C. Trypsin
190
is used at room temperature for no more than 34 min for

complete cell detachment.
11. Freezing medium: mix 0.775 mL of L-15 medium with 75 L
of tissue culture grade dimethyl sulfoxide (DMSO, 7.5 %) and
150 L of FBS (15 %).
12. Sterilizing filters (syringe filters and filter flask; 0.22 m).
13. Amphibian cell culture incubator: set the incubator for amphibian cell cultures at 2526 C without CO2. Use culture flasks
which close tightly so that there is no media loss due to
evaporation.
2.2 Equipment
and Reagents
for Transfection
of AL-1 Cells
1. BTX Harvard apparatus ECM830 (capable of square wave

electroporation).
2. Sterile 4 mm electroporation cuvettes (e.g., VWR cat. no.
89047-2010).
3. Lipofectamine 3000 transfection reagent (Life technologies, cat. no. L3000-015).
4. Opti-MEM I reduced serum medium (Life technologies, cat.
no. 310985-070).
5. Plasmid DNA.
2.3 Equipment
and Reagents
for Nucleofection
of AL-1 Cells
1. Lonza nucleofector 2b device (basic model).

2. Ingenio 0.2 cm cuvettes (cat. no. 50121).
3. Cell line electroporation kit V (Lonza, cat. no. VCA-1003) or
Ingenio electroporation solution (Mirus Bio LLC).
4. Fine-tip disposable pipettes.
5. Plasmid DNA.
6. 50 mL centrifuge tubes.
Methods
3.1 Thawing
AL-1 Cells
1. Thaw cells rapidly by shaking vials in a 37 C water bath until

no ice is apparent.
2. When growing cells in the absence of CO2, after step 1, add
slowly 2 mL of complete L-15 to the freshly thawed cells.
3. Plate the cells in a small flask (35 mm or T-25) for optimal
density.
4. Place the dish/flask in an incubator maintained at 2526 C
without CO2. Alternatively cells can be grown at room temperature if no incubator is available, but they will proliferate at
a slower rate. Go to step 8.
5. When growing cells in a CO2 incubator, after step 1, dilute the
cell suspension with 8 mL of cold AMEM in a centrifuge tube.
191
6. Spin the cell suspension at 62 g for 5 min. Decant the supernatant and resuspend the pellet in 5 mL of AMEM.
7. Transfer the cell suspension to a 75 cm2 (or smaller) flask and
place it in the amphibian cell incubator.
8. Change the medium on the following day.
3.2 Maintenance
of AL-1 Cells
AL-1 cells can be grown either in L-15 complete medium at 26 C

in an incubator or in AMEM at 25 C in a humidified CO2 incubator. Split the cells 1:2 when they reach 8085 % confluence, usually
once a week (see Note 2).
1. Under sterile conditions, remove the medium within flask with
a sterile pipette.
2. Rinse the AL-1 cells using A-PBS and remove PBS from flask.
3. Add 2 mL of 0.25 % trypsin.
4. Monitor the cells under an inverted microscope to see when
they begin to detach.
5. When most cells have detached from the flask, neutralize the
trypsin by adding four times the volume of L-15 complete
medium (e.g., 8 mL of complete medium for 2 mL of trypsin)
or AMEM.
6. Resuspend the cells by pipetting the medium up and down to
break up clumps of cells and to make sure that no cells are left
on the flask walls.
7. Transfer the cell suspension to a centrifuge tube (15 or 50 mL
conical bottom tube).
8. Mix 100 L of the cell suspension and 100 L of 0.4 % trypan
blue if cell counting is necessary.
9. Plate 10 L in a hemocytometer and count the cells.
10. Centrifuge at 200 g for 5 min at 4 C to pellet the cells.
11. Remove the supernatant and discard it.
12. Add the desired volume of L-15 complete medium or AMEM
(pipette up and down 45 times to break up clumps and disperse cells).
13. Plate the cell suspension.
14. If the cells are used for expansion, plate them in a flask; the
target plating density should be 40 %.
15. If the cells are to be used for experimental procedures (e.g.,
effect of hormones or drug treatment on gene expression),
plate them in the appropriate dish/well; the target plating density should be 6075 %.
16. Check for cell attachment the following day.
192
3.3 Cryopreservation
of AL-1 Cells
1. Harvest the cells when at 7080 % density by trypsinization as

described in Subheading 3.2, steps 314; one million cells
should be used for freezing.
2. Resuspend the cell pellet in 1 mL of L-15 with 7.5 % DMSO
and 15 % FBS.
3. Transfer to a 1 mL cryovial (any standard cryovial works fine).
4. Store the cryovials sequentially at 20 C overnight inside a
Styrofoam box to allow temperature to decrease slowly, then
transfer the Styrofoam box containing the cells to a 80 C
freezer overnight. The cells can be stored at this temperature
for 34 months without any adverse effects. Preferably, transfer
the cells into liquid nitrogen for long-term storage.
3.4 Electroporation
of AL-1 Cells
1. Place the microtubes and electroporation cuvettes on ice

30 min before the procedure.
2. L-15 complete medium, A-PBS, and the plasmids should be
kept on ice during the entire procedure. Low temperature
greatly helps cell survival.
314, and count.
4. Resuspend the cells using ice cold A-PBS.
5. Centrifuge at 200 g for 5 min at 4 C to pellet the cells.
Remove the supernatant and add A-PBS to obtain a concentration of 100,000 cells/100 L.
6. Add to each tube containing the plasmid 100 L of PBS containing the cells. The optimal plasmid amount is 1 g but it
can range from 0.5 to 5 g. Addition of a fluorescent reporter
expressing GFP or mCherry under the CMV promoter is
useful to assess the transfection rate (typically addition of tenfold less of this plasmid is sufficient to assess transfection rate)
(see Note 3).
7. Transfer the cell suspension to an electroporation cuvette.
8. Electroporate the cells at 200 V for 35 ms (see Note 4).
9. Quickly add 1 mL of L-15 complete medium to the transfected cells.
10. Plate the cells in a 12-well plate (one electroporation per well).
11. Repeat the steps 510 for each transfection conditions.
12. Place the transfected cells in the incubator at 26 C.
13. Change the medium the following day.
14. Check for cell attachment, survival, and transfection rate
(Fig. 1df). Optimal expression should be seen after 2448 h.
3.5 Transfection
of AL-1 Cells
with Lipofectamine
3000
193
1. Use between 0.5 and 1 g of plasmid DNA. This is the optimal

amount, but a range between 0.5 and 2 g works. A fluorescent marker can be used to assess transfection rate.
314, and count.
3. Dilute the cells in L-15 complete medium in order to obtain a
concentration of 50,000 cells/0.5 mL.
4. Plate the cells: typically plate 50,000 cells in 0.5 mL per well in
24-well plates to obtain a confluence around 85 %; the cell
density can range between 70 and 90 % but should not be
lower or higher than these values to maintain good transfection rate.
5. Prepare the Lipofectamine 3000 components for each transfection condition:
(a) Add the desired amount of plasmid to 50 L of OptiMEM; 0.51 g of plasmid DNA is the optimal amount
but a range between 0.5 and 2 g works. A fluorescent
marker can be added to assess transfection rate.
(b) Add 2 L of P3000 reagent (part of Lipofectamine 3000
kit) per 1 g of plasmid.
(c) In a second tube, mix 50 L of Opti-MEM and 1.5 L of
Lipofectamine 3000.
(d) Mix the content of the two tubes and incubate for 5 min
at room temperature.
6. Remove the medium from the attached cells in the 24-well
plate.
7. Rinse the cells once with A-PBS and then add 500 L of L-15
medium containing 5 % FBS and 1 L-glutamine (without P/S).
8. Add the Lipofectamine 3000 solution from step 5c.
9. Incubate the cells at 37 C for a maximum of 4 h (do not use
a CO2-enriched incubator). AL-1 will not survive well if kept
longer in those conditions (see Note 5).
10. Transfer the cells to the 26 C incubator.
transfected constructs should be detectable after 2448 h
(see Note 3; Fig. 1ac).
3.6 Transfection
of AL-1 Cells by
Nucleofection
1. Equilibrate 10 mL of complete AMEM in a tissue culture flask

or a centrifuge tube in a CO2 amphibian cell culture incubator
for 20 min as cells must be transferred to this medium immediately after nucleofection. The final volume of the medium added
depends on the culture flask or Petri dish used (see Note 6).
194
2. Warm up the nucleofector solution at room temperature.

3. Select the following program for AL-1 cellsprogram T-030.
314. A cell density of 7080 % confluence is optimal.
5. Carefully remove all the supernatant with an aspirator and any
small volume of medium remaining should be removed using
a pipette tip.
6. Resuspend the cells in 100 L of nucleofector solution and mix
it gently without creating air bubbles.
7. Add 24 g plasmid DNA and mix the solution.
8. Transfer the cell suspension to 0.2 cm electroporation cuvette
carefully through the sides of the cuvette without creating any
air bubbles (see Note 7).
9. Replace the cap of the cuvette and place it in the cuvette holder
of the nucleofector device.
10. Run the program T-030.
11. Immediately after completion of the program, take out the
cuvette and transfer the cell suspension to the equilibrated
complete medium.
12. Place the tube in the cell culture incubator for 30 min to allow
the cells to recover before plating them.
13. Nucleofected cells from each tube can be plated on 2 25 cm2
flasks or 34 35 mm cultures dishes.
14. Transfer the cells to the amphibian incubator.
transfected constructs should be detectable after 2448 h. Cell
survival rate after nucleofection is between 30 and 50 %.
Expression of marker genes (eGFP, RFP) in nucleofected cells
is 6080 % (see Note 8).
16. AL-1 cells can be cultured for several weeks without loss of
marker gene expression. Heterogeneity in the level of gene
expression is observed as for other methods of transfection
(Fig. 1b, e).
Notes
1. Originally, AL-1 cells were grown in 10 % FBS with 1 ITS,
but protocol optimization experiments showed that no difference in cell growth is observed by lowering FBS to 5 % and ITS
concentrations to 0.2.
2. AL-1 cells need to be maintained at 4090 % confluence for
optimal cell growth. If the density is too low, the cells will
195
proliferate very slowly. Over-confluent cells will stop growing

and will not reattach after passage.
3. Optimal transfection is observed when plasmids are pure (we
recommend using PureLink HiPure Plasmid Maxiprep kit)
followed by extra purification with phenol/chloroform/isoamyl
alcohol extraction (as described in Current Protocol) [7].
4. Use of other electroporation devices is feasible. However, the
optimal conditions need to be determined based on the manufacturers recommendation.
5. The method of transfection using the commercial transfection
reagent, Lipofectamine 3000, yields good transfection while
allowing good cell survival when performed at 37 C (Table 1).
Optimal expression is observed around 72 h post-transfection.
6. Nucleofection has not been assessed in AL-1 cells grown in
L-15 complete medium.
Table 1
Methods of transfection tested on AL-1 cells
Method of transfection
Result of transfection
Toxicity
Electroporation (square
wave is necessary)
~50 % transfection rate
~50 % of cells dont reattach
Cytofectamine (Bio-Rad)
0 % (done at 26 C)
None observed
Fugene-HD (Roche)
Less than 5 % (done at

26 C)
None observed
Lipofectin (Invitrogena)
0 % (done at 26 C)
Most cells died if left over 4 h
0 % (done at 26 C)
Cells will die off if left over 4 h
Lipofectamine 2000
~20 % if done at 37 C
4h
>50 % of cells will die within 72 h
Lipofectamine 3000a
0 % (done at 26 C)
None observed
Lipofectamine 3000a
~50 % if done at 37 C
4h
Less than 5 % of cells detach
Endo-Porter (Gene Tools)
0 % (done at 26 C) 4
and 16 h
Toxic if left on cells 16 h
Magnetofection PolyMag
(Oz Biosc)
Less than 5 % at 26 C
Depends on how much metal beads

are used, the more beads are
used, the more cells will die off
Nucleofection
6080 %
3050 % survival
Ca-Pi precipitation
0 % (done at 26 C)
None observed
Lipofectamine 2000
N.B. for each method listed, various ratios of plasmid to reagents were tested and only the summary is presented in this
table. The most efficient methods are the ones described in detail (i.e., electroporation, Lipofectamine 3000, and
nucleofection)
196
7. Use about 5 105 cells per 0.2 cm cuvette. Due to the large
size of amphibian cells, manufacturers recommended number
of cells is not required. Nucleofection can be successfully carried
out also using a lower number of cells. However, under these
conditions cell death is higher. Cuvettes with larger volumes
can also be used for nucleofection of cells.
8. Efficiency of transfection using the Lonza kit and Mirus electroporation solution was assessed in parallel using various plasmids and comparable results were obtained.
References
1. Roy S, Gardiner DM, Bryant SV (2000)
Vaccinia as a tool for functional analysis in
regenerating limbs: ectopic expression of Shh.
Dev Biol 218:199205
2. Levesque M, Gatien S, Finnson K, Desmeules
S, Villiard E, Pilote M, Philip A, Roy S (2007)
Transforming growth factor: beta signaling is
essential for limb regeneration in axolotls. PLoS
One 2:e1227. doi:10.1371/journal.pone.
0001227
3. Shaikh N, Gates PB, Brockes JP (2011) The
Meis homeoprotein regulates the axolotl Prod
1 promoter during limb regeneration. Gene
484:6974
4. Villiard E, Brinkmann H, Moiseeva O, Mallette
FA, Ferbeyre G, Roy S (2007) Urodele p53 tolerates amino acid changes found in p53 variants
linked to human cancer. BMC Evol Biol 7:180.
doi:10.1186/1471-2148-7-180, 1471-21487-180 [pii]

5. Guimond JC, Levesque M, Michaud PL,
Berdugo J, Finnson K, Philip A, Roy S (2010)
BMP-2 functions independently of SHH signaling and triggers cell condensation and apoptosis in regenerating axolotl limbs. BMC Dev
Biol 10:15. doi:10.1186/1471-213X-10-15
6. Whited JL, Tsai SL, Beier KT, White JN,
Piekarski N, Hanken J, Cepko CL, Tabin CJ
(2013) Pseudotyped retroviruses for infecting
axolotl in vivo and in vitro. Development
140:11371146
7. Moore D, Dowhan D (2002) Purification and
concentration of DNA from aqueous solutions.
Curr Protoc Mol Biol, Chapter 2:Unit 2.1A.
doi: 10.1002/0471142727.mb0201as59. John
Wiley & Sons, Inc.
Chapter 16
Isolation and Culture of Neurospheres
from the Adult Newt Brain
Abstract
Neural stem cells (NSCs) give rise to neurons in the adult brain and are possible targets in regenerative
therapies. In vitro cultures of NSCs as neurospheres have been established from cells isolated from diverse
species. Newts are exceptional regenerators among vertebrates. These animals are able to efficiently
replace neurons following ablation of those by activation and subsequent differentiation of NSCs. Here
we describe the method for isolating and culturing of NSCs from the newt brain both during self-renewing and differentiating conditions. Newt NSC culture provides a useful tool for functional studies of NSC
fate with the potential of resulting in novel regenerative strategies.
Key words Primary culture, Neurosphere, Neural stem cells, Newt
Introduction
Newts have remarkable regeneration capacities among adult vertebrates [1], which extend also to the brain. In a series of experiments, it has been shown that the newt brain is able to activate
sufficient cues to direct activated NSCs toward specific neuronal
subtypes within an existing brain tissue [24]. As a complement to
in vivo studies, in vitro cultures of NSCs offer additional opportunities to reveal regulatory mechanisms that control NSCs fate.
A hallmark of NSCs is their potential to form neurospheres in
culture. In cultures, NSC fate is easy to manipulate by over- and
under-expression approaches and by treatment with small molecules. Such manipulations can be used to uncover critical regulatory mechanisms underlying proliferation and differentiation
toward neurons. Recently, we used this approach to characterize
the heterogeneity of newt NSCs isolated from defined brain regions
at the molecular level and carry out functional manipulations of
neurogenesis [5].
Here, we describe a detailed protocol for the formation and
propagation of neurospheres from the adult newt brain (Fig. 1).
197
198
Fig. 1 Formation and differentiation of neurospheres. (a) Small spheres appearing 4 days after plating.
(b) Spheres typically reach maximum size around day 14. (c) Plating neurospheres on PDL plates leads to
attachment of the neurospheres to the substrate. (d) By day 15, differentiating neurospheres are apparent by
bright-field microscopy
The basis of the procedure is the enzymatic digestion of newt brain

into single cells. Among these single cells NSCs proliferate and
form neurospheres as it has been described in other species [5]. We
also outline how to promote adhesion of neurospheres to Poly-Dlysine-coated plates in order to induce differentiation of NSCs in
defined culture medium (Fig. 2).
Materials
Prepare all solutions fresh before use. Dilute all culture medium to
66 % with Milli-Q water to adjust amphibian osmolarity (see Note 1),
and filter using 0.22 m syringe filter.
2.1 Dissection Tools

and Culture Plates
1. Scalpel blade, forceps, and surgical scissors: Autoclave all

instruments and sterilize with 70 % ethanol before usage
(see Note 2).
Isolation and Culture of Neurospheres from the Adult Newt Brain
199
Fig. 2 Immunocytochemical characterization of neurospheres. (ad) Growing neurospheres stained with stem
cell marker GFAP and proliferation marker, PCNA. Most of the GFAP-expressing cells are marked by the proliferation marker, PCNA. (eh) Differentiating neurospheres stained with the neuronal marker, Tuj-1, and the glial
marker, GFAP. This image illustrates that most of the progeny are neurons and some progeny are glial cells
2. 8-well chamber slides, 24-well low-adherent plates, and 25 cm2

cell culture flask.
3. 60 15 mm Petri dish, tissue strainer (40 m).
4. Dissection microscope, light microscope, and fluorescence
microscope.
2.2 Reagents
for Neurosphere
Culture
1. Anesthetic solution: Make 0.1 % of ethyl p-aminobenzoate

(MS222) in tap water (see Note 3).
2. Dissection solution: L15 medium containing 1 % of 100 U/
mL streptomycin-penicillin solution (see Note 4).
3. Enzyme solution A: Mix 30 U/mL papain and 40 g/mL
DNase in 1 mL of L15 medium.
4. Enzyme solution B: Dissolve 2 mg/mL of ovomucoid in
40 g/mL DNase in containing L15 medium. Make 1 mL
solution.
5. Enzyme digestion solution: Mix 250 L of solution A and B,
wait for 5 min (see Note 5).
6. Enzyme inhibitor solution: 2 mg/mL ovomucoid and 40 g/
mL DNase in L15.
200
7. Preparation of growth factors:

(a) Dissolve 20 g human FGF-2 in 1 mL of 5 mM TrisHCl
(pH 7.6) and sterilize through a 0.22 m pore-size filter.
Make 50 L aliquots and store at 20 C.
(b) Dissolve 0.1 mg human EGF in 1 mL PBS containing
0.1 % bovine serum albumin. Make 50 L aliquots and
store at 20 C.
8. Expansion medium: Dilute DMEM/F12/Glutamax medium
to 66 % with sterile Milli-Q water and supplement with 2 % of
B27 (serum-free supplement), 1 % of 100 U/mL penicillinstreptomycin, 20 ng/mL of EGF, and 20 ng/mL of FGF-2.
9. Differentiation medium: Neurobasal medium supplemented
with 2 % of B27, 1 % of 100 U/mL penicillin-streptomycin,
and 1 % of 2 mM Glutamax.
10. Poly-D-lysine coating (PDL): Prepare 1 mg/mL stock solution
of PDL in Milli-Q water. The stock solution can be stored at
20 C for up to 6 months. The working concentration of
PDL is prepared by diluting 1 mL of stock solution in 50 mL
of sterile PBS [6]. Coat the 8-well chamber slide by adding
250 L of PDL on each well and incubate overnight at
25 C. Wash the slides with Milli-Q water, three times for
5 min (see Note 6).
2.3 Reagents
for Fixation
and Staining
1. Sterile phosphate buffered saline (PBS), pH 7.4.

2. 4 % formaldehyde solution.
3. 0.5 % Tx-100 in PBS: Add 5.0 mL of Triton x-100 (Tx-100)
to 995 mL of PBS.
4. Blocking solution: Add 5 mL of donkey serum to 95 mL of
PBS containing 0.5 % Tx-100.
5. Primary antibodies such as anti-GFAP, PCNA, and Tuj-1.
Dilute primary antibodies in blocking solution.
6. Alexa Fluor conjugated secondary antibodies. Dilute secondary antibodies in blocking solution.
7. Mounting medium: Dilute 5 mg/mL of DAPI (4,6-diamino2-phenylindole) by 1:1,000 in DAKO florescence mounting
medium.
Methods
All the cell culture procedures are carried out under aseptic
conditions.
3.1 Isolation
of Brain Cells
1. Anesthetize newts in 0.1 % ethyl p-aminobenzoate (MS222).

Typically it takes 20 min.
201
2. Sacrifice the animal and dissect out the brain under a dissection
microscope.
3. Drop the extracted brain in to a 60 15 mm Petri dish containing dissection solution.
4. Remove carefully the meninges and blood vessels off the brain
with fine forceps. Wash the tissue by transferring it to a new
60 15 mm Petri dish containing dissection solution (see Note 7).
5. Place the brain into fresh dissection medium and take the brain
into culture hood. Use a scalpel to cut the brain into small
(approximately 1 mm3) pieces (see Note 8).
6. Collect the pieces of brain using a 1,000 L pipette and transfer to the fresh 1.5 mL microtube. Allow the tissue to sink to
the bottom by gravity, and remove the supernatant solution.
7. Add 500 L freshly made enzyme digestion solution and incubate at room temperature for 1 h. During the incubation, stir
the tube gently once every 15 min (see Note 9).
8. Add equal volume of enzyme inhibitor to stop the enzyme activity.
Incubate 5 min at RT. Transfer the incubation mixture to 15 mL
falcon tube and centrifuge for 5 min at 80 g (see Note 10).
9. Remove supernatant and add 1 mL of fresh dissection medium
to the precipitate.
10. Dissociate the newt brain cells by triturating with 1,000 L
pipette for 2 min slowly up and down (see Note 11).
11. Filter cell suspension through a 40 m tissue strainer to remove
any undissociated cells or tissue clumps.
12. Collect the filtered cells and centrifuge at 80 g for 5 min.
13. Remove most of the supernatant, leaving 300 L in the tube to
make sure that cells are not lost.
14. Resuspend the cells in 4 mL of expansion medium and transfer
them to a 25 cm2 cell culture flask (see Note 12).
3.2 Neurosphere
Formation
and Differentiation
1. Plated isolated cells in the 25 cm2 flask should be cultured in

the incubator at 25 C at 2 % CO2 (see Note 13).
2. Change half of the medium once per week by centrifuging the
suspension and then replacing it with half the volume of the
medium (see Note 14).
3. After 14 days, collect the neurospheres by centrifuging at
80 g for 5 min. These neurospheres can be either stained
directly or induced to differentiate (see Note 15).
4. For differentiation, remove the supernatant, resuspend the
spheres in the expansion medium, and then plate the spheres
on PDL-coated slides.
5. After 24 h, when the spheres are attached, remove the expansion medium and change to neurobasal medium (see Note 16).
202
3.3 Immunostaining
of Neurospheres
and Differentiated
Neurospheres
Between changing the solutions wait at least 3 min so that the

neurospheres have time to resettle at the bottom of the well. Aspire
the solutions by slightly tilting the plates and having the tip of the
pipette touching the wall of the plate rather than the bottom [7].
Do not remove more than 75 % of the solutions.
1. Isolate the spheres by centrifugation and plate them into
24-well plates.
2. Add 4 % PFA and incubate for 15 min.
3. Remove PFA and wash three times with PBS for 5 min.
4. For proliferative cell nuclear antigen staining (PCNA), incubate neurospheres in 2 M HCl in 0.5 % Tx-100 in PBS for
20 min at 37 C.
5. For GFAP and Tuj-1 staining, use 0.5 % Tx-100 in PBS for
15 min at RT.
6. Wash the neurospheres with PBS once for 5 min.
7. Change to blocking solution containing 5 % donkey serum in
0.5 % Tx-100 in PBS. Incubate for 30 min at RT.
8. Prepare primary antibodies in blocking buffer. Incubate with
respective antibody overnight at 4 C. Use anti-rabbit
GFAP (1:500), anti-mouse PCNA (1:500), and anti-mouse
Tuj-1 (1:500).
10. Incubate neurospheres with Alexa Fluor conjugate secondary
antibody, either Alexa Fluor 488 (1:500) or Alexa Fluor 594
(1:500) for 2 h at RT.
12. Remove maximum PBS as possible, then collect the neurosphere with 1,000 L pipette and place them on 76 26 mm
glass slide. Add mounting medium containing DAPI on the
slide and mount with a 24 50 mm coverslip.
13. For immunostaining differentiated neurospheres, follow all the
steps 112, and omit the centrifugation steps.
14. Observe the samples under a fluorescence microscope with
appropriate filters.
Notes
1. Amphibian osmolarity is 225 5 mOsmol. Therefore, the culture medium is diluted to 66 % with Milli-Q water to match
the osmolarity of the newt cells.
2. It is important to remove any remaining ethanol from the surgical tools by rinsing them with sterile PBS before touching
the tissue. Traces of ethanol will act as a fixative for the tissue.
203
3. MS222 should be dissolved in tap water, do not use Milli-Q

water.
4. Dissection solution should be kept cold during preparation of
the tissue explant; therefore, keep the solution on ice. The
antibiotics, penicillin, and streptomycin prevent the bacterial
contamination of the cell culture medium.
5. Prepare this solution just before use.
6. PDL coating can also be done at 37 C for 2 h. PDL-coated
slides can be kept maximum for a week before using.
7. Blood vessels are a source of contamination and should be
removed from the culture.
8. Smaller pieces of tissue will dissociate better and yield higher
number of neurospheres.
9. Check the enzymatic digestion every 15 min and stir gently to
mix the solution. The solution becomes turbid due to digestion. Make sure that there are no clumps forming during digestion. Clumping usually occurs due to the release of DNA from
dead cells.
10. Digestion time varies depending on the type of tissue and concentration of enzyme. Vigorous digestion leads to fewer viable
cells. Digestion is one of the most critical steps, which, if not
performed correctly, would substantially reduce the number of
viable cells. Also, avoid formation of air bubbles; excessive air
bubbles decrease cell viability.
11. NSCs are of ventricular origin. During the digestion of the tissue, cells from the ventricular zone are released first and later
other cells start to dissociate. Therefore, it is not necessary to
completely digest the entire tissue.
12. The optimal cell density for neurosphere formation is about
5,00010,000 cells/mL but may be lowered for clonal
analyses.
13. Optimal culturing temperature is 25 C; however, the cultures
tolerate temperature between 20 and 27 C.
14. Instead of changing the medium completely, it is advised to
change only half of the medium at the time because prosurvival
factors produced by the cells may be present.
15. Small-sized neurospheres start to appear on day 4, grow bigger
over time, and reach maximum size (100300 m) by 23
weeks (Fig. 1).
16. Just removing the growth factor can be sufficient to induce
differentiation of neurospheres. Defined medium leads to more
robust differentiation toward various lineages. Over time,
neurospheres start to differentiate and produce progenies.
These cells can be stained for differentiation markers (Fig. 2).
204
Acknowledgment
This work was supported by a grant from the Swedish Research
Council to AS.
References
Dev Biol 24:525549
regions of the adult vertebrate brain. Development 137:41274134
3. Berg DA, Kirkham M, Wang H, Frisen J, Simon
A (2011) Dopamine controls neurogenesis in
the adult salamander midbrain in homeostasis
and during regeneration of dopamine neurons.
and behavioural recovery in a salamander lesion-
induced regeneration model. Development

134:28812887
5. Kirkham M, Hameed LS, Berg DA, Wang H,
Simon A (2014) Progenitor cell dynamics in
the newt telencephalon during homeostasis and
neuronal regeneration. Stem Cell Reports
2:507519
6. Ortega F, Costa MR, Simon-Ebert T, Schroeder
T, Gotz M, Berninger B (2011) Using an
adherent cell culture of the mouse subependymal zone to study the behavior of adult neural
stem cells on a single-cell level. Nat Protoc
6:18471859
7. Sasaki R, Aoki S, Yamato M, Uchiyama H, Wada
K, Ogiuchi H, Okano T, Ando T (2010) A protocol for immunofluorescence staining of floating neurospheres. Neurosci Lett 479:126127
Chapter 17
Methods for Axolotl Blood Collection, Intravenous
Injection, and Efficient Leukocyte Isolation from Peripheral
Blood and the Regenerating Limb
Abstract
The vertebrate immune system comprises both adaptive and innate immune cells with distinct functions
during the resolution of inflammation and wound healing after tissue injury. Recent evidence implicates a
requirement for innate immune cells from the myeloid lineage during the early stages of limb regeneration in
the Mexican axolotl. Understanding the functions of innate and adaptive immune cells in the axolotl has been
hampered by a lack of approaches to isolate and analyze these cells. Here we describe a protocol to isolate
myeloid cells from the regenerating axolotl limb that incorporates intravenous delivery of physiological labels.
In addition we provide a protocol to enrich for leukocytes in the peripheral blood. These protocols produce
single-cell suspensions that can be analyzed using flow cytometry or sorted into specific subsets using fluorescent-activated cell sorting (FACS). FACS is a routine approach to sort cells based on their physical characteristics as well as their cell surface antigen repertoire. Isolated cell populations can then be analyzed in a
wide range of downstream assays to facilitate a greater understanding of leukocyte biology in the axolotl.
Key words Salamander, Leukocyte biology, Myeloid cell, Flow cytometry and regeneration
Introduction
Urodele amphibians possess the remarkable capacity to resolve
injury in a range of clinically relevant organs such as the heart,
brain, and spinal cord as well as regenerate structures such as limbs
and tails [1]. Resolution of tissue injury triggers an inflammatory
response that is mediated by cells of the immune system, a mechanism conserved between mammals and vertebrates with robust
regenerative abilities [26]. Cells of the immune system can be
divided into two separate branches that include the evolutionarily
ancient innate immune cell populations and the more recently
evolved adaptive cell types. Adaptive immune cells comprise of T
and B lymphocytes. Innate immune cells include phagocytic cells
(monocyte, macrophage, and neutrophils), natural killer (NK)
cells, basophils, eosinophils, mast cells, and platelets.
205
206
Macrophages, in addition to their role as professional phagocytes,

also function as a source of both pro-inflammatory and anti-inflammatory
signals during tissue homeostasis and wound healing in mammals
[79]. Studies in the Mexican axolotl (Ambystoma mexicanum) have
demonstrated that myeloid cells accumulate in the blastema during the
early stages of limb regeneration and are most abundant at 4 days
postamputation [10]. Systemic macrophage depletion by clodronate
liposome delivery prior to amputation results in the failure of limb
regeneration. This is characterized by deregulation of key regenerative
genes and extensive fibrosis [10]. Interestingly this phenotype can be
rescued after the endogenous macrophage population is replenished
and the limb is reamputated, suggesting that there is a temporal requirement during the early stages of axolotl limb regeneration [10].
Delineating the roles of macrophages and other leukocyte subsets
during axolotl limb regeneration is a critical step in understanding
what molecular pathways permit efficient tissue injury resolution and
regeneration. However, understanding the molecular basis for macrophage dependence and the functions of other leukocytes during limb
regeneration has been impeded by the lack of established methods to
isolate these cells. Here we describe a protocol to isolate myeloid cells,
specifically monocytes and macrophages from the regenerating axolotl limb. This protocol incorporates intravenous delivery of reagents
used to label macrophages based on their physiological function. The
process of intravenous injection has yet to be formally described in the
axolotl and we provide a step-by-step guide for this procedure. In
addition we detail a protocol to magnetically deplete red blood cells
and enrich for leukocytes within the circulating blood. Together these
methods can be utilized in the axolotl to study leukocyte biology during homeostasis, inflammation, injury, and regeneration.
Materials
2.1 General
Reagents, Equipment,
and Consumables
1. Microsurgery scissors and forceps.

2. Disposable Pasteur pipettes, 35 mm Petri dishes.
3. 15 and 50 mL conical tubes and centrifuge tubes.
4. Cell strainers with 40 and 100 m pore size.
5. 5 mL round-bottom FACS tubes with 40 m cell strainer cap.
6. Poly-L-lysine microscope slides.
7. Mounting medium.
8. 0.5 M Ethylene diaminetetraacetic acid (EDTA), pH 8.0.
9. 10 Hanks balanced salt solution (HBSS).
10. HBSS-EDTA solution (0.7): To prepare 200 mL solution,
add 14 mL 10 HBSS to 184 mL sterile water. Add 2 mL 5 M
EDTA to this solution.
Methods for Axolotl Blood Collection, Intravenous Injection, and Efficient
207
11. Goat serum.

12. Blocking buffer solution: To prepare 50 mL add 1 mL goat
serum to 49 mL HBSS-EDTA solution.
13. Holtfreters stock solution: Dissolve 3.46 g of NaCl, 0.05 g of
KCl, 0.1 g of CaCl2, and 0.2 g of NaHCO3 in 1 L of water.
14. Holtfreters working solution (20 %): Dilute stock Holtfreters
solution 1:5 using sterile water.
15. Stereomicroscope with fluorescence attachment.
16. Microinjector with accessories.
17. Capillary glass filaments with an outer diameter of 0.94 mm.
2.2
Axolotl Surgery
1. 0.2 % ethyl-3aminobenzoate methanesulfonate salt (Tricaine).

For 1 L solubilize 2 g in 1 L Holtfreters working solution.
Adjust pH to 77.5. Store at 4 C away from light.
2. 2 MDa dextran-rhodamine: Solubilize 5 mg in 1 mL of 1
HBSS, aliquot, and store at 20 C.
2.3 Axolotl Limb

Blastema Isolation
and Tissue
Dissociation
1. 2 mg/mL collagenase II. For 10 mL solution, add 20 mg collagenase II to 10 mL HBSS-EDTA solution.

2. 100 mg/mL collagenase/dispase. Use at a 1:100 dilution.
3. gentleMACS C-Tubes (Miltenyi Biotec).
4. gentleMACS Dissociator (Miltenyi Biotec).
2.4 Antibody
Staining and Flow
Cytometry
1. 5 mg/mL 4,6-diamidino-2-phenylindole (DAPI). Use at a

1:2,000 dilution.
2. 0.5 mg/mL Isolectin B4. Use at a 1:50 dilution.
3. Axolotl specific anti-Pan Ig. A kind gift from Franoise
Salvadori. Use at a 1:400 dilution.
4. 2 mg/mL Streptavidin, Alexa Fluor 488 Conjugate. Use at a
1:200 dilution.
5. 2 mg/mL Anti-mouse IgG (H + L), Alexa Fluor 647
Conjugate. Use at a 1:1,000 dilution.
6. Standard flow cytometer and FACS machine.
2.5 Modified
Giemsa-Wright Stain
1. Cytospin centrifuge (Thermo Scientific or similar).

2. 133 mM dibasic sodium phosphate anhydrous (Na2HPO4).
Dissolve 18.89 g Na2HPO4 in 1 L of deionized water.
3. 133 mM monobasic potassium phosphate (KH2PO4). Dissolve
9.08 g KH2PO4 in 1 L of deionized water.
4. 133 mM Sorensons buffer pH 6.8. To prepare 100 mL, add
43.75 mL of 133 mM Na2HPO4 to 56.25 mL 133 mM
KH2PO4. Final pH should be assessed using a pH meter.
208
5. May Grnwald Stain. For 30 mL working dilution add

3.95 mL of May Grnwald Stain to 26.05 mL of 133 mM
Sorensons buffer pH 6.8.
6. Giemsa Stain. For 30 mL working dilution add 3.95 mL of
Giemsa Stain to 26.05 mL of 133 mM Sorensons buffer pH 6.8.
2.6 RNA Synthesis,
cDNA Synthesis,
and Quantitative
Polymerase Chain
Reaction
2.7 Isolation
of Circulating Blood
in the Axolotl
2.8 Magnetic
Separation Reagents
Using EasySep
1. RNAqueous-4 PCR Kit (Life Technologies).

2. SuperScript VILO cDNA Synthesis Kit (Life Technologies).
3. SYBR green.
4. Standard thermal cycler.
1. 25G SURFLO winged infusion set (Terumo Medical
Products).
2. 5 mL syringe.
1. 10 sodium dithionite. Add 0.95 g sodium dithionite to 5 mL
HBSS-EDTA solution.
2. EasySep magnet (STEMCELL Technologies).
Methods
It is recommended to prepare the necessary equipment and
reagents prior to performing any of the methods described in this
section. Working dilutions of any of the reagents described should
be prepared in advance unless indicated otherwise.
3.1 Time
Considerations
The protocols covered in Subheadings 3.43.7 (Fig. 1) span over

a 5-day period with animal injections performed on the first
(Subheading 3.4) and third (Subheading 3.5) days. Blastemas (the
mass of progenitor cells which gives rise to the new limb) are harvested on the fifth day (4 days postamputation) (Subheading 3.6).
Blastemas are immediately processed into single-cell suspensions
after which cells can be analyzed on a flow cytometer or sorted
using a FACS machine. The estimated time taken between
Subheadings 3.6 and 3.7 is approximately 45 h. Blastema isolation, tissue mincing, and bone removal require approximately
3090 min depending on the number of blastemas to be processed.
The enzymatic digestion and cell suspension filtration require
approximately 90 min. Antibody staining requires approximately
60 min. This estimation does not include the time required for
data acquisition on the flow cytometer or any methods thereafter.
In addition this estimation does not include the time taken to prepare any equipment, materials, and reagents.
The following red blood cell depletion protocol requires
approximately 90120 min to complete. The estimated time for
209
Fig. 1 Flowchart of the key steps performed to isolate and validate macrophages in the regenerating axolotl
limb. The time taken between the limb amputation and FACS is 5 days with surgery occurring on the first and
third days and tissue harvesting, processing, staining, and FACS all occurring on the fifth day
isolating blood using the winged infusion set is approximately

3060 min depending on the number of animals used. Sodium
dithionite treatment and magnetic depletion of red blood cells is
estimated to take 3060 min depending on the number of times
each sample is put through the EasySep magnet.
3.2
Ethics Approval
3.3 Animal
Maintenance
and Usage
3.4 Axolotl Limb

Amputation
Before proceeding with any animal experiments including the

methods described below, please ensure that the necessary animal
ethics approval is granted.
Axolotls (Ambystoma mexicanum) are maintained in 20 %
Holtfreters solution at 1922 C on a 12-h light, 12-h dark cycle.
To ensure enough cells are obtained for analysis, it is recommended
that the animals used be at least 1 year of age and measure between
15 and 20 cm (snout to tail).
1. Anesthetize axolotl in 0.2 % Tricaine. The time taken for an
axolotl to become completely anesthetized is size dependent.
This can take approximately 1020 min. An anesthetized axolotl will not react to a skin pinch performed with a pair of
surgical forceps (see Note 1).
2. Place the anesthetized axolotl onto the surgical stage lying on
its side.
3. Secure the forelimb with a pair of surgical forceps. Using a pair
of surgical scissors, amputate 1 mm below the wrist joint (for
a distal amputation) or 1 mm below the elbow joint (for a
proximal amputation) (see Note 2).
4. Place the axolotl into a fresh tank of 20 % Holtfreters solution. It takes approximately 1530 min for an anesthetized
axolotl of this size to regain its consciousness.
210
3.5 Intravenous
Injection of High
Molecular Weight
Dextran
1. Approximately 48 h prior to blastema isolation, animals should be

prepared for i.v. injection of 5 mg/mL 2 MDa dextran-rhodamine
by induction of anesthesia using 0.2 % Tricaine (see Note 1).
2. Thaw out an aliquot of 5 mg/mL 2 MDa dextran-rhodamine.
Use up to 100 g of dextran for a 20 cm-sized animal.
3. Place the anesthetized axolotl on the surgical stage underneath
a fluorescent microscope lying on its side.
4. Identify a suitable afferent vessel in a gill branch for intravenous injection (Fig. 2) (see Note 3).
5. Using a pair of forceps, snap off the tip of a pulled capillary
glass filament. The diameter of the capillary glass filament
should closely match the diameter inside the afferent vessel
chosen for injection.
Fig. 2 A representative diagram depicting intravenous delivery of soluble reagents

in the axolotl. The gills of the aquatic axolotl allow easy identification of the return
flow of oxygenated blood flow back to the heart in afferent vessels before distribution to peripheral tissues. Under a dissection microscope, afferent vessels can
be identified and capillary glass filaments (shown in green) can be used to deliver
drugs or other compounds directly into the bloodstream (color figure online)
211
6. Load capillary glass filament with 5 mg/mL 2 MDa dextranrhodamine using a 10 L pipette tip. Ensure that no air bubbles are present within the injection volume (see Note 4).
7. Load the capillary glass filament into the microinjector.
8. Perform intravenous injection into the afferent vessel under a
dissection microscope. Set injection pressure to 20 psi and
slowly eject 5 mg/mL 2 MDa dextran-rhodamine from the
glass needle into the target vessel using small pulses (510 ms)
(see Note 5).
9. Slowly withdraw capillary glass filament from afferent vessel
minimizing any damage to the vessel or surrounding tissue.
10. Slide a gloved finger over the injection site or hold it there for
up to 30 s to accelerate clotting. This will aid in sealing the
vessel at the entry point with skin mucus and minimize additional blood loss.
11. Using a fluorescent stereomicroscope, visualize a blood vessel
in the tail to confirm delivery of the fluorescent 5 mg/mL
2 MDa dextran-rhodamine. Cells lining the vessels and within
the bloodstream will be fluorescent for approximately 46 h
postinjection.
12. Place the axolotl into a fresh tank of 20 % Holtfreters solution
for recovery in quiet individual housing for at least 24 h.
3.6 Blastema
Isolation and Tissue
Dissociation
1. 48 h after dextran labeling, anesthetize the amputated axolotl

using 0.2 % Tricaine (see Note 1).
2. Cool C-tubes on ice. One C-tube is capable of processing two
to four blastemas.
3. Place the anesthetized axolotl on the surgical stage lying on its side.
4. Use a pair of forceps to secure the forelimb. Cut 2 mm below
the original line of amputation using a pair of surgical scissors.
5. Briefly wash any blood from the harvested blastema with
HBSS-EDTA solution.
6. Place the isolated blastema onto a 35 mm tissue culture dish
sitting on an elevated angle containing 3 mL of 2 mg/mL collagenase II in it. Harvest additional blastemas if required.
7. Use two forceps to carefully remove any pieces of bone or
cartilage from the blastema. Grip the bone/cartilage with a
pair of forceps and remove any tissues attached using a fresh
pair of sterilized surgical scissors.
8. Finely mince the blastema tissue with surgical scissors into
0.20.5 mm-wide pieces.
9. Transfer the minced blastema pieces into a C-tube along with
the 3 mL of 2 mg/mL collagenase II in the 35 mm tissue culture dish (see Note 6).
212
10. Rinse the tissue culture dish with an additional 3 mL of collagenase II. Transfer into the C-tube to ensure that all cells are
collected.
11. Add enough collagenase II to the C-tube to a final volume of
10 mL.
12. Add 100 L of collagenase/dispase (100 mg/mL) to the
10 mL 2 mg/mL collagenase II solution for a final concentration of 1 mg/mL (see Note 7).
13. Cap tube with lid, invert, and swirl gently to align the tissue to
the plastic blades of the C-tube.
14. Place the inverted C-tube onto the gentleMacs apparatus
ensuring that the C-tube is locked in place.
15. Run C-tube Heart 1 protocol. Maintain inverted position and
place on ice. Process additional C-tubes if required (see Note 8).
16. Wrap C-tubes with foil and place on a roller at room temperature. Leave for 1 h to digest (see Note 9).
17. Run C-tube Heart 2 protocol and place tubes on ice with the
lid facing upward. Process additional C-tubes if required.
18. Transfer the tissue suspension within each C-tube into a fresh
50 mL tube by passing through a 100 m cell strainer (see
Note 10).
19. Rinse the C-tube twice with 10 mL HBSS-EDTA solution and
pass through a 100 m cell strainer. The final volume should
be 30 mL.
20. Centrifuge the cell suspension at 350 g for 15 min at 4 C.
21. Aspirate supernatant and resuspend the pelleted cells with
blocking buffer solution at a final concentration of no more
than 1 106 cells/100 L.
3.7 Live-Cell
Antibody Staining
for Myeloid Cells
from the Limb
Blastema
1. All staining reactions are conducted in 1.7 mL microcentrifuge tubes (see Note 11).
2. Block cells on ice away from light for at least 20 min.
3. Prepare 1.7 mL microcentrifuge tubes with the correct dilution of primary antibody: 0.5 mg/mL biotinylated Isolectin
B4 (use at a 1:50 dilution).
4. Add 100 L to each individual 1.7 mL microcentrifuge tube.
Mix by flicking or pipetting up and down.
5. Incubate on ice away from light for at least 20 min (see Note 12).
6. Wash any unbound primary antibodies with 900 L of wash
solution (HBSS-EDTA) and mix thoroughly and centrifuge at
350 g at 4 C for 5 min (see Note 13).
7. Prepare a working dilution of combined secondary antibodies:
2 mg/mL Streptavidin Alexa Fluor 488 (1:200).
213
8. Aspirate supernatant and resuspend pellet in 100 L of 1:200

Streptavidin Alexa Flour 488. Incubate on ice, away from
light for a minimum of 10 min (see Note 14).
9. Wash any unbound secondary antibodies with 900 L of wash solution, mix thoroughly, and centrifuge at 4 C for 5 min (see Note 13).
10. Prepare a working dilution of DAPI (1:2,000).
11. Aspirate supernatant and resuspend pellet in 1:2,000 DAPI at
a final concentration of 1 106 cells/100 L. Transfer stained
cell suspension to a 5 mL FACS tube by passing cells through
a 40 m filter.
12. Proceed to analyze the single-cell suspensions using a flow cytometer. Alternatively cells can be sorted for applications in downstream assays using FACS. A gating strategy and the expected
results using this method are shown in Figs. 3 and 4, respectively.
3.8
Cytospin
1. Using a FACS machine, isolate 1050,000 cells per individual

population into 1.7 mL microcentrifuge tubes.
Fig. 3 FACS gating strategy on single-cell suspensions of blastemas obtained at 4 days postamputation. (a)
Forward scatter profile of crude blastema cell suspension analyzed by flow cytometry. Single cells are gated
on for downstream analysis using forward scatter area (FSC-A) and forward scatter (FSC). (b) Scatter profile of
single cells and tissue debris. Tissue debris are gated out using side scatter area (SSC-A) and forward scatter
area (FSC-A). (c) Scatter profile of nonviable cells and non-debris. Nonviable cells are excluded by DAPI staining as dead cells become permeable allowing DAPI to bind to the cells nucleus. (dg) Single-stain controls for
dextran-rhodamine (DEX) and Isolectin B4 (IB4). (d) Detection of DEX+ cells in unlabeled (negative control). (e)
Detection of DEX+ cells in positive control. (f) Detection of IB4+ cells in isotype (negative control). (g) Detection
of IB4+ cells in positive control
214
Fig. 4 Detection of myeloid cells in the regenerating axolotl limb at 4 days postamputation by flow cytometry.
(a) Four distinct populations can be detected when cells are co-labeled with DEX and IB4: DEX IB4, DEX
IB4+, DEX+ IB4+, and DEX+ IB4+. (b) Side scatter area (SSC-A) and forward scatter area (FSC-A) profiles of
each of the four individual populations are shown individually as indicated
2. Add blocking buffer solution to a final volume of 350 L to

the 1.7 mL microcentrifuge tubes.
3. Load poly-L-lysine slide and chamber into appropriate slots of
the Cytospin centrifuge.
4. Transfer the total 300 L of single-cell suspension into a
Cytospin chamber. Transfer any additional samples into separate Cytospin chambers if required.
5. Place lid of the Cytospin centrifuge over the samples and centrifuge at 1,600 g for 10 min.
6. Remove chambers from their slides without contacting the
smears.
7. Examine each slide under a microscope to ensure that the cells
have annealed to the slide.
8. Dry the slides overnight. Slides should be stored in a dry area
away from light (see Note 15).
3.9 Modified
Giemsa-Wright Stain
1. Transfer 30 mL of working dilution May-Grunwald and Giemsa

stains into separate slide mailers. Prepare an additional slide
mailer containing distilled water for the subsequent wash steps.
2. Transfer the poly-L-lysine slides into the slide mailer containing the May-Grunwald staining solution. Leave for 5 min at
room temperature.
3. Wash by transferring the slides into a slide mailer containing
distilled water. Ensure that any precipitation is removed.
215
Fig. 5 Modified Giemsa-Wright stains on sorted cell populations. (a) IB4 Dex cells consist predominantly of
red blood cells and nonmyeloid cells. (b) IB4+ Dex cells consist of a heterogeneous population of myeloid
cells including cells with mononuclear phagocyte morphology (monocytes and macrophages) as well as cells
with polymorphonuclear morphology (neutrophils). (c) IB4+ Dex+ cells are a homogenous population of cells
displaying clear mononuclear phagocyte morphology. (d) IB4 Dex+ cells comprise of a heterogeneous population of cells displaying nonmyeloid cell morphology. This includes cells with dark round nuclei with small
spherical cytoplasm and cells with dendritic/fibroblast-like morphology displaying light colored large elliptical
nuclei with large elongated multipolarized cytoplasm. Scale bars indicate 50 m
4. Transfer slides into the slide mailer containing a working dilution of Giemsa staining solution. Leave for 15 min at room
temperature.
5. Wash by transferring slides into a slide mailer containing fresh
distilled water. Ensure that any precipitation is removed.
6. Air dry slides (see Note 16).
7. Mount slides using mounting media and coverslip.
8. Slides can then be stored or imaged using a color microscope.
Examples of the expected results for each of the FACS-isolated
cell populations in the regenerating limb are shown in Fig. 5.
3.10 Isolation of RNA
from FACS-Sorted
Cells
1. Centrifuge isolated cell populations at 350 g at 4 C for

5 min (see Note 17).
2. Aspirate and resuspend pellet in 350 L of lysis/binding solution.
Lyse cells thoroughly by pipetting or vortexing (see Note 18).
3. Add equal volume of 64 % ethanol (final volume of 700 L) to
the lysate and mix gently by pipetting.
4. Transfer lysate/ethanol mixture into filter cartridge assembled
in a collection tube.
5. Centrifuge at 15,000 g for 1 min. Discard flow through.
6. Add 700 L of wash solution 1. Centrifuge at 15,000 g for
1 min and discard flow through and reuse collection tube for
washing steps.
7. Add 500 L of wash solution 2/3. Centrifuge at 15,000 g
for 1 min and discard flow through. Repeat twice.
8. Transfer filter cartridge into a fresh collection tube. Add
3050 L of elution buffer and centrifuge at 15,000 g for
1 min.
216
3.11 DNase1
Treatment and DNase
Inactivation
1. Add 0.1 volume of 10 DNase1 and 1 L of DNase1 to the

RNA sample in elution buffer. Incubate at 37 C for 1530 min.
2. Add 0.1 volumes DNase inactivation reagent. Mix gently and
incubate at room temperature for 2 min. It is recommended to
mix the DNase inactivation reagent by vortexing prior to use.
3. Centrifuge the tube at 10,000 g for 1 min to pellet the DNase
inactivation reagent.
4. Transfer RNA solution into fresh microcentrifuge tube leaving
behind the DNase inactivation reagent pellet.
5. Measure RNA quality and concentration via a spectrophotometer.
6. Store at 20 C until further use.
3.12
cDNA Synthesis
1. For a single cDNA synthesis reaction, combine the following

components in a 0.2 mL PCR tube on ice. If multiple reactions are being performed, it is recommended to prepare a
master mix without the RNA samples (see Note 19).
Component
Volume
5 VILO Reaction Mix
4 L
10 SuperScript Enzyme
Mix
2 L
RNA (up to 2.5 g)
X L
DEPC-treated water
To 20 L
2. Gently mix and incubate at 25 C for 10 min.

4. Terminate reaction at 85 C for 5 min.
5. Store at 20 C until further use.
3.13 Quantitative
Real-Time PCR Gene
Expression Analysis
1. Quantitative polymerase chain reaction (qPCR) assays are performed using SYBR green and analyzed using a thermal cycler
instrument.
2. cDNA samples synthesized from the RNA of cell populations
isolated by FACS at 4 days postamputation can be analyzed for
gene expression relative to whole blastema tissue at 4 days
postamputation.
3. Gene expression levels are calculated using the Pfaffl method
and is normalized using the geometric mean of at least two
housekeeping (normalizer) genes.
4. Repeat experiments at least three times from two biological replicates containing cDNA pooled from eight individual blastemas.
5. Primer sequences used in qPCR gene expression analysis are
listed in Table 1.
217
Table 1
Primer sequences used for qPCR
Primer
Forward
Reverse
RBL27
CATCAGATCAAGCAAGCAGTA
CCAATGCAGCAGTTTAGATG
B-actin
TCCATGAAGGCTGCCCAACT
TGGCGCCACATCTGATTGAT
CD11b
CTCGCCCTACTGTGGATTGT
AAGGCCACCTTCTCCAGATT
Neutrophil
elastase
CGCCTCCCTACAGTTCAGAG
ATCGGACTCATTCCATCCAA
Myeloperoxidase
TCAACAGCTGGAGAATCGTG
ATGTTGATGGCGGCTAAATC
CSF1R
CTCCAGGATGGGACTGTCAT
CCGCTTGGAGGTAGAGTCTG
MPEG1
CTTGCAAGACAGTTCGTCCA
TGGTTCGGTTTCCCAGATAG
MMP9
GCATCGTAGGATTCTCCATCA
ACCAGTGAAGGCCGTTCCGAT
VEGFR2
ACTGAAAACGCTGGGAAATG
AGAAGGTGGTGGTGTCCAAG
VCAM1
AAGACGACCGAAGTGTACGT
CCTGGTGAGTTTCAAGGTGC
ICAM1
AGCATAACGGCAAGATGGTC
GGATTTTCCCTCAATCAGCA
EpCAM
TAATGGCACAGACACCTGCT
TCTGCAACGTCATTCTCAGG
Collagen A2
ACCTGGTGGAAAGGGAGACT
GAAGATCCAGGTTCCCCATT
Fibronectin
ATTGCGTACTCCCAACTTCG
ACATGCTTCTCCCACGAGTC
3.14 Isolation
of Peripheral Blood
in the Axolotl
1. Anesthetize the axolotl in 0.2 % Tricaine (see Note 1).

2. Place anesthetized axolotl onto surgical stage on its back with
the ventral side facing up (Fig. 6).
3. Place a pad of lint-free tissue under the loose skin of the ventral side of the head to expose the gill branches and efferent
vessels.
4. Prepare cold HBSS-EDTA solution in a 50 mL tube.
5. Connect a 25G winged infusion set to a 5 mL syringe. Wash
the tubing of the winged infusion set by drawing 3 mL of
HBSS-EDTA solution into the 5 mL syringe. Flush 2 mL
HBSS-EDTA solution out of the 5 mL syringe (see Note 20).
6. Using one hand to hold the wings of the infusion set, gently insert
the needle into an efferent vessel. Take care to insert the needle
into the vessel and not through to the other side (see Note 21).
7. Using the remaining free hand, slowly draw blood from the
efferent vessel through the connecting tube and into the
syringe. A maximum of 10 % of total blood volume can be
drawn from one animal (see Note 22).
8. Slowly withdraw the needle minimizing any damage to the
vessel or surrounding tissue.
218
Fig. 6 Isolation of peripheral blood in the adult axolotl. Deoxygenated blood vessels in the gills can be exposed
after a pad of lint-free tissue is placed under the ventral side of the head. This allows easy access to insert the
needle of the SURFLO winged infusion set into the vessels shown in blue (color figure online)
9. Transfer blood into a 15 mL tube containing cold HBSSEDTA solution (see Note 23).
10. Slide a gloved finger over the injection site or hold it there for
up to 30 s to accelerate clotting. This will aid in sealing the
vessel at the entry point with skin mucus and minimize additional blood loss.
11. Place the axolotl into a fresh tank of 20 % Holtfreters solution, for recovery in quiet individual housing for at least 24 h.
3.15 Magnetic
Depletion of Red Blood
Cells Using EasySep
Magnets
1. Chill EasySep magnets on ice prior to use.

2. Prepare 1 concentration of sodium dithionite from 10 stock
solution (see Note 24).
3. Centrifuge peripheral blood for 10 min at 350 g at
4 C. Remove the supernatant.
4. Resuspend cell pellet in 1 sodium dithionite solution (solution should turn dark red-purple color).
5. Pour 3 mL of resuspended cell solution into 5 mL polystyrene
FACS tube and slot into EasySep magnet (ensure that tube
does not go all the way through).
6. Pour the remaining 3 mL of cell suspension into separate
5 mL polystyrene FACS tube and slot into a separate magnet.
(Alternatively if two magnets are not available, cells can be
resuspended in 4 mL and performed in one tube.)
7. Incubate on ice for 5 min. During this time red blood cells will
become magnetically attracted toward the walls of the 5 mL
polystyrene FACS tube and EasySep magnet.
219
8. Without removing the tube from the EasySep magnet, pour

out cell solution into a new 5 mL polystyrene FACS tube. Any
cells that are not bound to the magnet will pour out into the
next tube (see Note 25).
9. Place the new 5 mL polystyrene FACS tube with the first
round of depleted red blood cells into EasySep magnet and
incubate on ice for 5 min.
10. Repeat steps 8 and 9 in Subheading 3.14 and at least four
times (see Note 26).
11. Transfer 1 solution of sodium dithionite cell suspension into
a 50 mL Falcon tube and add blocking buffer solution to a
final volume of 30 mL.
12. Wash out sodium dithionite by centrifuging cells for 15 min at
350 g at 4 C.
13. Remove supernatant. The cell pellet should have a visible layer
of white blood cells.
Proceed to downstream experiments such as direct culturing of
cells or flow cytometric analysis. The following steps provide an
example of how to perform live-cell staining prior to flow cytometric analysis. This method follows the same live-cell staining method
described in Subheading 3.7.
1. Resuspend the cell pellet in blocking buffer solution at a final
concentration of no more than 1 106 cells/100 L.
2. Block on ice for a minimum of 20 min.
3. Prepare primary antibodies: 0.5 mg/mL Isolectin B4 (1:50)
and axolotl monoclonal antibody Pan Ig (1:400). Incubate
the cells on ice away from light.
4. Add 100 L to each individual 1.7 mL microcentrifuge tube
and mix by flicking or pipetting.
5. Incubate on ice away from light for at least 20 min (see Note 12).
6. Wash any unbound primary antibodies with 900 L of wash
solution (HBSS-EDTA), mix thoroughly, and centrifuge at
350 g at 4 C for 5 min (see Note 13).
7. Prepare a working dilution of combined secondary antibodies:
2 mg/mL Streptavidin, Alexa Fluor 488 (use at a 1:200 dilution) and 2 mg/mL Anti-mouse IgG (H + L), Alexa Fluor
647 Conjugate (use at a 1:1,000 dilution).
8. Aspirate supernatant and resuspend pellet in 100 L of combined secondary antibody solution. Incubate on ice, away
from light for a minimum of 10 min (see Note 14).
9. Wash any unbound secondary antibodies with 900 L of wash
solution, mix thoroughly, and centrifuge at 4 C for 5 min (see
Note 13).
10. Prepare a working dilution of DAPI (1:2,000).
220
105
10
105
IB4
0.076%
10
103
IB4
9.27%
103
102
Pan Ig
0.027%
102
Pan Ig
9.44%
0
-102
-102
0
102
103
104
105
102
103
104
105
Fig. 7 Leukocytes can be enriched from total peripheral blood following magnetic depletion of red blood cells
using the EasySep system. A comparison between normal peripheral blood (left) and leukocyte-enriched (right)
samples using flow cytometric analysis. Treatment with sodium dithionite allows for red blood cells to be depleted.
This results in an over 100-fold increase in the detection of innate (IB4) and adaptive (Pan Ig) immune cells
11. Aspirate supernatant and resuspend pellet in 1:2,000 DAPI at

a final concentration of 1 106 cells/100 L. Transfer stained
cell suspension to a 5 mL flow cytometry tube by passing cells
through a 40 m filter.
12. Proceed to analyze cell populations using a flow cytometer. An
example of the expected result is shown in (Fig. 7).
3.16 Expected
Results
and Conclusions
Here we describe a protocol that enables the isolation of myeloid

cells at the 4-day postamputation time point. This method is
designed to isolate cells using commercially available reagents and
specialized laboratory equipment. This method incorporates intravenous delivery reagents into the axolotl. For our experiments we
have used 2 MDa dextran-rhodamine. Alternative soluble reagents
may also be delivered using this method. The 2 MDa dextran is
taken up by macrophages via macropinocytosis, the endocytic
function by which large antigens are captured [11]. Cells are liberated through a combination of mechanical and enzymatic digestion where the extracellular matrix components are digested. This
allows for a single-cell suspension to be obtained. These cells are viable in abundance and maintain their surface antigens. Preservation
of the cell surface integrity enables live-cell surface labeling using
antibodies which identify activated myeloid cells that can be later
analyzed using flow cytometry [12].
We demonstrate that a distinct population is labeled by both
dextran-rhodamine and Isolectin B4 a marker of activated myeloid
cells in the axolotl: DEX+ IB4+ (Fig. 4a) [13]. The DEX+ IB4+
221
population is shown to be homogenous in morphology displaying

typical mononuclear phagocyte characteristics are large in size
(Fig. 5c). The large cell size observed is consistent with side scatter area (SSC-A) and forward scatter area (FSC-A) profile observed
on the flow cytometer (Fig. 4b). In addition a heterogeneous
population of myeloid cells can be detected within the DEX
IB4+ population (Fig. 4). This includes the presence of polymorphonuclear cells (neutrophils) and mononuclear cells (monocytes
and macrophages) (Fig. 5b). Gene expression analysis on these
cell population confirms that both the DEX IB4+ and DEX+
IB4+ are highly enriched for genes expressed by myeloid cells
(CD11b), neutrophils (neutrophil elastase and myeloperoxidase),
and monocytes and macrophages (CSF1R and MPEG1) (Fig. 8).
Conversely the DEX IB4+ and DEX+ IB4+ populations are not
enriched for genes expressed by other mesenchymal cell types
found in the regenerating limb such as fibroblasts and endothelial
cells (Fig. 9). Together these results demonstrate a validated
approach to isolate an abundant population of myeloid cells with
specific enrichment of monocytes and macrophages in the regenerating axolotl limb.
Fig. 8 Gene expression analysis on sorted cell populations using qPCR. Gene expression is relative to a whole
blastema at 4 days postamputation. DEX IB4+ and DEX+ IB4+ cells are enriched for genes restricted to the
myeloid lineage in comparison to DEX IB4 and DEX+ IB4 cells. DEX IB4+ cells are a heterogeneous
population of myeloid cells indicated by high enrichment of myeloid cells (CD11b), neutrophils (neutrophil
elastase and myeloperoxidase), and monocytes/macrophages (CSF1R). In contrast DEX+ IB4+ cells are predominantly enriched for monocyte and macrophage genes (CSF1R, MPEG1, and MRC-1)
222
Fig. 9 Gene expression analysis on sorted cell populations using qPCR. Gene expression is relative to a whole
blastema at 4 days postamputation. DEX IB4+ and DEX+ IB4+ cells are not enriched for genes commonly
expressed by endothelial cells (VEGFR2, VCAM1, and ICAM), epithelial cells (EpCAM), and fibroblasts (Col1a2
and fibronectin) in comparison to DEX IB4 and DEX+ IB4 cells
In addition to the macrophage isolation protocol, we have also

described a method to enrich for leukocytes in peripheral blood
(Fig. 7). This method can be utilized to study different leukocyte
subsets during homeostasis and injury. Limb amputation results in
the induction of inflammatory signals that lead to the recruitment
of different leukocyte subsets that include monocytes from the
peripheral blood [6]. Infiltrating peripheral blood monocytes play
various roles during the resolution of inflammation and regeneration. In addition peripheral blood-derived monocytes are known
to contribute to the local tissue macrophage population, which
also have important roles during homeostasis and wound healing
[1418]. We have therefore developed a protocol to deplete red
blood cells from peripheral blood to effectively enrich for leukocytes that can be easily detected using flow cytometry (Fig. 9). To
demonstrate the utility of this strategy, we have used the activated
myeloid cell marker Isolectin B4 and axolotl specific panimmunoglobulin marker Pan Ig [12, 13, 19]. We demonstrate that
this strategy allows for over a 100-fold enrichment of leukocytes by
flow cytometric analysis. This enables cells to be concentrated in a
smaller volume, significantly decreasing the time required to analyze and isolate cells on the flow cytometer.
223
The protocols described in this chapter provide a detailed

guide to isolate cells from the myeloid lineage including macrophages from the axolotl blastema as well as enrich for leukocytes
found in the circulating blood. We have shown that a combination of physiological and cell surface labeling techniques is capable of identifying distinct myeloid cell populations in the
regenerating limb. Leukocytes from the circulating blood can be
enriched by magnetically depleting nucleated red blood cells after
treatment with sodium dithionite. Both protocols are ideal for
isolating specific cell populations that can be utilized in other
downstream applications such as cytochemistry staining, gene
expression analyses, and in vitro assays. More significantly these
protocols provide methods that can be used to aid in the study of
macrophages and additional leukocyte subsets in the context of
the regenerating axolotl limb.
Notes
1. The percentage of Tricaine used to anesthetize the axolotl is
dependent on the size of the animal. It is necessary to adjust
this percentage to avoid any potential lethal doses. For
example, animals that are 3 cm (snout to tail) in size are
routinely anesthetized using 0.05 % Tricaine, whereas 0.2 %
Tricaine is used in animals that are greater than 15 cm
(snout to tail) in size.
2. It is recommended that surgeries are performed under a dissection microscope. Following amputation of the limb (proximal or distal), it is common to find that the bone/s have not
been completely removed. To prevent any bone/cartilage
protruding into the regenerating wound epithelium, it is recommended that bones be trimmed to fall in line with the plane
of amputation.
3. Choosing an injection point in an afferent vessel upstream of
branch points will assist in maintaining a continuous mixture
of the reagent into the oxygenated blood flow back to the
heart. This is especially important for fine vessels where blood
flow from other vessels downstream will help pull the blood
flow toward the heart.
4. Capillary glass filaments of 0.94 mm diameter are most suitable in our hands but other diameters can also be used.
Optimizing the parameters for pulling glass filaments should
be determined empirically and long fine needles can have their
tips snapped to an appropriate size.
5. Injection of air into the bloodstream should be avoided in all
instances.
224
6. Alternatively, isolated blastemas may be placed into microcentrifuge tubes containing 500 L of 2 mg/mL collagenase II. Using a pair of surgical scissors, users can take
advantage of the microcentrifuge tubes curved bottom to
mince the blastema into fine pieces. It is important that all
tissue pieces are cut very finely and there are no large chunks
remaining when using this method to avoid any potential
jamming of the C-tube during tissue processing stage using
the gentleMacs.
7. In addition, it is recommended that 2 L of DNase1 (1 mg/
mL) is added to the final solution to prevent any clumping
of cells.
8. Additional protocols on the gentleMacs can be utilized;
however, we have found that the two-step heart isolation protocol gives the best ratio of total viable cells.
9. The minimum time C-tubes can be placed on a roller at room
temperature is 40 min; lower incubation time decreases yield
of cells. Incubation times spanning greater than 2 h results in
a decrease in cell viability.
10. This protocol does not yield cells from the epidermal layer
(skin). Therefore, it is expected that there will be tissue that is
not digested. This will appear as small white pieces and will
not pass through the 100 m cell strainer.
11. In order to maximize cell viability, it is recommended that all
steps in this section be carried out on ice.
12. Normal time for primary antibody incubation is approximately
4060 min. We have found that this can be decreased to a
minimum of 20 min without any decrease in efficiency of antibody binding capacity.
13. More than 900 L of wash solution can be used. Additional
washes can be performed but are not necessary.
14. Normal time for secondary antibody incubation is approximately 30 min. We have found that this can be decreased to a
minimum of 10 min without any decrease in secondary antibody binding capacity to the primary antibody.
15. Cells can be fixed onto the side using 4 % paraformaldehyde.
16. Slides can be left to dry overnight and mounted the next day.
17. For this protocol we have chosen to use the commercially
available RNA isolation kit from Life Technologies. Other
RNA isolation kits may be used in this method.
18. The exact volume of lysis/binding solution used is not critical.
A general tip is that low-end volumes (100 L) be used for
fewer cells (<1,000 cells) and high-end volumes (500 L) used
for large amounts of cells (1 107 cells).
225
19. For this protocol we have chosen to use the commercially

available cDNA synthesis kit available from Invitrogen. Other
cDNA synthesis kits may be used in this method.
20. Flushing the winged infusion set with ice-cold HBSS-EDTA
solution will minimize clotting within the tubing.
21. The pressure required to draw the blood is low when correctly
positioned within a vessel. Do not apply too much pressure as
vessels may collapse and cause clotting.
22. Blood collection of more than 10 % total blood volume in any
3-week period is not recommended. For a point of reference,
approximately 1 mL of blood can be drawn from animals
1520 cm in size (snout to tail). Collection of blood exceeding 15 % of total blood volume may require special permission
from local ethics committees.
23. The collected blood can be used directly for some applications; however, spinning for 15 min at 350 g will separate
blood cells from platelets, serum, and clotting factors and
allow other downstream applications.
24. Sodium dithionate is an oxidizing agent. In order to ensure
optimal leukocyte enrichment and viability, it is recommended
that the 10 stock solution is prepared fresh, shortly before
making the final 1 dilution.
25. When pouring out cells dark red/purple droplet will remain at
the edge of the tube. Do not transfer this into the subsequent
tube.
26. Subsequent rounds of red blood cell depletion can be performed by repeating steps 8 and 9 in Subheading 3.6.
Acknowledgments
We thank Nadia Rosenthal and the members of her laboratory for
the advice and helpful discussions. We thank members of the
FlowCore facility at Monash University for performing FACS
experiments. This work was supported by grants from Stem Cells
Australia (Australian Research Council). The Australian
Regenerative Medicine Institute is supported by grants from the
State Government of Victoria and the Australian Government.
References
1. Tanaka EM, Reddien PW (2011) The cellular
basis for animal regeneration. Dev Cell 21:
172185
2. Harty M, Neff AW, King MW, Mescher AL
(2003) Regeneration or scarring: an immunologic perspective. Dev Dyn 226:268279
3. Mescher AL, Neff AW (2005) Regenerative

capacity and the developing immune system.
Adv Biochem Eng Biotechnol 93:3966
4. Godwin JW, Brockes JP (2006) Regeneration,
tissue injury and the immune response. J Anat
209:423432
226
5. Mescher AL, Neff AW, King MW (2013)

Changes in the inflammatory response to
injury and its resolution during the loss of
regenerative capacity in developing Xenopus
limbs. PLoS One 8:e80477
6. Godwin
JW,
Rosenthal
N
(2014)
Differentiation. Differentiation 87:6675
7. Delavary BM, van der Veer WM, van Egmond
M (2011) Macrophages in skin injury and
repair. Immunobiology 216:753762
8. Newman AC, Hughes CCW (2012)
Macrophages and angiogenesis: a role for Wnt
signaling. Vasc Cell 4:13
9. Tidball JG, Dorshkind K, Wehling-Henricks M
(2014) Shared signaling systems in myeloid cellmediated muscle regeneration. Development
141:11841196
10. Godwin JW, Pinto AR, Rosenthal N (2013)
Macrophages are required for adult salamander
limb regeneration. Proc Natl Acad Sci U S A
110:94159420
11. Lim JP, Gleeson PA (2011) Macropinocytosis:
an endocytic pathway for internalising large
gulps. Immunol Cell Biol 89:836843
12. Miron VE, Boyd A, Zhao J-W, Yuen TJ, Ruckh
JM, Shadrach JL, van Wijngaarden P, Wagers
AJ, Williams A, Franklin RJM, ffrench-Constant
C (2013) M2 microglia and macrophages drive
oligodendrocyte differentiation during CNS
remyelination. Nat Neurosci 16:12111218
13. Zammit PS, Clarke J, Golding JP, Goodbrand
IA, Tonge DA (1993) Macrophage response
14.
15.
16.
17.
18.
19.
during axonal regeneration in the axolotl

central and peripheral nervous system.
Neuroscience 54:718719
Gordon S, Taylor PR (2005) Monocyte and
macrophage heterogeneity. Nat Rev Immunol
5:953964
Shi C, Pamer EG (2011) Monocyte recruitment
during infection and inflammation. Nat Rev
Immunol 11:762774
Davies LC, Jenkins SJ, Allen JE, Taylor PR
(2013) Tissue-resident macrophages. Nat
Immunol 14:986995
Pinto AR, Paolicelli R, Salimova E, Gospocic J
(2012) An abundant tissue macrophage population in the adult murine heart with a distinct
alternatively-activated macrophage profile.
PLoS One 7:e36814
Epelman S, Lavine KJ, Beaudin AE, Sojka DK,
Carrero JA, Calderon B, Brija T, Gautier EL,
Ivanov S, Satpathy AT, Schilling JD,
Schwendener R, Sergin I, Razani B, Forsberg
EC, Yokoyama WM, Unanue ER, Colonna M,
Randolph GJ, Mann DL (2014) Embryonic
and adult-derived resident cardiac macrophages are maintained through distinct mechanisms at steady state and during inflammation.
Immunity 40:91104
Tournefier A, Guillet F, Ardavin C,
Charlemagne J (1988) Surface markers of axolotl lymphocytes as defined by monoclonal
antibodies. Immunology 63:269276
Chapter 18
Assessing Cardiomyocyte Proliferative Capacity
in the Newt Heart and Primary Culture
Abstract
Unlike humans, adult newts possess extraordinary abilities to functionally regenerate lost and injured
organs, including cardiac muscle. The most remarkable feature of mature newt cardiomyocytes is their
ability to reenter the cell cycle, undergo cell division, and serve as a reservoir for progenitor cells. There
are, however, a number of unsolved questions concerning the cellular and molecular mechanisms that
underlie this plasticity; for example, we still lack a deeper understanding of the cell-inherent properties of
newt cardiomyocytes and to what degree they differ from their mammalian counterparts. Along with considerable morphological changes at the wound site, a striking feature shared by different regenerating tissues in the newt is an extensive and dynamic remodeling of the extracellular environment. The dynamic
signaling between cardiomyocytes and extracellular environment is of eminent importance in the control
of the differentiated state of the cell, but the molecular details remain elusive. In this chapter, we describe
methods to assess cardiomyocyte proliferation in vivo and enrich primary cardiomyocytes from newt hearts
to study their behavior, taking extracellular matrix components into consideration.
Key words Heart regeneration, Cardiomyocyte proliferation, EdU, Cardiomyocyte culture,
Extracellular environment, ECM
Introduction
1.1 In Vivo Cardiac

Regenerative
Activities
The regenerative ability of the adult mammalian heart is very

limited. Adult mammalian cardiomyocytes withdraw from the cell
cycle soon after birth and the default response to damage is characterized by formation of a collagen-rich scar. In contrast, after
injury newt cardiomyocytes can proliferate and contribute to the
functional restoration of the tissue architecture without scarring.
Three different injury models have been described: (1) surgical
resection of approximately 20 % of the ventricular apex [1, 2], (2)
needle puncture of the ventricle wall and removal of pierced tissue
[3], and (3) internal cardiomyocyte crushing using mechanical
squeezing of the heart [4, 5]. In each case, bleeding is arrested by
the formation of a blood clot and minor myocardial contraction.
227
228
Fig. 1 Time course of cardiac regeneration. Cardiac injury induces the deposition of a tenascin-C (TNC)-rich
transitional extracellular matrix (green). While the unamputated heart contains only a few cells actively synthesizing DNA (EdU = white), there is a substantial proliferative response throughout the myocardium between 7
and 35 dpa. Cardiac muscle is labeled with MF20 (red). White dotted lines demarcate the amputation site.
Scale bar: 400 m; dpa days postamputation
Within 23 days postamputation (dpa), a dense fibrin matrix

replaces the clot, and dedifferentiation of a subset of cardiomyocytes is thought to begin during this early regenerative period, as
emphasized by downregulation of cardiac markers, such as
-myosin heavy chain and cardiac troponins [4, 5]. Along with
these changing intracellular activities, we identified a dramatic
reorganization of the ECM (Fig. 1). A transitional extracellular
matrix (ECM) that is shared by different regenerating tissues and
bears astounding similarities to matrix components critical in
embryonic development [1, 610] apparently provides cues to the
embedded cells and controls the temporal and spatial regulation of
cardiac regeneration [1]. Mounting evidence suggests that this cellular dedifferentiation facilitates cardiomyocyte proliferation with
significant cell cycle reentry beginning by 7 dpa (Fig. 1). There is
some controversy as to the location of the proliferative activity [1,
3, 11, 12]; however, recent work using pulse-chase labeling techniques in our laboratory revealed a dynamic redistribution of proliferative cells from cell cycle reentry to the final destination at the
site of tissue replacement [1]. Cell proliferation gradually subsides
and the expression of mature muscle markers returns, with functional restoration of the wound by 6070 dpa (Fig. 1) [3, 4].
1.2 In Vitro
Cardiomyocyte
Activities
Long-term cultures revealed that the majority of newt cardiomyocytes can enter into S phase. Surprisingly, while all cells were
exposed to serum-containing medium, only about a third of newt
cardiomyocytes went through more than one complete cycle of
cell division [2]. Interestingly, the picture from in vivo labeling
studies after injury of the newt ventricle also indicates that only a
subset of differentiated cardiomyocytes seem to be responsible for
the increase in cell number observed upon regeneration [1]. It is
Newt Cardiomyocytes in vivo and in vitro
229
noteworthy that S phase entry seems apparently driven by

serum-induced pathways that are dependent on Rb inactivation
and shared in cardiomyocytes and skeletal myotubes [2]. We found
that ECM components that reflect the cellular environment during
regeneration promote similar behaviors of cultured cardiomyocytes and skeletal myotubes, including proliferation [1, 6, 13].
Thus, experimental evidence suggests that newt primary cardiomyocyte cultures reflect properties of the population of cardiomyocytes after heart injury and can account for these properties at
the single-cell level [1, 2]. However, the heterogeneity in proliferative potential remains an important question. In this regard, it is of
interest to test the functional properties of various ECM components in isolation and combination on cardiomyocyte explants.
A molecular comparison of the cells in culture should help elucidate the regulation of the differentiated state and cell cycle progression in adult cardiomyocytes. This chapter provides an
experimental toolbox ranging from in vivo to in vitro assessment of
single cardiomyocytes, which we believe is important for an integrated perspective of their functional properties.
Materials
Prepare all solutions using ultrapure water and analytical-grade
reagents. Prepare and store all reagents at room temperature
(unless indicated otherwise). Diligently follow all waste disposal
regulations when disposing waste materials. The use of animals
must follow the guidelines of and be approved by the Institutional
Animal Care and Use Committee.
2.1 Surgical
Procedures
1. Six to eight adult newts per preparation.

2. Newt water: Deionized and dechlorinated water supplemented
with 0.0375 % Instant Ocean (available from suppliers of
aquarium supplies). We use Instant Ocean salt at a very low
concentration, which is not comparable to the concentrations
typically used in saltwater aquariums.
3. Anesthesia solution: 0.1 % w/v ethyl 3-aminobenzoate methanesulfonate salt (Tricaine) in 0.0375 % Instant Ocean.
4. IC-spacing perfboard (approximately 13 cm 8 cm) (available
from suppliers of electronic components).
5. Stretch Magic elastic cord.
6. Alcohol-free povidone-iodine (Betadine).
7. Forceps, No. 5 forceps, fine spring scissors, and microscissors.
Sterilize in autoclave.
8. C-13 Sofsilk sutures.
9. Recovery tanks: Clear plastic containers (30 cm 18 cm 13 cm)
with cover, filled with approximately 1.0 L newt water.
230
2.2 Collection
of Regenerating
Tissue
1. Tissue-Tek OCT compound.
2.3 Monitoring
Proliferative
Progenitor Cells
1. Phosphate buffered saline (PBS).
2. Dry ice slurry in isopentane.
2. 1 mM 5-ethynyl-2-deoxyuridine (EdU, Invitrogen) in 70 %

PBS.
3. 100 mM thymidine in 70 % PBS.
4. 4 % paraformaldehyde (PFA) in PBS.
5. 0.5 % Triton X-100 in PBS.
6. Blocking buffer: 20 % goat serum, 0.2 % bovine serum albumin (BSA), 50 mM ammonium chloride, 25 mM glycine,
25 mM lysine, and 0.02 % sodium azide in PBS.
7. EdU detection buffer: 1 ng/mL Alexa Fluor (AF) 594
conjugated azide (Life Technologies) diluted in 100 mM
TrisHCl (pH 8.5), 1 mM copper (II) sulfate, and 100 mM
ascorbic acid.
8. 0.1 % Tween-20 in PBS.
9. Nonfluorescent mounting medium (e.g., FLUORO-GEL).
2.4 Imaging Cellular

and Extracellular
Proteins and Matrices
1. Superfrost Plus slides.

2. 0.5 % Triton X-100 in PBS.
3. Blocking buffer: 20 % goat serum, 0.2 % bovine serum albumin (BSA), 50 mM ammonium chloride, 25 mM glycine,
25 mM lysine, and 0.02 % sodium azide in PBS.
4. Antibodies: Primary antibody information to detect cellular
and extracellular matrix proteins is summarized in Table 1. All
primary antibodies were tested for species specificity with
appropriate controls. ECM antibodies have been verified in the
newt model [1, 6, 13]. For immunofluorescence studies, primary antibodies were detected with appropriate species-specific
Alexa Fluor (AF)-conjugated secondary antibodies, Table 2.
5. 0.1 % Tween-20 in PBS.
6. Biotinylated hyaluronic acid binding protein
Calbiochem), 1 g/L in PBS with 0.2 % BSA.
(HABP,
7. Avidin/biotin blocking kit (Zymed Labs).

8. Hyaluronic acid sodium salt (Calbiochem) 1 mg/mL.
2.5 Collection
of Myocardial Tissue
for Primary Cultures
1. Sterile 60 mm plastic cell culture dish.

2. 70 % L15 media. Use sterile ddH2O to dilute the medium
to 70 %.
3. 70 % L15 media supplemented with 1 pen/strep/
fungizone.
231
Table 1
Primary detection reagents used for immunohistochemistry
Probe
Company
Product no. Host
Dilution
Antigen/source
Tenascin-C
Millipore
AB19013
Rabbit
1:500
Embryonic chick
brain
Fibronectin
Sigma
F0791
Mouse
IgG1
1:200
IST-3 hybridoma
HABPbiotinylated
Calbiochem
385911
Bovine
1:300
Bovine nasal
cartilage
MF20
DSHB
MF20
Mouse
IgG2b
1:2,000 ascites;
Light meromyosin
1:300 Bioreactor
supernatant
Wilms Tumor 1
Calbiochem
CA1026
Rabbit
1:150
Human WT1
3377
Rabbit
1:200
Ser10 of human
histone H3
Phospho-histone Cell Signaling

H3
Technology
See Note 6
Table 2
Secondary detection reagents used for immunohistochemistry
Fluorophore
Company
Product no.
Secondary
Ab/target
Dilution or
concentration
Imaging
channel
AF488
Invitrogen
A11034
Anti-rabbit
1:500
Green
AF488
Invitrogen
A11029
Anti-mouse
1:500
Green
AF546
Invitrogen
A21123
Anti-rabbit
1:500
Near red
AF594
Invitrogen
A11005
Anti-mouse
1:500
Near red
AF647
Invitrogen
A21242
Anti-mouse
IgG2b
1:300
Far red
AF546
Invitrogen
S11225
Streptavidin
1:300
Near red
AF594 conjugated
azide
Invitrogen
A10270
EdU
1 ng/mL
Near red
DAPI
Roche
10236276001
Nuclear DNA
1:1,000
Blue
4. 100 % ethanol.
5. Forceps and iridectomy scissors. Sterilize in autoclave and keep
stored in 70 % ethanol during procedure.
6. 20 mL glass scintillation vials and caps. To sterilize expose to
UV light for at least 30 min.
232
7. 70 % calcium- and magnesium-free PBS (nPBS).

8. Enzyme cocktail: Under sterile conditions, make fresh every
time, 4 3 mL 70 % calcium- and magnesium-free nPBS with
0.5 % trypsin (Sigma), 400 U/mL type II collagenase (Sigma),
0.15 % BSA, 0.3 % glucose, and 1 pen/strep/fungizone. The
dissociation enzymes are critical; other suppliers are possible,
but concentrations and conditions need to be optimized.
9. Shaking water bath with variable speed.
10. Sterile fire-polished glass Pasteur pipette.
11. 50 mL conical tubes.
12. Newt minimum essential medium (newt MEM): 70 % MEM
with 10 % FBS and 1 pen/strep/fungizone.
13. Centrifuge with swinging bucket rotor (e.g., Beckman Allegra
6KR).
14. Uncoated 60 mm plastic tissue culture dishes.
15. Tissue culture incubator set to 25 C with 2.0 % CO2.
16. ECM-coated 60 mm plastic tissue culture dishes: tenascin-C
(Millipore, catalog number CC065), fibronectin (Millipore,
Catalog no. FC010), and laminin (Millipore, Catalog no.
CC095). The source of the matrices is critical; other suppliers
are possible, but concentrations and conditions need to be
optimized.
17. Inverted microscope with phase and fluorescence optics (e.g.,
Leica DMI6000).
18. 12-well tissue culture polystyrene dishes.
Methods
Carry out all procedures at room temperature unless otherwise
specified. The use of animals must follow the guidelines of and be
3.1 Surgical
Procedures
for Ventricular
Resection
1. Newts are anesthetized by submersion in room temperature

0.1 % Tricaine in newt water for 1015 min and then placed on
ice covered with plastic wrap for 1520 min. Prior to heart
ventricle amputation, verify that newts are nonresponsive to
touch and pain through both the tail pinch and the supine
positioning test (see Note 1).
2. Newts are subsequently turned on their back, gently strapped
into correct position on an IC-spacing perfboard with Stretch
Magic elastic cord loosely wrapped around the neck and tail
(see Fig. 2a). To minimize infection apply approximately 50 L
alcohol-free povidone-iodine to the incision site.
233
Fig. 2 Newt ventricular resection surgery. (a) Cartoon demonstrating how anesthetized newts are held in place
on a perfboard with elastic cord. (b) Vertical line indicates position of ventral near-midline incision. (c) Resection
of cartilaginous sternum and exposure of pericardial sac. (d) Gentle external pressure releases the heart from
the chest cavity. (Note the two darker red atria on top and the single pale red ventricle at the bottom.) (e)
Resection of approximately 20 % of the ventricle. (f) A single suture closes the external chest wound following
ventricular resection
3. For ventricular amputation surgeries (Fig. 2bf), cut the outer

layer of the skin and tissue using No. 5 forceps and microscissors. Make the initial incision approximately 2 mm from the
midline, just below the neck and above the posterior side of
the forelimbs (Fig. 2b). Beneath the incision, the sternum is
easily visualized as an opaque, cartilaginous material, which is
234
Fig. 3 After surgery newts recover immersed in shallow water
dissected through to reveal the pearly white pericardial sac

(Fig. 2c).
4. Use forceps to expose the pericardial sac in the chest cavity and
use fine spring scissors to make an incision in the pericardium.
Apply gentle pressure to the chest (near the shoulders) to fully
release the exposed heart from the pericardial sac and the chest
cavity (Fig. 2d). The newt has a three-chambered heart, visualized as two dark red atria superior to a lighter pink ventricle.
5. Hold the lower tip of the ventricle with No. 5 forceps, and
with fine spring scissors carefully resect 1520 % of the total
ventricular tissue mass from the apex (Fig. 2e) (see Note 2).
6. After resection, place the injured heart back into its original
position in the pericardial sac and chest cavity.
7. Close the wound with a single C-13 Sofsilk suture (Fig. 2f).
8. For recovery, keep the newts on ice covered with plastic wrap
for approximately 30 min.
9. Return the newts to a tank containing standard newt water and
elevated at one end so that the animals head remains out of
the water for 13 h to avoid drowning during recovery (Fig. 3).
Keep the animals in these small plastic containers filled partway
with newt water until regenerating tissues are collected. Cover
with a lid and change water daily.
3.2 Collection
of Regenerating
Tissue
1. At the time of tissue collection, newts will be sacrificed. Newts

are re-anesthetized as described in Subheading 3.1, step 1.
2. For immunohistochemistry studies, harvest regenerating hearts
at designated time points, embed in Tissue-Tek OCT compound, freeze in an isopentane-dry ice slurry, and store at 80 C.
3. For RNA-based investigations, remove from the apex of the
heart regenerating tissue with fine spring scissors and immediately flash freeze in liquid nitrogen.
3.3 Monitoring
Proliferative
Progenitor Cells
235
1. For cardiac regeneration studies, 3 days before tissue harvest,

newts are injected intraperitoneally with 100 L of 1 mM EdU
in 70 % PBS daily to allow for the identification of cells that
had entered the cell cycle (see Note 3).
2. For pulse-chase studies, after the 3-day labeling period, newts
are injected again with 100 L of 100 mM thymidine in 70 %
PBS to dilute residual EdU and greatly reduce further incorporation of the EdU label.
3. At the time of sacrifice, harvest the tissue, embed in TissueTek OCT as described in Subheading 3.2, step 2, and collect
serial sections of 14 m on Superfrost Plus slides using a cryostat (e.g. Leica CM3050S).
4. Fix the sections in 4 % PFA for 5 min, rinse in PBS, permeabilize with 0.5 % Triton X-100 in PBS for 1 min, and then rinse
with PBS.
5. Block sections for 30 min in blocking buffer.
6. To identify cells that incorporated EdU, incubate sections for
30 min with AF594 conjugated azide (final concentration
1 ng/mL) diluted in 100 mM TrisHCl (pH 8.5), 1 mM copper (II) sulfate, and 100 mM ascorbic acid.
7. Apply primary antibodies for 1 h and rinse sections with 0.1 %
Tween-20 in PBS.
8. Block slides again for 5 min before staining with the appropriate secondary detection reagents for 30 min.
9. Rinse slides with 0.1 % Tween-20 in PBS and mount with
FLUORO-GEL.
3.4 Imaging Cellular

and Extracellular
Proteins and Matrices
1. For immunohistochemistry studies (see Notes 4 and 5), collect

serial cryosections of 14 m on Superfrost Plus slides.
2. Fix sections in 4 % PFA for 5 min, rinse in PBS, permeabilize
with 0.5 % Triton X-100 in PBS for 1 min, and then rinse
with PBS.
3. Treat sections for 30 min with blocking buffer (20 % goat
serum, 0.2 % BSA, 50 mM ammonium chloride, 25 mM
glycine, 25 mM lysine, and 0.02 % sodium azide in PBS).
4. Apply primary antibodies for 1 h at room temperature and
rinse sections with 0.1 % Tween-20 in PBS.
5. Block slides again for 5 min before staining with the appropriate secondary detection reagents for 30 min.
6. Rinse slides with 0.1 % Tween-20 in PBS and mount with
FLUORO-GEL.
7. Image sections on a fluorescence or confocal microscope (e.g.,
Leica DMI6000, Zeiss LSM 510 Meta).
236
8. To assemble individual sections into a single composite image

we employ Image-Pro Analyzer.
9. To quantify cell staining, we use Adobe Photoshop and subsequently process cell count data in Microsoft Excel.
3.5 Collection
of Myocardial Tissue
for Primary Cultures
We prepare primary cultures of newt cardiomyocytes using a modified version of previously described methods [2].
1. For each preparation, six to eight adult newts are anesthetized
as described in Subheading 3.1, step 1.
2. To minimize possible contamination, generously cover the
newt chest and forelimbs in alcohol-free povidone-iodine.
3. Expose hearts as described in Subheading 3.1, steps 3 and 4,
and with iridectomy scissors, cut and remove the single ventricle free of atrial tissue.
4. Place the ventricles quickly and carefully into a sterile 60 mm
cell culture dish with room temperature 70 % L15 media.
5. Store ventricles overnight (1218 h) at 25 C in fresh 70 %
L-15 media supplemented with 1 pen/strep/fungizone.
6. In a designated tissue culture hood, rinse sterile forceps and
iridectomy scissors in 70 % calcium- and magnesium-free PBS
(nPBS) and dissect each ventricle into four to six pieces.
7. Using the forceps, transfer dissected ventricles to a sterile scintillation vial containing 3 mL of digestion mixture [nPBS with
0.5 % trypsin, 400 U/mL type II collagenase, 0.15 % BSA,
0.3 % glucose, 1 pen/strep/fungizone].
8. Place the standing scintillation vial into a shaking water bath at
27 C and digest the heart tissue for 8 h, with a change of
enzyme cocktail every 2 h. Rotate the scintillation vial containing the dissected heart muscle at 90 rpm for the first 2 h and
60 rpm for the final 6 h. To protect cells from light during the
incubation, cover the scintillation vial with aluminum foil.
9. Following the 8-h digestion, triturate the cell suspension with
a sterile fire-polished glass Pasteur pipette for 25 min.
10. To neutralize the digestion mixture, add the cell suspension to
50 mL conical tubes containing 30 mL newt minimum essential
media (70 % MEM) with 10 % FBS and 1 pen/strep/
fungizone.
11. In a low-speed centrifuge with swinging bucket rotor (e.g.,
Beckman Allegra 6KR), centrifuge the suspension for 10 min
at 200 g to collect the cells.
12. Remove the supernatant and resuspend the sedimented cells
with 4 mL newt MEM with 10 % FBS and 1 pen/strep/
fungizone.
3.6 Enrichment
of Cardiomyocytes
and Culture of Primary
Cells
237
1. Following the enzymatic digestion of cardiac tissue and removal

of debris by centrifugation, plate the resuspended cell mixture
in 60 mm uncoated tissue culture dishes and store the dishes
undisturbed for 23 days at 25 C in a humidified 2.0 % CO2
incubator. During this time, blood cells, connective tissue cells,
etc., will attach to the plastic surface, while cardiomyocytes
remain nonadherent.
2. Carefully collect the enriched floating cardiomyocytes with a
glass Pasteur pipette, count them on a hemocytometer, and
finally plate at a density of 3,000 cells/cm2 onto ECM-coated
dishes (see below) in newt MEM with 10 % FBS and 1 pen/
strep/fungizone. To support cardiomyocyte adherence, leave
this culture dish undisturbed for 23 days at 25 C in a humidified 2.0 % CO2 incubator before the first media change.
3. During culture, monitor the cardiomyocytes regularly and
image them for analysis using an inverted tissue culture microscope with 10 or 20 objectives. In culture, the newt cardiomyocytes maintain their differentiated status and display an
elongated shape with the typical branched morphology (Fig. 4a)
and positive reaction with the MF20 antibody (Fig. 4c). Over
1012 days in culture, the cardiomyocytes will spread, form
intricate junctions, and display spontaneous beating (Fig. 4b).
3.7 Assessing DNA

Synthesis in Cultured
Cells
1. For in vitro proliferation studies, we employ commercially

available ECMs, including tenascin-C, fibronectin, and laminin
[1, 6, 13]. Dilute the ECMs in serum-free MEM and allow
them to passively adsorb to 12-well tissue culture polystyrene
dishes at 1 g/cm2 for a minimum of 1 h but typically overnight at 25 C in a sterile incubator, before rinsing the plates
with nPBS. For DNA synthesis assays, coat wells in triplicate.
Confirm successful coating in 1 well per ECM via IHC with
respective antibodies. Importantly, do not allow ECM-coated
dishes to dry at any time before plating with cells.
2. Culture cardiomyocytes in 70 % MEM with 10 % FBS and 1
pen/strep/fungizone. Approximately 7 days after plating, the
cells reach a density suitable to assess their proliferative activity
(Fig. 4c). By 1014 days post-plating, the cardiomyocytes
begin to form complex networks that prevent proper observation and counting (Fig. 4b).
3. To the media of each well, add EdU at a final concentration of
1 M and incubate for 12 h.
4. After the overnight incubation with EdU, fix, permeabilize,
and stain the cells with AF594 azide and other antibodies as
described above for immunohistochemical staining procedures
(Fig. 4d).
238
Fig. 4 Explanted newt cardiomyocytes in culture. (a) Early on in diluted cultures, cardiomyocytes display the
typical bifurcated structure. (b) Picture frame of movie displaying beating cardiomyocytes. Within 2 weeks the
cardiomyocytes reach a considerable density, interconnect, and beat in synchrony. (c and d) Throughout
in vitro culture, the cardiomyocytes maintain their contractile machinery as verified by MF20 staining. (d)
Cardiomyocytes actively synthesize DNA as determined by EdU incorporation. Scale bar for a, c, d: 50 m
5. Use an inverted microscope with phase contrast and

fluorescence illumination at 10 to acquire 10 nonoverlapping images for each well.
6. Count cells in Adobe Photoshop and process cell count data in
Microsoft Excel. To statistically assess the effects of different
matrices on in vitro DNA synthesis, we typically use one-way
ANOVA in PAST software.
Notes
1. The tail pinch test involves pinching the tail with enough force
to normally cause a newt to respond with a jerk. If the newt
fails to respond, this suggests that the newt is sufficiently anesthetized. The supine positioning test involves rolling the newt
onto its back in the supine position. A newt does not appreciate being rolled onto its back and will immediately flip its body
to the prone position if not sufficiently anesthetized.
239
2. When resecting 1520 % of the ventricular tissue mass from

the apex, be careful not to cut too deeply into the ventricular
lumen as this will cause massive bleeding resulting in the animals death.
3. Both BrdU and EdU can be used to identify cardiomyocytes
that are actively synthesizing DNA (i.e., have entered the cell
cycle). However, we prefer using EdU as the mild click chemistry protocol does not destroy cellular epitopes (unlike BrdU
protocols) and is compatible with immunofluorescent techniques aimed at identifying proteins or other markers present
in the cardiomyocytes or ECM. Either AF594 azide or AF488
azide can be used for the EdU detection.
4. The fluorescent staining procedures described in this chapter
represent a method that we have found to produce reliable and
reproducible results and clear images for subsequent analysis.
However, as with any immunohistologic studies, there are
alternative methods that can be employed that will also produce reliable and meaningful results. Each investigator should
examine and validate the methods that best suit their particular
study.
5. To visualize hyaluronic acid distribution, we use biotinylated
hyaluronic acid binding protein (HABP) as an indirect probe
[6]. After fixation and permeabilization, and prior to labeling
sections with HABP, inactivate endogenous avidin and biotin
activity with an avidin/biotin blocking kit. After these blocking steps, wash sections two times for 5 min each in PBS and
then follow with the HABP incubation as described for primary antibodies. Confirm the staining specificity by preincubating HABP with a solution of 1 mg/mL hyaluronic acid
sodium salt, and then incubate a tissue section with this
absorbed reagent. A marked reduction in fluorescent staining
when compared to the unabsorbed HABP labeled indicates
that the HABP labeling is specific.
6. If using antibodies not listed in this table, investigators should
validate their use for newts either through a literature search or
through conducting their own studies to ensure that the antibodies react with the appropriate antigen and are specific for
that antigen. This is especially true when using antibodies that
have been generated for use in other species.
Acknowledgements
We would like to acknowledge both current and former research
laboratory personnel who helped develop the protocols described
in this chapter. These individuals include Claudia Guzman and
Sarah Mercer. We thank Drs. Jeremy Brockes and Anoop Kumar
240
for sharing their laboratory protocol for establishing newt primary

cardiomyocyte cultures. We would also like to acknowledge
Dr. Ken Poss who initially helped us establish the heart surgery
procedure we describe in this chapter.
References
1. Mercer SE, Odelberg SJ, Simon H-G (2013)
A dynamic spatiotemporal extracellular matrix
facilitates epicardial-mediated vertebrate heart
regeneration. Dev Biol 382:457469
2. Bettencourt-Dias M, Mittnacht S, Brockes JP
J Cell Sci 116:40014009
3. Witman N, Murtuza B, Davis B, Arner A,
Morrison JI (2011) Recapitulation of developmental cardiogenesis governs the morphological and functional regeneration of adult newt
hearts following injury. Dev Biol 354:6776
4. Laube F, Heister M, Scholz C, Borchardt T,
Braun T (2006) Re-programming of newt cardiomyocytes is induced by tissue regeneration.
J Cell Sci 119:47194729
5. Piatkowski T, Mhlfeld C, Borchardt T, Braun
T (2013) Reconstitution of the myocardium in
regenerating newt hearts is preceded by transient deposition of extracellular matrix components. Stem Cells Dev 22:19211931
6. Calve S, Odelberg SJ, Simon H-G (2010) A
transitional extracellular matrix instructs cell
behavior during muscle regeneration. Dev Biol
344:259271
7. Mercer S, Cheng C-H, Atkinson DL,
Krcmery J, Guzman CE, Kent DT, Zuckor K,
8.
9.
10.
11.
12.
13.
Marx KA, Odelberg SJ, Simon H-G (2012)

Multi-tissue microarray analysis identifies a
molecular signature of regeneration. PLoS
One 7(12):e52375
Tassava RA, Nace JD, Wei Y (1996)
Extracellular matrix protein turnover during
salamander limb regeneration. Wound Repair
Regen 4:7581
Toole BP, Gross J (1971) The extracellular
matrix of the regenerating newt limb: synthesis
and removal of hyaluronate prior to differentiation. Dev Biol 25:5777
Vinarsky V, Atkinson DL, Stevenson TJ,
Keating MT, Odelberg SJ (2005) Normal
newt limb regeneration requires matrix metalloproteinase function. Dev Biol 279:8698
Bader D, Oberpriller J (1979) Autoradiographic
and electron microscopic studies of minced
cardiac muscle regeneration in the adult newt,
Notophthalmus viridescens. J Exp Zool 208:
177193
Oberpriller JO, Oberpriller JC (1974)
Response of the adult newt ventricle to injury.
J Exp Zool 187:249253
Calve S, Simon H-G (2012) Biochemical and
mechanical environment cooperatively regulate skeletal muscle regeneration. FASEB J
26:25382545
Chapter 19
Long-Term Organ Cultures of Newt Hearts
Abstract
Adult newts regenerate their hearts after injury by initiating proliferation of cardiac muscle and non-muscle
cells. Mechanistic studies in vivo to analyze heart regeneration are challenging due to the long reproduction cycle of newts and the complexity of the genome. Culture of primary newt cells might offer alternative
experimental approaches, but monolayers of newt cardiomyocytes and slice cultures of newt hearts show
extensive morphological changes during cultivation. Hence, we developed a protocol to culture intact
newt hearts in vitro, avoiding major morphological changes of explanted organs during a 5-week cultivation. The model provides improved accessibility and allows manipulation of cultured organs by small
molecules and viral vectors. We found that dedifferentiation and S-phase entry of cardiomyocytes, which
are hallmarks of cardiac regeneration in vivo, can be recapitulated in cultured hearts in vitro. We reason
that long-term organ cultures of newts are a versatile tool for mechanistic studies on organ regeneration.
Key words Organ culture, Newt heart, 3D culture, S-phase labeling, Dead cell stain
Introduction
The spatial and temporal organization of a tissue is crucial for many
cellular processes such as proliferation, migration, and apoptosis
[1]. Cell-cell and cell-environment interactions play an important role
during tissue morphogenesis, homeostasis, and remodeling [2].
Tissue formation and remodeling depend on expression of receptors
and cell adhesion molecules, intracellular signaling cascades, and
mechanical junctions [3, 4], which are easily disrupted when cells
are separated from their native environment. In addition, the extracellular matrix (ECM) affects cellular behavior and gene expression
by providing a scaffold with a tissue-specific 3D ultrastructure [5]
and allowing transmission of mechanical forces formed by interactions of cells. The ECM consists of fibrous and noncollagen
components, including collagens, elastin, fibronectin, laminin, and
tenascin. Glycosamine and proteoglycans form the hydrous part
of the ECM, in which different cell types such as fibroblasts,
nerve endings, pericytes, vessels, and macrophages are located [6].
241
242
Monolayer cultures of cells fail to form the three-dimensional

bioscaffold and do not provide the characteristic interaction with
adjacent cells typical of organs in vivo. As a result, cells in monolayer cultures show a deviant gene expression pattern and behave
differently compared to their in vivo counterparts. 3D cultures of
primary cells are better suited to recapitulate the tissue microenvironment and physiology. Therefore, several different 3D culture
systems such as organotypic explants, spheroids consisting of
aggregated single cells, polarized cell cultures by cultivation on
porous membranes, in collagen or Matrigel, microcarrier culture,
or tissue-engineered models have been developed [1, 2]. Such
models are mainly used for drug screening [4] or toxicity tests,
but also for cancer, cell adhesion, migration, and gene expression
studies [2].
Unlike mammals, newts are able to regenerate heart tissue
after injury [7, 8]. Dedifferentiation of cardiomyocytes occurs by
changes in myofibrillar morphology including division of myofibrils, cross-links between adjacent myofibrils, or radial spreading of
myofilaments into sarcoplasm [7, 914]. Adult newt cardiomyocytes reenter the cell cycle and proliferate in vivo after cardiac damage [8, 9, 1115]. Similar processes occur during cultivation of
larval newt hearts [10], slice cultures [9], or isolated cardiomyocytes [1619] presumably induced by damages inflicted by cutting
hearts into slices or as a result of disrupting the 3D tissue organization. So far, attempts to genetically manipulate newts to study
newt heart regeneration in vivo mechanistically showed only limited success. Therefore, we developed an ex vivo cultivation system
of newt hearts, allowing us to avoid excessive cell death or major
morphological changes during a 5-week cultivation period (Figs. 1
and 2). Similar to the in vivo situation, S-phase entry of cardiac
cells in explanted hearts increased after experimental damage of the
ventricle (Fig. 3). Application of the long-term heart organ culture
system uncovered major differences in the ability of cultured newt
hearts to rebuild trabeculated ventricular structures depending on
the timepoint of the injury. We found that hearts explanted 24 h
after initial injury showed a much better ability to regenerate compared to hearts explanted immediately after damage. Improved
regenerative capacity was reflected by migration of dedifferentiated
cardiomyocytes into damaged areas, a process that is a characteristic for newt heart regeneration in vivo. Hearts, cultivated immediately after injury, showed significant lower levels of cardiomyocyte
dedifferentiation and migration and failed to rebuild ventricular
trabeculations. We are currently studying the molecular basis of the
signals, which trigger cardiac regeneration in newts using transcriptomic and proteomic analysis in combination with inhibition
of signaling pathways with small molecules [2025].
Ex Vivo Heart Cultures
243
Fig. 1 Immunofluorescence staining of tissue sections from hearts after 14 and 35 days of ex vivo culture.
(a) Control hearts show a normal morphology after 14 days in culture as indicated by staining for F-actin,
Vimentin, and nuclei (DAPI). (b) Only slight changes in the trabeculated network of the ventricle are visible after
5 weeks of cultivation. (c and d) Thin trabeculae with scattered cardiomyocytes are visible in the damaged
region of hearts cultivated directly after injury. (e and f) Hearts placed in culture 1 day after experimental injury
show trabeculae that contain multiple dedifferentiated cardiomyocytes. Red, Vimentin; green, F-actin; blue, DAPI.
Scale bar: 75 m
Materials
2.1 Animal Handling

and Heart Injury
1. Sulfamerazine solution: Dissolve 5 g sulfamerazine (Sigma) in

1 L tap water (see Note 1).
2. Alvegesic solution: Alvegesic (butorphanol 10 mg/mL) is
diluted in tap water (0.5 mg/L) [26] (see Note 2).
3. Tricaine solution: 1 g/L tricaine (ethyl 3-aminobenzoate
methanesulfonate or MS 222) is dissolved in tap water, and the
pH is adjusted to 7.4 with NaHCO3.
4. Tissue glue Histoacryl (B. Braun) (see Note 3).
5. Sterile microscissors and fine forceps with curved and straightshaped tips (see Note 4).
6. Stereomicroscope.
244
Fig. 2 SYTOX Blue staining of cultured newt hearts. The cell membrane-impermeable dye SYTOX Blue marks
nuclei of cells with damaged membranes undergoing cell death. To generate an internal positive control, tissue
damage was induced by squeezing the aortic trunk with forceps immediately before staining (indicated by
arrows). (a, c, and e) Epi-illumination images of hearts after 2 weeks cultivation. (b, d, and f) SYTOX Blue staining of the hearts is shown in the upper panel. Cultured hearts do not show significant signs of cell death after
14 days in culture irrespective of previous experimental damage. Solid lines indicate injured regions of hearts
(c and e). Dashed lines indicate the outer borders of cultured hearts (b, d, and f). Scale bar: 500 m
2.2
Organ Removal
1. 70 % ethanol.
2. L15 Leibovitz medium: To 35 mL L15 Leibovitz medium with
GlutaMAX, add 1 mL penicillin/streptomycin solution, and
make up to 50 mL with sterile cell culture water (see Note 5).
3. Sterile scissors for decapitation, microscissors, and fine forceps
with curved and straight tips.
4. Stereomicroscope.
2.3
Cultivation
1. Cultivation medium: To 30 mL MEM (minimum essential

medium) with GlutaMAX, add 5 mL FCS (fetal calf serum)
and 1 mL penicillin/streptomycin solution. Additionally, add
ciprofloxacin (CiproHEXAL 100 mg/50 mL) at a final concentration of 10 g/mL, and fill up to 50 mL with sterile cell
culture water.
2. 3.5 cm plastic dishes and 24-well plates.
3. EdU (5-ethynyl-2-deoxyuridine/component A) from a
Click-iT EdU Alexa Fluor 488 Imaging Kit (Life Technologies)
for S-phase labeling.
245
Fig. 3 EdU labeling of hearts after 14 days in culture. Cardiac cells enter S-phase and proliferate in vivo after
injury. Low-level EdU labeling is also present in uninjured hearts [8]. (af) EdU incorporation of cells in cultured
hearts indicating S-phase entry. (a) Control hearts showing low numbers of EdU-positive cells. (b) EdU-labeled
cardiomyocytes in uninjured control hearts. (cf) After heart injury, EdU-positive cardiac cells increase in number. Red, myosin light chain 3 (MYL3); green, EdU; blue, DAPI. White borders in the upper row indicate magnified areas. Scale bar (a, c, and e), 150 m; (b, d, and f), 25 m
2.4 Tissue Staining
Against Vimentin
and F-Actin
1. 10 APBS (amphibian phosphate buffered saline): Dissolve

80 g NaCl, 14.4 g NaHPO4 2H2O, 2 g KH2PO4, and 2 g
KCl; make up to 1 L with deionized water; and stir well.
2. 1 APBS: Dilute 75 mL 10 APBS to 1 L with deionized
water and adjust the pH to 7.4 with NaOH.
3. 4 % paraformaldehyde (PFA) solution: Add 4 g paraformaldehyde to 80 mL of APBS. For better solubility, add a pellet of
NaOH and stir the solution. Next, pass the solution through a
pleated filter, and fill up to 100 mL with APBS. Adjust the pH
to 7.4 with NaOH (see Note 6).
4. 2 % agarose gel: Dissolve 0.2 g agarose (low-melting agarose is
preferred) in 1 APBS by using a microwave. To embed the
hearts, the gel should be cooled down.
5. Antibody against Vimentin, conjugated with Cy3 (Sigma,
Clone V9).
6. Phalloidin, conjugated with FITC (Sigma).
246
7. 10 % Triton X-100 solution: Weigh 10 g Triton X-100 and

make up to 100 mL with APBS, and stir well to dissolve the
solution. The final concentration of Triton X-100 will be
0.1 %, by adding 1 L 10 % Triton X-100 solution to 99 L of
staining solution (see Note 7).
8. DAPI (4,6-diamidino-2-phenylindole) nuclei staining solution: Dilute DAPI stock solution (1:1,000) in APBS.
9. Razor blades.
10. Glass bottom dishes.
2.5 SYTOX Blue
Staining of Dead Cells
1. SYTOX Blue nuclei dye (Life Technologies).

2. Forceps.
3. Stereomicroscope with an appropriated filter (e.g., Leica M205
FA).
4. Cultivation medium (see Subheading 2.3, item 1).
2.6 Sample
Preparation
for Cryosections
1. 1 APBS (see Subheading 2.4, item 2).

2. 4 % PFA solution (see Subheading 2.4, item 3).
3. 20 % sucrose: Dissolve 10 g D-saccharose in APBS.
4. 30 % sucrose: Dissolve 15 g D-saccharose in APBS.
5. OCT Tissue-Tek embedding media (Sakura).
6. Cryomolds.
7. SuperFrost Plus slides (Menzel).
2.7 Reagents
for S-phase Labeling
and Antibody Staining
Against Myosin Light
Chain 3 (MYL3)
1. Click-iT EdU Alexa Fluor 488 Imaging Kit (Life Technologies).

2. 1 APBS (see Subheading 2.4, item 2).
3. 0.5 % Triton X-100 in 1 APBS (see Note 7).
4. 3 % bovine serum albumin (BSA) in APBS.
5. Deionized water.
6. Antibody against MYL3 (Sigma HPA 016564).
7. 5 % BSA in 1 APBS.
8. 10 % Triton X-100 solution (see Subheading 2.4, item 7).
9. Cy3-conjugated secondary antibody against rabbit (Dianova).
10. DAPI nuclei stain solution (see Subheading 2.4, item 8).
11. Mowiol (mounting medium).
Methods
Two different injury models are possible in newts: (1) an immediate
ex vivo injury model, where the hearts are damaged directly before
cultivation (injury ex vivo) and (2) a delayed ex vivo injury model,
where the injury is applied 24 h before cultivation (1 day after injury).
3.1 Animal
Pretreatment, Heart
Injury, and Organ
Removal
247
1. For 1 day after injury heart cultures, keep animals 6 h before

operation in Alvegesic solution.
2. Afterward, deeply anesthetize the newts by incubating them
for 1520 min in tricaine (see Note 8).
3. To induce heart injury, keep the newt facing ventral side and
make a small skin incision with microscissors. Cut the exposed
pericardium and fix the heart at the aortic trunk using curved
fine forceps.
4. For heart injury, squeeze the right half of the ventricle 15 up
to 20 times with a straight fine forceps in orthogonal direction.
Afterward, carefully return the heart into the thoracic cavity,
and close the wound with Histoacryl.
5. For disinfection, incubate the animals in sulfamerazine solution until recovery from anesthesia, and transfer them into
husbandry aquaria with Alvegesic solution [7, 27].
6. To avoid contaminations during cultivation, immerse the animals for 2 h in sulfamerazine solution before organ removal.
7. After deep anesthesia in tricaine solution, decapitate the newts
and wash them with 70 % ethanol.
8. Remove the hearts, transfer them to L15 Leibovitz media, and
wash three times to remove the blood (see Note 9).
9. Prepare the hearts for the group direct injury by fixing
them at the aortic trunk, and damage one half of the ventricle
by squeezing with forceps, following the procedure described
in in vivo operated hearts for 1 day after injury cultures
(see step 4).
3.2 Preparation
and Cultivation of Ex
Vivo Hearts
1. After the transfer of the removed organs to a laminar flow

hood, wash the hearts three times in cultivation medium, and
culture each heart in 3.5 cm cell culture dishes in an incubator
maintained at 25 C with 5 % CO2 (see Note 10). Perform first
medium change after 24 h and subsequently twice a week.
Transfer hearts into 24-well plates at the second medium
change.
2. For S-phase labeling, add EdU (200 M) to the cultivation
medium 3 days before checkpoint (see Note 11).
3.3 Vimentin
and F-Actin Tissue
Staining
1. Wash the hearts twice in APBS, embed them in 2 % agarose

gel, and cut them with a razor blade in two halves.
2. Wash them again in APBS.
3. Fix the samples for 30 min with 4 % PFA solution.
4. Wash them again three times with APBS.
5. Label endothelia cells by incubating the samples in a 1:300
dilution of the Vimentin-Cy3 antibody in APBS for 2 h at room
248
temperature (see Note 12). Use an FITC-coupled phalloidin

in a 1:100 dilution in APBS with 0.1 % Triton X-100 to detect
F-actin of cardiomyocytes. Incubate the samples therein overnight at 4 C. Thereafter, incubate the samples for 30 min at
room temperature in DAPI solution (1:1,000) for counterstaining the nuclei.
6. Wash the samples extensively for the next 2 h with APBS by
changing the APBS every 15 min.
7. Embed the tissue in 2 % agarose gel in glass bottom dishes and
take images immediately with a confocal microscope.
3.4 SYTOX Blue Dead
Cell Stain
1. The cell membrane-impermeable dye SYTOX Blue is used to

stain cells with damaged membranes, a sign of pending cell
death. Add SYTOX Blue to the cultivation media to a final
concentration of 5 M (see Note 12). To control staining
intensity, squeeze the aortic trunk with sterile forceps to induce
necrosis and incubate the hearts for 2 h in an incubator at
25 C with 5 % CO2.
2. Wash the hearts twice with cultivation medium.
3. Observe the hearts immediately under a stereofluorescence
microscope with appropriated filter and record the images
(see Note 13).
3.5 EdU Detection,

Antibody Staining
Against MYL3 (Myosin
Light Chain 3)
in Cardiomyocytes,
and Nuclei Labeling
with DAPI
1. Wash the hearts twice in APBS and fix them for 1 h with 4 %
PFA solution.
2. Wash the tissues 3 for 10 min each in APBS.
3. Incubate the samples in 20 % sucrose overnight at 4 C.
4. Thereafter, transfer the hearts to 30 % sucrose, and incubate
them for the next 48 h at 4 C.
5. For embedding, transfer the heart to a cryomold containing
OCT Tissue-Tek and incubate for 10 min at room temperature.
6. Freeze the cryomold in liquid nitrogen and store the samples
at 80 C (see Note 14).
7. Cut 6 m sections by using a cryostat microtome and mount
the sections on SuperFrost Plus slides.
8. Perform EdU labeling as described for cell culture by using the
protocol provided by the supplier, but without fixation.
9. Afterward, wash the slides 3 for 10 min in 5 % BSA solution.
10. Label the cardiomyocytes by using an antibody against MYL3.
Dilute the antibody 1:500 in 5 % BSA and 0.1 % Triton X-100 in
APBS and incubate the slides therein overnight at 4 C.
11. Wash the samples 3 for 10 min each with APBS.
249
12. To detect the primary antibody, incubate with a Cy3-conjugated

secondary anti-rabbit antibody at 1:300 dilution in APBS for
45 min.
13. Counterstain the nuclei with DAPI (1:1,000) for 20 min at
room temperature.
14. Finally, wash the samples 3 for 10 min with APBS, and mount
the samples with a cover slip by using Mowiol.
15. Let the slides dry overnight at 4 C. For imaging, use a confocal microscope.
Notes
1. Sulfamerazine inhibits folic acid synthesis and is antibacterial.
It is a fine white powder. Protect yourself and work under a
hood.
2. Alvegesic (butorphanol) solution is given as a pre- and postoperative analgesic to the newts.
3. Histoacryl is a tissue glue, which harden within seconds.
Always wear gloves and avoid skin contact.
4. Dissection instruments are sterilized by autoclaving or by incubation in 70 % ethanol for 15 min.
5. L15 Leibovitz medium is buffered by a combination of salt,
sugar, and amino acids and can be used for cultivation without
CO2/sodium bicarbonate.
6. When using PFA powder protect yourself by working under
the hood. Wear nitrile gloves, a lab coat and protective goggles. Avoid skin contact. To enhance solubility of PFA in
APBS, you might increase the temperature by using a temperature-regulated magnetic mixer, but do not exceed 50 C.
7. Triton X-100 is highly viscous solution and pipetting an exact
volume is difficult. Therefore, weigh out Triton X-100 using a
laboratory balance.
8. After 1520 min, newts should not show any swim or tail
movement, not even when the animals are lying on their backs.
Prolong the incubation time in tricaine solution, if animals
show any movements.
9. The newt skin is contaminated by bacteria, which is only
reduced after disinfection with sulfamerazine. Therefore, first
remove control hearts and hearts subjected to damage after
organ removal. Hearts that are removed 1 day after injury
should be dissected last. Separate the hearts in single tubes
during transfer to cell culture and always disinfect the dissecting stools between the procedures.
250
10. Contaminations by bacteria will be visible during the first 24 h

after setting up the cultures. Therefore, use single 3.5 cm culture dishes, so you can simply remove contaminated dishes,
without taking a risk for the whole culture.
11. For the preparation of solutions and EdU detection, follow the
protocol provided by the supplier.
12. Fluorescence dyes are light sensitive and should be protected
from light to avoid photo bleaching. Samples should be stored
in the dark, for example, by covering with aluminum foil.
13. SYTOX Blue is a cell membrane-impermeable dye, which only
stains nuclei after cell membrane damage. Fixation with PFA
affects membrane integrity of cells. If PFA fixation is done after
SYTOX Blue staining, the remaining dye will stain the nuclei
of previously negative cells, resulting in false-positive signals.
14. Freezing of hearts in OCT Tissue-Tek without fixation and
incubation in sucrose results in the formation of ice crystals
inside the hearts and impairs tissue morphology when placing
samples in liquid nitrogen.
Acknowledgments
This work was supported by the Max-Planck-Society, the Excellence
Cluster Cardiopulmonary System (ECCPS), the University of
Giessen-Marburg Lung Center (UGMLC), the Cell and Gene
Therapy Center (CGT) of the University of Frankfurt, and the
DFG (SFB TRR81).
References
1. Haycock JW (2011) 3D cell culture: a review
of current approaches and techniques. Methods
Mol Biol 695:115
2. Pampaloni F, Reynaud EG, Stelzer EH (2007)
The third dimension bridges the gap between
cell culture and live tissue. Nat Rev Mol Cell
Biol 8:839845
3. Green JB (2008) Sophistications of cell sorting. Nat Cell Biol 10:375377
4. Griffith LG, Swartz MA (2006) Capturing
complex 3D tissue physiology in vitro. Nat Rev
Mol Cell Biol 7:211224
5. Badylak SF (2002) The extracellular matrix as a
scaffold for tissue reconstruction. Semin Cell
Dev Biol 13:377383
6. Hein S, Schaper J (2001) The extracellular
matrix in normal and diseased myocardium.
J Nucl Cardiol 8:188196
7. Piatkowski T, Muhlfeld C, Borchardt T, Braun

T (2013) Reconstitution of the myocardium in
regenerating newt hearts is preceded by transient deposition of extracellular matrix components. Stem Cells Dev 22:19211931
8. Witman N, Murtuza B, Davis B, Arner A,
Morrison JI (2011) Recapitulation of developmental cardiogenesis governs the morphological and functional regeneration of adult newt
hearts following injury. Dev Biol 354:6776
9. Nag AC, Healy CJ, Cheng M (1979) Organ
culture of adult amphibian heart: a fine structural analysis. Tissue Cell 11:231248
10. Millhouse EW Jr, Chiakulas JJ, Scheving LE
(1971) Long-term organ culture of the salamander heart. J Cell Biol 48:114
11. Bader D, Oberpriller J (1979) Autoradiographic
and electron microscopic studies of minced
12.
13.
14.
15.
16.
17.
18.
19.
20.
cardiac muscle regeneration in the adult newt,

Notophthalmus viridescens. J Exp Zool 208:
177193
Bader D, Oberpriller JO (1978) Repair and
reorganization of minced cardiac muscle in the
adult newt (Notophthalmus viridescens). J
Morphol 155:349357
Oberpriller J, Oberpriller JC (1971) Mitosis in
adult newt ventricle. J Cell Biol 49:560563
Oberpriller JO, Oberpriller JC (1974)
Response of the adult newt ventricle to injury.
J Exp Zool 187:249253
Oberpriller JO, Oberpriller JC, Arefyeva AM,
Mitashov VI, Carlson BM (1988) Nuclear
characteristics of cardiac myocytes following
the proliferative response to mincing of the
myocardium in the adult newt, Notophthalmus
viridescens. Cell Tissue Res 253:619624
Bettencourt-Dias M, Mittnacht S, Brockes JP
J Cell Sci 116:40014009
Tate JM, McDonnell TJ, Oberpriller JC,
Oberpriller JO (1987) Isolation of cardiac
myocytes from the adult newt, Notophthalmus
viridescens. An electron microscopic and quantitative light microscopic analysis. Tissue Cell
19:577585
Tate JM, Oberpriller JO (1989) Primary cell
culture and morphological characterization of
ventricular myocytes from the adult newt,
Notophthalmus viridescens. Anat Rec 224:
2942
Tate JM, Oberpriller JO, Oberpriller JC (1989)
Analysis of DNA synthesis in cell cultures of the
adult newt cardiac myocyte. Tissue Cell
21:335342
Looso M (2014) Opening the genetic toolbox
of niche model organisms with high throughput
21.
22.
23.
24.
25.
26.
27.
251
techniques: novel proteins in regeneration as a

case study. Bioessays 36:407418
Looso M, Preussner J, Sousounis K,
Bruckskotten M, Michel CS, Lignelli E,
Reinhardt R, Hoffner S, Kruger M, Tsonis PA,
Borchardt T, Braun T (2013) A de novo assembly of the newt transcriptome combined with
proteomic validation identifies new protein
families expressed during tissue regeneration.
Genome Biol 14:R16. doi:10.1186/gb-201314-2-r16
Spiked-in pulsed in vivo labeling identifies a
new member of the CCN family in regenerating
newt hearts. J Proteome Res 11:46934704
Bruckskotten M, Looso M, Reinhardt R, Braun
T, Borchardt T (2012) Newt-omics: a comprehensive repository for omics data from the
newt Notophthalmus viridescens. Nucleic
Acids Res 40(Database issue):D895D900
Looso M, Borchardt T, Kruger M, Braun T
(2010) Advanced identification of proteins in
uncharacterized proteomes by pulsed in vivo
stable isotope labeling-based mass spectrometry. Mol Cell Proteomics 9:11571166
Borchardt T, Looso M, Bruckskotten M,
Weis P, Kruse J, Braun T (2010) Analysis of
newly established EST databases reveals similarities between heart regeneration in newt
and fish. BMC Genomics 11:4. doi:10.1186/
1471-2164-11-4
Koeller CA (2009) Comparison of buprenorphine and butorphanol analgesia in the eastern
red-spotted newt (Notophthalmus viridescens). J Am Assoc Lab Anim Sci 48:171175
Laube F, Heister M, Scholz C, Borchardt T,
Braun T (2006) Re-programming of newt cardiomyocytes is induced by tissue regeneration.
J Cell Sci 119:47194729
Chapter 20
In Vitro Preparation of Newt Inner Ear Sensory
Epithelia as a Model for Repair and Regeneration
Ruth R. Taylor
Abstract
The sensory hair cells of the inner ear transform sound energy into electrical signals, but are readily lost
through aging, excessive noise, and ototoxic agents. The newt provides an excellent model in which to
explore regeneration and whilst loss of hair cells from inner ear epithelia does not require whole organ
regeneration, new hair cells are generated from differentiated supporting cells that transdifferentiate without an intervening mitotic event. Here we describe the methods for maintaining the sensory epithelia in
long term culture; for the use of the aminoglycoside, gentamicin, to kill the hair cells; and for the examination of the tissue by electron microscopy or fluorescence microscopy. Demembranation of the epithelium
reveals the underlying ultrastructure of the tissue for examination by scanning electron microscopy (SEM)
and is a technique that can be utilized with immunogold labelling.
Key words Hair cell, Salamander, Notophthalmus viridescens, Stereocilia, Utricle, Saccule
Introduction
The inner ear contains the mechanosensitive sensory epithelia that
detect and transduce sound and those in the vestibular portion that
detect changes in head position and are involved in maintaining
balance and posture. The inner ear of the adult newt, Notophthalmus
viridescens comprises seven sensory epithelia: the three cristae
located within the ampullae of the semicircular canals that detect
angular motion of the head; the utricle which detects gravity and
acceleration; the amphibian papilla and saccule which are auditory
end organs and the lagena which performs mostly a vestibular
function. In some other newt species there is also a basilar papilla
but this has been lost from Notophthalmus viridescens.
The mechanosensory hair cells of the inner ear epithelia
transform sound waves and vibrations into electrical signals that
ultimately are detected and interpreted by the cortex of the brain
[1]. In mammals, the loss of these cells from the auditory system
results in a progressive and permanent deafness. Ototoxic agents,
253
254
Ruth R. Taylor
excessive noise, and aging can trigger this loss and new hair cells
are not generated. Following damage to the mammalian vestibular
system there is a very limited level of hair cell replacement [2].
These new hair cells are thought to arise from the non-sensory
supporting cells that surround each hair cell via direct phenotypic
conversion (transdifferentiation) without a mitotic event [3]. The
capacity of urodele amphibians, such as Notophthalmus viridescens,
to regenerate various body parts and tissues such as limb and the
lens has lead us to investigate the generation of new hair cells arising spontaneously following their ablation in the inner ear of this
vertebrate [4].
It has long been known that aminoglycosides, used to treat
tuberculosis, gram-negative sepsis, and many other infections, are
ototoxic and can cause deafness through the loss of hair cells and
consequent loss of spiral ganglion cells [5]. They have been used in
many inner ear studies both in lower vertebrates and in mammals.
In mammals administration of aminoglycoside such as gentamicin
by a series of systemic injections will cause permanent damage to
the cochleae and some aminoglycosides will affect the vestibular
sensory epithelia. In the newt, attempts to systemically deliver aminoglycosides to ablate hair cells have proved to be difficult as sufficiently high dosage results in death of the animal due to kidney
damage. However, in vitro organotypic long term cultures provide
a suitable preparation to examine recovery and regeneration of the
inner ear epithelia.
Materials
Adult newts are available from animal suppliers from the USA
(e.g., Charles D. Sullivan & Co.). Maintain the animals according
to the regulations of the institution and/or the guidelines of the
authorities.
2.1 Culture
of Sensory Epithelia
1. Anesthetic: Prepare 0.1 % 3-aminobenzoic acid ethyl ester

(MS-222) in distilled water.
2. 70 % Ethanol.
3. Amphibian PBS (APBS): To prepare 100 mL APBS, mix 80
mL Dulbeccos phosphate buffered saline with 20 mL sterile
distilled water.
4. Amphibian minimal essential medium (AMEM): Prepare 80 %
Minimal Essential Medium with GlutaMAX (MEM) + 20 %
sterile water. Then add 1 % Hepes buffer (4-(2-hydroxyethyl)1-piperazineethanesulfonic acid) and 10 % horse serum (donor
herd collected).
5. Hair cell culture medium (H-AMEM): To the AMEM add 1 %
amphotericin B (antimycotic) and 100 g/mL ciprofloxacin
(a non-ototoxic broad spectrum antibiotic).
Hair Cell Regeneration in the Newt Inner Ear
255
6. Gentamicin sulfate (aminoglycoside antibiotic): Prepare a

stock solution of 10 mM in sterile water and store at 20 C
for up to 6 months.
7. Hair cell ablation medium: To the H-AMEM solution (item 5),
add 2 mM gentamicin solution.
8. Surgical tools: Fine forceps (no. 3 and 5 fine tip medical grade
tweezers suitable for dry heat sterilizing/autoclaving), spatula
and curettes and assorted small dental surgical tools.
9. Sterile plasticware: 35 mm petri dishes, 24-well plates, 15 mL
falcon tubes.
10. Stereo dissecting microscope with incident light illumination.
2.2 Scanning
Electron
Microscopy (SEM)
1. Cacodylate buffer: Prepare a stock solution of 0.2 M sodium

cacodylate with 6 mM CaCl2, adjust to pH 7.3 with 0.2 M
HCl. Store at 4 C.
2. Cacodylate buffer working solution: Buffer diluted 1:1 with
deionized water for working concentration of 0.1 M
cacodylate.
3. Primary fixative: 2.5 % glutaraldehyde in 0.1 M cacodylate buffer. Prepare from 10 mL individual vials of 25 % glutaraldehyde
(electron microscopy grade) in water. Prepare a working solution by mixing one part 25 % glutaraldehyde, five parts 0.2 M
cacodylate buffer, and four parts sterile water. Store at 4 C.
4. Osmium tetroxide (OsO4) post-fixative. Break open a 1 g vial
of solid OsO4 in a fume hood and add to 50 mL of distilled or
deionized water to provide a 2 % solution. The OsO4 requires
some time to dissolve. Leave overnight before first use. Store
at room temperature in dark-glass bottle to reduce exposure to
light (see Note 1).
5. 1 % OsO4 solution: Mix equal volumes of 2 % OsO4 and 0.2 M
cacodylate to give a 1 % solution in 0.1 M cacodylate buffer as
a post-fixative; dilute 1:1 with water during processing with
thiocarbohydrazide.
6. Thiocarbohydrazide (TCH): Make a filtered saturated solution
in water. 0.5 g/100 mL provides a saturated solution. Filter
before use. Use fresh solution each time.
7. Ethanol series: Dilute 100 % ethanol with deionized water to
give 30, 50, 70, 85 and 90 %. Store at room temperature.
8. 100 % Ethanol (pure, anhydrous).
9. Small sample holders, e.g., specimen containers for critical
point dryer.
10. Small glass bottles suitable size for the sample holders.
11. Critical point dry device: from liquid CO2.
256
Ruth R. Taylor
12. Specimen support stubs for SEM. Use appropriate size for the
instrument according to manufacturers recommendations for
their particular holders.
13. Silver Paint: Electrolube Silver Conductive paint or Electrodag
Fast drying conductive paint (provides a conductive adhesive
for attaching specimens to support stub).
14. Sputter coater: platinum foil.
2.3 Demembranation
of Tissue
1. Cytoskeletal buffer with phallacidin (CPP buffer): Prepare a fresh

solution of 5 mM KCl, 137 mM NaCl, 4 mM NaHCO3, 0.4 mM
KH2PO4, 1.1 mM Na2HPO4, 2 mM MgCl26H2O, 5 mM
PIPES, 2 mM EGTA, and 5.5 mM Glucose. Adjust the pH 6.0
6.1 if necessary using NaOH (see Note 2). Add 5 M Phallacidin
1mg/mL in methanol stock solution and store at 20 C. To this
solution, add Protease inhibitor tablets (EDTA free): one tablet
dissolved just before use as per suppliers instruction.
2. 0.25 % Triton X-100: dilute Triton X-100 stock solution in
CPP buffer.
3. 0.25 % saponin: dilute saponin in CPP buffer.
4. Fixative: 2.5 % glutaraldehyde in CPP buffer (see item 1).
5. 0.2 M cacodylate buffer (see Subheading 2.2, item 1).
6. 2 % OsO4 (see Subheading 2.2, item 4).
7. Specimen holders and small glass bottles.
2.4 Immunogold
Labelling
1. Fixative: 4 % paraformaldehyde and 0.05 % glutaraldehyde in

CPP buffer (Subheading 2.3, item 1).
2. Blocking solution: Prepare a solution of 1 % bovine serum
albumin, 0.15 % Triton X-100 in CPP buffer (Subheading 2.3,
item 1).
3. Primary antibody: Dilute anti Myosin VI 1:50 in blocking
solution (item 2).
4. Secondary antibody: Gold-conjugated goat anti-rabbit IgG
Dilute 1:20 in blocking solution (item 2).
5. PBS wash solution: PBS with 0.15 % Triton X-100 for
rinsing.
2.5 Transmission
Electron
Microscopy (TEM)
1. Prepare 2.5 % glutaraldehyde fixative, osmium tetroxide,

sodium cacodylate buffer as described in Subheading 2.2,
items 13.
2. Decalcification buffer: 4.13 % EDTA in 0.1 M cacodylate
buffer.
3. Ethanol series: 3090 % in deionized water.
257
4. Ethanolic uranyl acetate: saturated solution of uranyl acetate in

70 % ethanol.
5. Aqueous uranyl acetate: 1 g uranyl acetate per 100 ml deionized water.
6. Lead citrate.
7. Plastic resin for embedding.
8. Silicon-coated rubber molds for embedding.
9. Embedding oven.
2.6 Immunofluorescence
1. Phosphate buffer solution (PBS): Prepare as a 1 solution by

dissolving one phosphate buffered saline tablet in 200 mL in
deionized water (yields 0.1 M phosphate buffer, 0.0027 M
potassium chloride and 0.137 M sodium chloride, pH 7.4 at
25 C). Alternatively, dissolve 137.0 mM NaCl, 2.7 mM KCl,
8.0 mM Na2HPO4, 1.5 mM KH2PO4, in deionized water.
2. Paraformaldehyde (PFA) fixative. Prepare a 4 % (w/v) solution
in PBS, warming carefully on a stirring hotplate in a fume
hood. Solution is cooled to room temperature before use. For
storage at 20 C, for up to 6 months, prepare 8 % (w/v) solution in 2 PBS. Dilute to 4 % prior to use.
3. Permeabilization: Prepare 0.5 % (v/v) Triton X-100 in sterile
water.
4. Blocking solution: Prepare a solution of 0.15 % Triton X-100 and
10 % (v/v) normal goat serum in PBS. Store for 23 days at 4 C.
5. PBS wash solution: 0.15 % Triton X-100 in PBS.
6. Antibody dilution buffer: 0.1 % (v/v) Triton X-100 and
100 mM L-lysine in PBS. Store for up to 7 days at 4 C.
7. Primary antibodies: antibodies to calretinin, otoferlin (HCS-1),
neurofilament.
8. Secondary antibodies: Goat anti-mouse IgG conjugated to
Alexa 488 or similar, Goat anti-rabbit IgG conjugated to Alexa
555 or similar.
9. Phalloidin conjugated to TRITC or FITC.
10. Antifade mountant with DAPI .
11. Glass slides: PTFE multi-spot glass slides.
Methods
3.1 Dissection and

Culture of the Inner
Ear (See Note 3)
1. Anesthetize the animals by placing them in a 0.1 % solution of

3-aminobenzoic acid ethyl ester for approximately 15 min.
2. Remove the animal from the water and kill in accordance with
local regulations. Following decapitation, remove the lower
jaw and bisect the head.
258
Ruth R. Taylor
3. Place bisected head in 70 % ethanol for 5 min to reduce the

chance of bacterial infection (see Note 4).
4. Rinse and continue dissection in APBS. The otic capsule lies
within close proximity of the eye and careful separation of tissue will expose the bright, hard bony capsule. Gently remove
the connective tissue and muscle surrounding the otic capsule
using fine surgical tools (dental probe) to reveal the bony outer
wall of the capsule.
5. Retract the columellar bone to one side and excise the otic
capsule (Fig. 1a) from the head.
6. Use a curette to open the thick membranous covering of the
oval window and expand the window opening by scraping
away some of the edge. This will allow medium to infiltrate the
inner ear epithelia more readily during culturing.
7. The utricular and saccular maculae are normally covered with
an otoconial membrane that consists of a fibrous extracellular matrix covered with calcium carbonate crystalline particles
(otoconia). Gently aspirate the otoconia from the otic capsule
with APBS using a syringe with a fine needle and incubate in
500 L H-MEM medium in a sterile 24-well plate. Otoconia
remaining during fixation tend to attach to the epithelium
obscuring the surface and will show autofluorescence.
8. To ablate hair cells, incubate as above in hair cell ablation
medium. For maximal hair cell ablation, incubate for 48 h and
rinse with fresh medium.
9. Maintain the cultures by removing and supplementing 50 % of
the medium on alternate days.
10. Cultures can be maintained for up to 28 days (see Note 5).
3.2 Scanning
Electron
Microscopy (SEM)
1. Fix the inner ear tissues in situ in the otic capsule. For this,
place the otic capsule in a 35 mm Petri dish and immobilize
using tweezers. Gently perfuse 2.5 % glutaraldehyde using a
syringe at the edge of the oval window taking care not to damage the labyrinth.
2. Immerse the entire otic capsule in glutaraldehyde solution for
at least 90 min at room temperature on a mechanical rotator,
or overnight at 4 C.
3. Rinse the samples three times for 10 min in 0.1 M cacodylate
buffer,
4. Post-fix the tissues in OsO4 for 2 h at room temperature.
5. To dissect the inner ear epithelial tissues from the otic capsule,
place the tissue in cacodylate buffer under a stereo microscope.
6. Gently crack open the otic capsule using a limited amount of
force at the edge of the oval window.
259
Fig. 1 (a) The bony otic capsule with oval window opened (arrow). (b) Labyrinth removed from otic capsule
with underside of the utricle shown to the left-hand side (arrow) and saccule uppermost (arrowhead). One
ampulla with crista, right-hand side. (c and d) Scanning electron micrographs of saccule. Hair bundles of the
saccular macula are partially covered with otoconial membrane (arrow) and extramacular hair bundles at the
very outer edge of the saccule are present (arrowhead). (d) Higher magnification of hair cell bundle showing
the graduated length of stereocilia and long kinocilium. (e and f) Transmission electron micrograph of hair cell
and cross section of bundle. (g) Extrastriolar region of utricular macula after demembranation: small hair
bundles are present. One bundle retains its long kinocilium. Its microtubular filaments have begun to splay.
Adjacent hair bundle has recess only at position of kinocilium. (h) Immunofluorescence of saccule.
Neurofilaments are labelled with antibody to neurofilament (green) and extend from the central macular hair
cell region out to extramacular hair cells at the edge of the saccule (arrows). Phalloidin labels the f-actin at cell
junctions and the actin-rich hair bundles (arrowhead, red) (color figure online)
260
Ruth R. Taylor
7. The membranous labyrinth will be exposed and can be freed

from the bony capsule by inserting a fine spatula beneath the
saccule. Care should be taken not to damage the sensory
epithelia.
8. The inner ear epithelia (Fig. 1b) can be further dissected to
separate the individual end organs, i.e., the saccule can be
trimmed with fine iris scissors from the utricle and the semicircular canals removed so that the ampullae can be opened to
access the cristae.
9. Gently remove any remaining otoconia and otoconial membrane by lifting with a fine forceps from the saccule and utricle
so that the hair bundles and surface of the maculae are visible
under the scanning electron microscope (Fig. 1c).
10. Place the dissected epithelium in specimen holders within small
glass bottles (see Note 6).
11. The dissected inner ear tissues are processed through the
repeated TCH-OsO4 procedure to enhance preservation of the
morphology and provide a conductive coat [6].
12. Wash the samples in distilled water.
13. Incubate the tissues in a fresh, filtered, saturated solution of
TCH for 20 min at room temperature.
14. Wash 6, in distilled water 5 min each.
15. Incubate in 1 % aqueous OsO4 for 1 h at room temperature.
16. Wash 6 in distilled water.
17. Repeat incubation in TCH and OsO4 as in steps 1315.
18. Dehydrate the samples through an ethanol series from 30 to
90 % incubating for 10 min each on a rotator.
19. Dehydrate the samples 2 in 100 % ethanol for 10 min each
(see Note 7).
20. Samples are then critical point dried from liquid CO2.
21. Mount the dried samples with the epithelium side up onto
SEM stubs using silver conductive paint (see Notes 8 and 9).
22. Leave the samples to fully dry before sputter coating.
23. Sputter-coat with platinum as per device manufacturers
protocol.
24. The samples are ready for observation under a scanning electron
microscope.
3.3 SEM
of Demembranated
Inner Ear Epithelia
Tissue
Prior to fixation, the surface membranes can be removed to reveal

the underlying cellular ultrastructural organization. Thus, details
of the cytoskeletal arrangement that contribute to the overall architecture can be examined using a high resolution SEM. In addition
to visualizing structural components, immunogold labelling can be
applied to localize proteins and actin filaments can be labelled with
261
gold particles by exposing the sample to gold-conjugated phalloidin.

Secondary gold markers are imaged using backscattered electron
detection (see Note 10).
1. Immediately after isolation, incubate the opened otic capsule
for 7 min at room temperature in 0.25 % Triton X-100 with
0.25 % saponin in CPP buffer. Agitate gently on a rotator or
rocker.
2. Rinse the sample three times in cytoskeletal buffer.
3. Fix in 2.5 % glutaraldehyde in CPP buffer (without protease
inhibitor) for 2.5 h for morphological examination.
4. Briefly rinse samples in 0.1 M cacodylate buffer.
5. Post-fix in OsO4 for 90 min.
6. Rinse 3 with cacodylate buffer.
7. Dissect the saccule and utricle from the labyrinth.
8. Process tissue through the thiocarbohydrazide-OsO4 repeated
procedure before dehydration and critical point drying (see
Subheading 3.2, steps 1121).
9. Do not sputter-coat. The tissue is examined in a field emission
SEM operating at 3 or 5 kV.
3.4 Demembranation
and Gold Labelling
of Tissue
1. Remove plasma membrane with extraction technique (see

Subheading 3.3, step 1).
2. Rinse three times in CPP buffer.
3. Fix tissue in
glutaraldehyde.
paraformaldehyde
with
0.05
4. Block nonspecific antigens with blocking solution.

5. Incubate tissue in primary antibody for 3 h at room
temperature.
6. Rinse with PBS wash solution 4, 10 min each.
7. Incubate in secondary antibody (goat anti-rabbit IgG
conjugated to 10 or 15 nm gold particles) overnight at 4 C.
8. Thoroughly rinse in PBS wash solution.
9. Postfix in 2.5 % glutaraldehyde for 1 h at room temperature.
10. Processing the tissues for SEM (see Subheading 3.3, steps 49).
11. Carbon-coat tissue (see Note 11).
12. Use backscatter detection in the SEM to visualize the gold
labelling of the sample.
3.5 Transmission
Electron Microscopy
For complete sections of the inner ear labyrinth, intact otic capsules can be sectioned following glutaraldehyde fixation and decalcification (see Note 12). However, end organs can be dissected
from the otic capsule following fixation and post-fixation with
osmium and processed for TEM as for intact otic capsules.
262
Ruth R. Taylor
1. Fix and process samples (see Subheading 3.2, steps 110).

2. Dehydrate samples in an ethanol series to 70 % ethanol.
3. En bloc stain in saturated uranyl acetate in 70 % ethanol overnight (see Note 13).
4. Remove uranyl acetate.
5. Completely dehydrate the samples through to 100 % ethanol.
6. Incubate tissue in propylene oxide for 15 min.
7. Repeat step 6.
8. Incubate in propylene oxide and plastic resin 3:1 for 2 h.
9. Leave the tissue overnight in 1:1 propylene oxide; resin
(see Note 14).
10. Infiltrate in pure resin.
11. For embedding the tissue, place the sample infiltrated by pure
resin in a mold and orient the tissue as desired under a
stereomicroscope.
12. Polymerize by incubating for 24 h at 60 C.
13. Ultrathin sections are cut from the polymerized block using a
diamond knife. Sections of 80 nm thick are collected on to
uncoated copper grids (see Note 15).
14. Stain the sections by floating the grids (section-side down) on
droplets of 1 % aqueous uranyl acetate for 15 min.
15. Wash 3 on droplets of deionised water.
16. Stain with lead citrate solution as in step 14 (see Note 16).
17. Wash 3 deionized water.
18. Examine the sections in a transmission electron microscope.
3.6 Immunofluorescence for Hair
Cell Detection
After fixation and opening of the otic capsule from culture, tissues
can be processed for immunofluorescence either as an intact labyrinth or the maculae and cristae can be dissected out at the onset.
To prevent loss of the samples processing is carried out using 72 or
96 well plates. During change of solutions damage to the epithelium should be avoided by gently aspirating fluid from around the
tissue or if tissue is manipulated from one well to the next a fine
spatula is used to lift the sample from underneath.
1. Fix inner ear epithelia in situ within the otic capsule using 4 %
paraformaldehyde for 90 min. Initially, a small amount of fixative is gently perfused through the oval window using a syringe
to ensure that the fixative reaches the entire labyrinth rapidly.
2. Rinse the otic capsule 3 for 5 min each with PBS.
3. Transfer the otic capsule to a 35 mm petri dish with PBS and
place under a dissecting microscope.
263
4. Open otic capsule using a stainless steel probe or fine dental

instrument, such as a dental excavator, and remove the labyrinth with a fine forceps.
5. Dissect the maculae and cristae and remove any remaining otoconial membrane.
6. Incubate the samples in 0.5 % Triton X-100 for 20 min to permeabilize the tissue.
7. Transfer the tissues to blocking solution for 40 min.
8. Replace the blocking solution with a primary antibody for hair
cell or neurofilament detection (antibodies to otoferlin, 1:200;
calretinin, neurofilament, 1:200 diluted in antibody dilution
buffer).
9. Incubate the tissues for 3 h at room temperature on a rocker or
overnight at 4 C.
10. Remove the primary antibody and add PBS.
11. Wash in PBS 4 for 10 min each in PBS.
12. Incubate the tissue is in a 1:100 dilution of the secondary antibody conjugated to either FITC or TRITC in blocking solution (see Note 17). At this step phalloidin conjugated to an
alternative fluorophore can be added to the secondary antibody at 1:1,000 dilution to detect filamentous actin.
13. Remove the secondary antibody and replace with PBS.
14. Wash 3 for 5 min each in PBS.
15. Mount the tissue using antifade mountant with or without
DAPI to label nuclei on a multispot glass slide. Carefully
manipulate the tissue to ensure that the epithelium is facing
upwards.
16. Coverslip and seal with nail varnish.
17. View the samples under a fluorescence microscope to locate
the sensory epithelium. If necessary, use confocal microscope
to acquire z-stack images.
Notes
1. Osmium tetroxide is volatile and a hazard to human health.
Handle OsO4 inside a fume hood (waste OsO4 must be collected in a marked bottle for suitable disposal).
2. Demembranation with immunogold label: following demembranation in buffer at pH 6.0 and fixation the tissue needs to
be processed in cytoskeletal buffer at pH 7.0.
3. Care should be taken to wear gloves when handling the newts
to prevent Salmonella transmission or fungal contamination.
264
Ruth R. Taylor
Both ears can be used for all experiments but it makes good
practice to use one ear as a control without ablating the hair
cells so that any effects of culturing can be considered. When
both ears are used for regeneration study, it is useful to fix one
for immunohistochemical analysis and the other for electron
microscopy. Incubators for amphibian cell culture should be
set at 25 C with 2 % CO2.
4. All further procedures should be carried out in a laminar flow
hood with sterile tools and medium to prevent infection.
5. Extensive hair cell loss is seen at 2 days post-gentamicin treatment and hair cell regeneration begins around 12 days
post-treatment.
6. As an alternative to specimen holders specifically produced for
electron microscopy, we have found that plastic capsules with
an open lattice base (such as those used to hold desiccant) suitable as they allow fluids to be drained from the samples without damage or loss of tissue. To prevent loss during the critical
point drying stage cover the capsules with copper mesh or lids
if available.
7. If required, the process can be halted at 70 % ethanol stage and
left overnight at 4 C.
8. Care should be taken that sufficient wet paint is applied to
attach the sample but that paint does not coat any of the upper
surface of the sample.
9. It is not always easy to determine orientation for mounting
specimens. Both saccule and utricle tend to be concave and on
careful inspection of the saccule the opening to the amphibian
papilla can be seen towards one edge of the epithelium. Nerve
tracts are often visible on the underneath of both end organs.
10. Biotinylated phalloidin and gold-conjugated streptavidin can
be used in conjunction with the demembranation protocol as
per immunogold labelling.
11. Carbon coat tissue by either using appropriately equipped
sputter coater or by evaporation using appropriate device.
12. We have found that otic capsules need to be incubated for several days (up to 5) in 4.13 % EDTA to decalcify sufficiently for
sectioning. They should become more translucent and when
pressed with forceps be soft and pliable.
13. Uranyl acetate is mildly radioactive and should be handled
with care. Waste uranyl acetate should be retained in a dedicated bottle for specialist disposal.
14. This infiltration technique allows for the plastic to be initially
introduced in a less viscous form and eventually all of the sample will be infiltrated with viscous plastic support material.
265
15. Training and experience are required to cut ultrathin sections

and technical staff usually perform this task.
16. Care needs to be taken to avoid carbon dioxide in the atmosphere interacting with lead citrate, which would result in precipitates of lead carbonate over the sections. This can be done
with pellets of sodium hydroxide placed locally within the
staining dish.
17. Choice of secondary antibody depends upon the host in which
the primary antibody has been raised.
Acknowledgement
Many thanks to Professor Andrew Forge for sharing his extensive
knowledge of electron microscopy techniques. This work was supported by Action on Hearing Loss (formerly RNID and Deafness
Research, UK).
References
1. Forge A, Wright T (2002) The molecular architecture of the inner ear. Brit Med Bull 63:524
2. Li L, Forge A (1997) Morphological evidence
for supporting cell to hair cell conversion in the
mammalian utricular macula. Int J Dev Neurosci
15:433446
3. Forge A, Li L, Nevill G (1998) Hair cell recovery in the vestibular sensory epithelia of mature
guinea pigs. J Comp Neurol 397:6988
4. Taylor RR, Forge A (2005) Hair cell regeneration in sensory epithelia from the inner ear of a
urodele amphibian. J Comp Neurol 484:
105120
5. Forge A, Schacht J (2000) Aminoglycoside antibiotics. Audiol Neuro-otol 5:322
6. Davies S, Forge A (1987) Preparation of the
mammalian organ of Corti for scanning electron
microscopy. J Microsc 147:89101
Part IV
Transgenesis in Salamanders
Chapter 21
Transgenesis in Axolotl (Ambystoma mexicanum)
Abstract
Transgenic animals have been indispensable in elucidating and deciphering mechanisms underlying various
biological phenomena. In regeneration, transgenic animals expressing fluorescent protein genes have been
crucial for identifying the source cells for regeneration and the mechanism of blastema formation. Animals
are usually generated by manipulating their genome using various techniques at/in one cell embryo/fertilized
egg stage. Here, we describe the generation of germline transgenic axolotls (Ambystoma mexicanum) using
the I-SceI meganuclease and Tol2 transposase.
Key words Salamander, I-SceI meganuclease, Tol2 transposase, Transgenics
Introduction
The ability to generate transgenic vertebrate animals has transformed
the molecular analysis of development, adult physiology, and disease. Recently, generation of transgenic animals via the random
integration of plasmid or BAC constructs into the genome has
been applied to zebrafish and axolotl systems for the purposes of
studying regeneration. The implementation of these animals has
had a fundamental role in elucidating the cell sources of regenerating
structures, the mechanisms by which regenerating tissue forms, as
well as analysis of molecular pathways operating during regeneration [18].
Such insights have been gained in salamander limb and spinal
cord regeneration via the generation of transgenic axolotls. Axolotls
are the most easily bred salamander species in laboratory setting
throughout the year with an average spawn size of 500 eggs per
mating. Adult axolotls are kept in water with an average temperature of 1820 C (0.5 C) with a daynight cycle of 12 h. The
conductivity of water is in the range of 500750 microSiemens
(S)/cm with a pH between 7.0 and 8.0. The level of NO2 in water
should be zero and that of NO3 should be kept below 100 mg/l.
The water should be dechlorinated by overnight evaporation,
269
270
chemical conditioning or carbon filtering and changed three times

per week. Freshly hatched axolotl larvae are fed daily with brine
shrimps (artemia) until reaching 5 cm in size (snout-to-tail).
Animals from 6 to 20 cm are fed small (3 mm) fish pellets and
artemia everyday. The amount of artemia is gradually decreased so
the animals get only fish pellets when they reach around 10 cm
in size. Adults (>20 cm in size) are fed big (5 mm) fish pellets three
times per week.
Male axolotls reach sexual maturity between 9 and 12 months
while females are ready to be mated between 12 and 15 months of
age. Males can be mated every 4 weeks, whereas females are ready
to mate again in 8 weeks from the previous spawn. For mating, the
male and female are put together in a covered mating tank (temperature 1516 C). The animals should not be disturbed until the
female starts to lay eggs. Plastic leaves in the tank help the females
to lay eggs on and facilitate the harvesting of eggs.
Transgenic axolotls have been generated using I-SceI meganuclease and Tol2 transposase [911]. Both these methods involve
collecting one cell stage fertilized eggs followed by injecting the
collected eggs with a mixture of DNA and I-SceI meganuclease or
DNA and Tol2 transposase enzymes. Germline establishment of
axolotl transgenic lines is dependent on identifying and growing
up the founder animals. Founder animals ideally express the transgene in all cells of its body and show no signs of morphological
abnormality. The founder animals are grown to sexual maturity
(1215 months) and mated with a non-transgenic mate to determine the germline transmission. Both Tol2 and I-SceI mediate
integration of the transgene into the genome but Tol2 seems to be
more efficient than I-SceI enzyme. Because of being highly efficient, founders generated via Tol2 method sometimes have nonuniform expression of transgene between cells of the same animal.
This is presumably due to multiple integrations of the DNA
between different cells of the same animal. On the other hand, the
I-SceI meganuclease method generates fewer but uniformly
expressing founders. Although the best way is to verify the expression of transgene in each cell is by cutting, sectioning and/or
immunostaining the limb or tail of the founder animal, this is timeconsuming and not a visual representation of the transgene expression. An easy and efficient way is to insert a fluorescent reporter in
the DNA being injected. This allows easy visualization and selection of the putative founder animal.
2
2.1
Materials
Equipment
1. Axolotls (can be purchased from the Ambystoma Genetic

Stock Center).
2. Artemia and fish pellets.
Axolotl Transgenesis
271
3. I-SceI enzyme and I-SceI enzyme buffer.

4. Plasmids: pBSII-SK-mTol2-MCS and T7-TPase (available
from Addgene).
5. DNA Plasmid Maxi Kit.
6. Scalpels to scrape the eggs from the leaves.
7. Containers for collecting eggs and to keep animals.
8. Cups to keep small animals.
9. Sieve to rinse the eggs.
10. Fish nets (8, 10, and 20 cm size).
11. Three pairs of forceps: two to dejelly the eggs and one to break
the needle for injection.
12. Petri dishes to collect eggs (145, 94, 60, and 30 mm).
13. 24-well plates to keep the embryos for the first week.
14. Sterile plastic transfer pipettes (2 mL) to transfer the embryos.
15. Slide with micrometric scale, 0.1 mm to determine the volume
of the injection-droplet.
16. Mold for making injection plates (Fig. 1).
17. Stereomicroscope with a light source.
18. PV830 Pneumatic Pico Pump.
19. Micromanipulator and microelectrode holder for injection.
20. Glass capillaries with 1.00 mm O.D. 0.58 mm.
21. Micropipette Puller.
22. mMESSAGE mMACHINE T7 ULTRA Kit.
Fig. 1 Shows the plastic mold for making the injection plate. The mold shown
here is for making a 10 cm injection plate. Reproduced from ref. [11]
272
2.2
Solutions
1. 10 MMR: Mix 400 mL of 5 M NaCl, 40 mL of 1 M KCl,

20 mL of 1 M MgCl2, 40 mL of 1 M CaCl2, 4 mL of 0.5 M
EDTA, 100 mL of 1 M HEPES. Fill up to 1.5 L with deionized water. Adjust the pH to 7.8 with 10 M KOH. Fill up to
2 L with deionized water. Autoclave and store at room temperature for up to 6 months.
2. 1 MMR/pen-strep: mix 100 mL of 10 MMR with 13 mL
of PenicillinStreptomycin and fill up to 1 L with deionized
water. Filter-sterile and store at room temperature for up to
2 months.
3. 1 MMR/20 % (wt/vol) Ficoll/pen-strep: mix 25 mL of 10
MMR, 50 g of Ficoll and 7 mL of PenicillinStreptomycin.
Fill up to 250 mL with deionized water. Filter-sterile and store
at 4 C for up to 2 months.
4. 0.1 MMR/5 % (wt/vol) Ficoll/pen-strep: mix 10 mL of 10
MMR, 50 g of Ficoll and 13 mL of PenicillinStreptomycin.
Fill up to 1 L with deionized water. Filter-sterile and store at
4 C for up to 2 months.
5. 0.1 MMR/pen-strep: mix 20 mL of 10 MMR and 25 mL of
PenicillinStreptomycin. Fill up to 2 L with deionized water.
Filter-sterile and store at Room Temperature for up to 2 months.
6. Holtfreters Solution (400 % concentration): mix 2.875 g of
KCl, 5.36 g of CaCl22H2O, 11.125 g of MgSO47H2O and
158.4 g of NaCl. Fill up to 10 L with distilled water. Store at
room temperature for up to 6 months.
7. 10 TBS: For 1 L, add 24.2 g of TRIS and 90 g of NaCl in
990 mL of distilled water. Mix well with stir bar and adjust the
pH to 8.0 by adding 10 mL of HCl (37 %). Store at room
temperature for up to 6 months.
8. Benzocaine 10 % (wt/vol): mix 50 g of Benzocaine in
500 mL of 100 % Ethanol. Store at room temperature for
up to 12 months.
9. Anesthetic for Axolotls: 0.03 % (vol/vol) Benzocaine: To make
10 L mix 500 mL of 10 TBS, 500 mL of 400 % Holtfreters
and 30 mL of 10 % Benzocaine. Fill up to 10 L with distilled
water and store at room temperature for up to 6 months.
Methods
3.1 Preparing DNA

and Tol2 mRNA
for Injection
1. Clone the transgene cassette in the multiple cloning sites of the

pBSII-SK-mTol2-MCS plasmid. Cloning the cassette in the
multiple cloning site allows the use of I-SceI meganuclease OR
the Tol2 transposase method to generate transgenic axolotls
(Fig. 2).
273
Fig. 2 Graphic map of pBSII-SK-mTol2-MCS plasmid. MCS: Multiple cloning

site to clone the cassette of interest for making transgenic axolotls. Note that the
MCS is surrounded by both I-SceI meganuclease as well as Tol2 transposase
sites/sequences. This gives the user flexibility to use one or the other method or
do a direct comparison between the two techniques using the same plasmid.
Reproduced from ref. [11]
2. Maxiprep the resulting plasmid using standard kits and

sequence verify that the miniTol2, I-SceI sites and the transgenic
expression cassettes are intact and harbor the correct expected
sequence.
3. Prepare Tol2 transposase mRNA by linearizing the T7-TPase
plasmid with BspEI enzyme and utilizing it as template for
in vitro transcription by following manufacturers instruction
of mMESSAGE mMACHINE T7 Ultra Kit.
Make aliquots of DNA (step 2) and in vitro transcribed
RNA (step 3) and store them at 20 C and 80 C respectively
(see Note 1).
3.2 Plate
and Needles
1. Pour 10 mL of 2 % (wt/vol) agar solution (made in distilled

water) in a 10 cm plastic petri dish.
2. Place the injection mold (upside down) (Fig. 1) into the agar
solution and let it solidify at room temperature.
274
Fig. 3 Depicts a 10 cm injection plate and the mold used to make this injection
plate. Axolotl eggs are aligned in the grooves/channels of the injection plate to be
injected with DNA injection mix
Fig. 4 The injection needle is made by pulling a glass capillary with a micropipette puller
3. Carefully remove the mold. This will result in channels for

holding the eggs in a soft agar bed (Fig. 3).
4. Prepare multiple plates and seal them with Parafilm and store
at 4 C until use.
5. For injection needles, pull the glass capillaries (1.00 mm
O.D. 0.58 mm) using a micropipette puller and store them
for future use (Fig. 4).
3.3 Egg Collection

for Injection
275
1. Collect the eggs from the plastic leaves by gently scraping them
off with a scalpel and place them in a metal sieve.
2. Rinse the eggs with 70 % Ethanol for approximately 1520 s
followed by rinsing thoroughly (but gently) with sterile water.
3. Place the eggs in a petri dish containing 1 MMR/pen-strep
solution using a transfer pipette.
4. Under stereomicroscope, manually dejelly the eggs using sharp
forceps/tweezers.
Transfer the dejellyed eggs into a clean petri dish containing
1 MMR/pen-strep solution (see Note 2).
3.4 Injection of DNA

into Eggs
1. Pour 1 MMR/20 % Ficoll/pen-strep solution in the injection

plate (step 4, Subheading 3.2).
2. Gently align the dejellyed eggs (step 5, Subheading 3.3) in the
grooves of the injection plate (Fig. 3).
3. Prepare the injection mix in a 1.5 mL tube and keep it on ice
until use.
For Tol2 mediated transgenesis, inject a volume of 5 nL per
egg with a total plasmid DNA concentration of 0.05 ng and
0.25 ng of Tol2 RNA (see Note 3).
For I-SceI transgenesis, inject a total of 0.5 ng DNA in 5 nL
volume per egg. To prepare 10 L injection mix, take 1 g DNA,
1 L of 10 I-SceI buffer, 2 L I-SceI (5,000 U/mL) I-SceI
enzyme and fill it up to 10 L with DNAseRNAse-free water.
4. Fill up the pulled glass needle (step 5, Subheading 3.2) with
the injection mix and attach the needle to micromanipulator
and pneumatic injection pump.
5. Break the tip of the needle using the slide with micrometric
scale under the stereomicroscope such that 5 nL of injection
mix is released when pressure is applied through the pneumatic
injection pump (Fig. 5).
6. Gently insert the needle in the animal pole of the eggs and
release the 5 nL of injection mix half way into the animal pole.
7. By moving the injection plate, inject all the aligned eggs one
by one. Leave some the eggs as uninjected control.
8. Transfer the eggs in a petri dish containing 1 MMR/20 %
Ficoll/pen-strep solution and leave at room temperature
for 2 h.
9. After 2 h, transfer the injected eggs into a fresh petri dish containing 0.1 MMR/5 % Ficoll/pen-strep solution and leave
them undisturbed for 24 h at room temperature.
276
Fig. 5 A 5 nL drop size is measured using the DNA injection mixed filled injection
needle using the micrometric scale under the stereomicroscope. If the drop size
is not optimal, break the needle more or adjust the pressure of the pneumatic
injection pump to obtain the 5 nL volume drop size
10. Transfer the healthy eggs into a sterile 24-well plate (one egg per
well) containing 0.1 MMR/ pen-strep solution. Let the eggs
develop for 78 days in the 24-well plate at room temperature.
11. Using a transfer pipette, gently transfer (one by one) the normally developed larvae from the wells of the 24-well plate to a
145 mm petri dish containing 0.1 MMR/pen-strep solution.
12. The larvae will start swimming after 23 days.
3.5 Transgenic
Larvae Screening
1. Dilute the benzocaine to 0.01 % with distilled water. This is

used to anesthetize the larvae.
2. Cut the tip of the transfer pipette to make it wide bore for
picking up the swimming larvae.
3. Place the wide bore transfer pipette in front of the larva such
that larvae will swim into it.
4. Gently place the larva from the transfer pipette into the 0.01 %
benzocaine and wait for it to anesthetize.
5. Using the same pipette, gently pick up the anesthetized larva and
place it in a drop of water in a petri dish and observe under the
fluorescence microscope for transgene expression (see Note 4).
Notes
1. The in vitro transcription of Tol2 transposase should be performed in a RNAse free environment. Wipe the bench with
RNAse away or similar products. Use only DNAse-, RNAse-free
277
filter tips and tubes. We usually make aliquots of 4.1 L of

500 ng/L concentrated in vitro transcribed RNA in 0.2 mL
PCR tubes for storing at 80 C.
2. Pre-screen the eggs for signs of damage or abnormal developing eggs. A healthy egg would contain two regions/poles.
A dark brown animal pole and a beige vegetal pole. Care should
be taken not to injure the egg and touch it with the sharp
forceps/tweezers.
3. The amount mentioned for injection is for an 8,000 bp size
plasmid. We recommend doing a pilot experiment for every
new plasmid that needs to be injected. The pilot experiment
should be to determine the optimal/best combination of plasmid DNA vs. Tol2 RNA to obtain a founder that expresses the
transgene in majority of its cells in the body.
4. While screening, only anesthetize 12 larvae, as the freshly
hatched larvae are very sensitive to benzocaine. As soon as the
screening is over, place it back into 0.1 MMR/pen-strep
solution. Then anesthetize the next 12 larvae for screening
and so on.
References
1. Kragl M, Knapp D, Nacu E, Khattak S, Maden
M, Epperlein HH, Tanaka EM (2009) Cells
keep a memory of their tissue origin during
axolotl limb regeneration. Nature 460:6065
2. McHedlishvili L, Mazurov V, Grassme KS,
Goehler K, Robl B, Tazaki A, Roensch K,
Duemmler
A,
Tanaka
EM
(2012)
Reconstitution of the central and peripheral
nervous system during salamander tail regeneration. Proc Natl Acad Sci U S A 109:
E2258E2266
and stem cell recruitment during skeletal muscle regeneration in two salamander species. Cell
Stem Cell 14:174187
4. Khattak S, Schuez M, Richter T, Knapp D,
Haigo SL, Sandoval-Guzman T, Hradlikova K,
Duemmler A, Kerney R, Tanaka EM (2013)
Germline transgenic methods for tracking cells
and testing gene function during regeneration
in the Axolotl. Stem Cell Reports 1:90103
5. McHedlishvili L, Epperlein HH, Telzerow A,
Tanaka EM (2007) A clonal analysis of neural
progenitors during axolotl spinal cord regeneration reveals evidence for both spatially
restricted and multipotent progenitors.
6. Chen CH, Durand E, Wang J, Zon LI, Poss

KD (2013) zebraflash transgenic lines for
in vivo bioluminescence imaging of stem cells
and regeneration in adult zebrafish.
Development 140(24):49884997
7. Gupta V, Poss KD (2012) Clonally dominant
cardiomyocytes direct heart morphogenesis.
Nature 484:479484
8. Choi WY, Gemberling M, Wang J, Holdway
JE, Shen MC, Karlstrom RO, Poss KD (2013)
In vivo monitoring of cardiomyocyte proliferation to identify chemical modifiers of heart
regeneration. Development 140:660666
9. Sobkow L, Epperlein HH, Herklotz S, Straube
WL, Tanaka EM (2006) A germline GFP transgenic axolotl and its use to track cell fate: dual
origin of the fin mesenchyme during development and the fate of blood cells during regeneration. Dev Biol 290:386397
10. Khattak S, Richter T, Tanaka EM (2009)
Generation of transgenic axolotls (Ambystoma
mexicanum). Cold Spring Harb Protoc
2009(8):pdb prot5264. doi:10.1101/pdb.
prot5264
11. Khattak S, Murawala P, Andreas H, Kappert V,
metamorphosis, transgenesis and tamoxifenmediated recombination. Nat Protoc 9:529540
Chapter 22
Generating and Identifying Axolotls with Targeted
Mutations Using Cas9 RNAGuided Nuclease
Abstract
The CRISPR/Cas9 RNA-guided nuclease now enables a reverse genetics approach to investigate the function
of genes of interest during regeneration in the axolotl. The process of generating the constructs necessary
for targeting a gene of interest is considerably less labor intensive than for other methods of targeted mutagenesis such as Zinc finger nucleases or Transcription activator-like effector nucleases. Here, we describe
the identification of targetable sequences in the gene of interest, the construction of unique guide RNAs,
the microinjection of these RNAs with Cas9-encoding mRNA, the selection of well-injected animals, and
an inexpensive, PCR-based method for identifying highly mutagenized animals.
Key words Transgenesis, Salamander, CRISPR, Limb regeneration, Guide RNA
Introduction
The axolotl has a long history of use as a genetic model organism,
but in recent decades it has been surpassed in use by other amphibian and aquatic model systems such as Xenopus species and zebrafish
[1]. While a number of mutant axolotl lines have been identified,
the comparatively long generation time and exceptionally large,
currently unsequenced, genome hinder genetic studies in the
axolotl. Nonetheless, better-characterized genetic model organisms lack the remarkable adult regenerative ability of the axolotl,
and because of this fascinating ability the axolotl continues to be a
premiere vertebrate model organism for regeneration research [2].
Numerous recent studies identifying transcripts and proteins
specifically upregulated in various tissues during regeneration are
providing greater insight into the molecular mechanisms governing regeneration in the axolotl [39], though the tools for investigating the function of these genes in vivo have been relatively
blunt, with ectopic overexpression and transient knockdown via
279
280
morpholino the primary tools for analysis. Techniques in which

selected genes can be completely functionally ablated can provide
more definitive evidence of whether genes implicated in regeneration
are essential for this process.
In recent years, a number of advances in targeted mutagenesis
now permit the generation of cell lines and whole organisms
with mutations at targeted sites. Zinc-finger nucleases (ZFN) [10],
Transcription activator-like effector nucleases (TALENS) [11], and
RNA-guided nucleases (RGNs) derived from bacterial Clustered
Regularly Interspersed Short Palindromic Repeats (CRISPR) [12]
all act to induce double strand breaks at targeted sequences which
are inefficiently repaired by nonhomologous end-joining mechanisms. The most recently developed of these systems, CRISPRderived RGNs, are particularly attracting the attention of
researchers as, rather than requiring the generation of a unique
protein to target a sequence of interest, RGNs use short guide
RNAs (sgRNA) to direct the Cas9 nuclease to the targeted
sequence. We find that the comparative ease of assembly of RGN
constructs as well as their efficiency at generating high mutation
rates at targeted sites make them very well suited for work in the
axolotl [13]. This innovation, combined with the growing body of
data regarding the axolotl transcriptome, allows the use of a reverse
genetic approach to probe the function of genes during tissue
regeneration.
While the CRISPR RGN system has been demonstrated to
work very well in a number of organisms, including the axolotl,
there are a number of challenges to consider when applying this
technique to the axolotl. The axolotl genome is currently
unsequenced, though multiple accessible sources of cDNA
sequencing are available [7, 14]. These data are sufficient for targeting a large number of genes implicated in regeneration; however, several steps should be taken to confirm the identity of
targetable sequences and that successful targeted mutagenesis can
subsequently be verified. Using currently available sequence, one
is only typically able to amplify short sequences of 100200 bases
around targeted sites, a product size insufficiently large to be
used in several of the endonuclease-based assays that are frequently used to screen for targeted mutagenesis in other organisms. Thus, we have adapted a protocol for rapidly screening for
mutagenesis frequency using very small, fluorescently labeled
PCR products and capillary electrophoresis. Despite several challenges, the rapid assembly of constructs for this system, combined with our novel screening protocol, allows one to proceed
from selection of a gene to target to identifying highly mutagenized animals in less than a week.
Generating and Identifying Axolotls with Targeted Mutations Using Cas9
281
Materials
2.1 sgDNA
Construction
Components
1. pDR274 expression Vector (Addgene Plasmid 42250).

2. BsaI restriction enzyme (NEB).
3. QIAquick PCR purification kit (Qiagen).
4. Two oligonucleotides containing target sequence and 5 ends
compatible with pDR274.
5. 10 Annealing buffer (0.4 M TrisHCl, 0.2 M MgCl2, 0.5 M
NaCl, 10 mM EDTA, pH 8.0).
6. Thermocycler.
7. Quick Ligase (NEB).
8. Chemically competent Dh5 cells.
9. QIAprep Spin Miniprep kit (Qiagen).
10. 0.8 % agarose TAE gel.
2.2 sgRNA and Cas9

mRNA Synthesis
Components
1. pMLM3613 Cas9 expression vector (Addgene Plasmid 42251).

2. DraI restriction enzyme (NEB).
3. PmeI restriction enzyme (NEB).
4. Phenolchloroformisoamyl alcohol (25:24:1).
5. Chloroform.
6. RNase-free 100 % ethanol.
7. 3 M sodium acetate pH 5.2.
8. RNase-free water.
9. 100 % isopropanol.
10. T7 Maxi script kit (Life Technologies).
11. T7 mMessage mMachine kit (Life Technologies).
12. 20 SB buffer (720 mM boric acid, 200 mM NaOH).
13. RNA loading dye.
14. ssRNA ladder (NEB).
15. GlycoBlue Coprecipitant (Life Technologies, optional).
2.3 Mating
Components
1. 10 L plastic tub.
2. Novaqua (Kordon).
3. Amquel (Kordon).
4. Modified 40 % Holtfreters solution (20 mM NaCl, 0.2 mM
KCl, 0.8 mM NaHCO3, 0.2 mM CaCl2, 4 mM MgSO4,
0.1 mL/L Amquel, 0.1 mL/L Novaquel, pH to 7.5).
5. Freezer bags.
6. Sealable plastic bags.
282
7. Rounded stones.
8. Plastic Foliage.
9. Male and female axolotl.
10. Fish nets.
2.4 RNA
Microinjection
Components
1. 25 75 1 mm microscope slides.
2. 100 mm 15 mm petri dishes.
3. Agarose.
4. 10 Marcs Modified Ringers (1 M NaCl, 20 mM KCl, 10 mM
MgS04, 20 mM CaCl2, 50 mM HEPES, pH 7.4, autoclaved)
use to make 1 MMR with 50 U/L PenicillinStreptomycin,
0.1 MMR with 50 U/L PenicillinStreptomycin, 1 MMR
with 20 % Ficoll and 50 U/L PenicillinStreptomycin, and
0.1 MMR with 50 U/L PenicillinStreptomycin.
5. Ficoll PM 400 (Sigma-Aldrich).
6. PenicillinStreptomycin.
7. Fine forceps (e.g., Dumont #55 Fine Forceps, Fine Science
Tools).
8. Micropipette Puller (e.g., Flaming/Brown P-87, Sutter).
9. 1 mm glass capillary with filament (e.g., TW100F-4, World
Precision Instruments).
10. Microloader tips.
11. Microinjector (e.g., Picospritzer III, Parker-Hannifin).
12. Dissecting microscope with fluorescence.
13. Hemocytometer or scale slide.
2.5 Genotyping
Components
1. DNeasy Blood and Tissue Kit (Qiagen).

2. Tricaine methanesulfonate.
3. 35 mm petri dish.
4. Scalpel blades.
5. 100 mM NaOH.
6. 1 M TrisHCl pH 7.4.
7. PCR-confirmed gene specific primers.
8. One gene specific primer with TCCCAGTCACGACGTsequence at 5 end.
9. Primer with m13 (TCCCAGTCACGACGT) sequence and 5
6-FAM modification (available through IDT, Invitrogen, and
Operon).
10. Taq Polymerase.
11. dNTPs.
12. Hi-Di Formamide (Life Technologies).
283
Methods
3.1 sgDNA
Construction
1. Linearize 4 g of pDR274 with 10 L 10 CutSmart buffer

and 5 L of BsaI enzyme and bring to 100 L with water.
Digest at 37 C for 1 h.
2. Purify using QIAquick PCR purification kit or other method,
determine concentration by spectrophotometry, and adjust
concentration to 25 ng/L. This stock of linear pDR274
should be sufficient for generating hundreds of unique
constructs.
3. Identify targetable sites in your gene of interest (Fig. 1a)
(see Note 1).
4. Obtain two oligonucleotides corresponding to your site. The
sequence of oligonucleotide 1 should be TA + 20 base target
sequence (up to, but not including the NGG protoadaptor
motif). Oligonucleotide 2 should also be 22 bases, beginning
with 5-AAAC and followed by the reverse complement of the
last 18 bases of the target sequence (Fig. 1b). When annealed,
these primers will have two overhangs, one 5-TAGG and the
other 5AAAC that are compatible with the overhangs of BsaIdigested pDR274 (Fig. 1c).
5. Resuspend your oligonucleotides in water to bring to a final
concentration of 100 M.
6. Add 1 L of each oligonucleotide to 5 L 10 annealing buffer
and bring to 50 L with H2O in a PCR tube.
7. Anneal primers by placing in a thermocycler and running the following program: 98 C for 0: 30 s, 5 C per cycle for 17 cycles.
Fig. 1 Schematic of genomic RGN target and oligonucleotides used to construct targeting vector. (a) Putative
genomic sequence with target sequence in blue and the protoadaptor motif in red. This sequence conforms to
the GG(N1N18)NGG constraints. (b) The sequence of the two oligonucleotides used to insert the targeting
sequence into the pDR274 vector. (c) After annealing, the oligos will have two 5 overhangs compatible with
the BsaI-cut ends of pDR274. One end will have a TAGG overhang, where the GG corresponds to the first two
bases of the target site. The other end will have an AAAC overhang
284
8. Mix 1 L of annealed primers, 1 L of BsaI-linearized pDR274

(25 ng), 7 L H2O, 10 L 2 NEB Quick Ligase Buffer, and
1 L T4 DNA ligase. Incubate at room temperature for 10 min.
9. Use 1 L of ligation to transform 50 L of Dh5 cells, and
plate on 50 g/mL kanamycin plates.
10. The following day pick four to eight colonies from plate and
grow up in 1 mL LB overnight with 50 g/mL kanamycin.
11. The next day, carry out minipreps of selected colonies using
QIAprep Spin Miniprep kit or preferred method.
12. Screen for correct ligations by digesting 2 L of miniprepped
DNA, with 0.5 L BsaI in 1 L of 10 CutSmart buffer, and
6.5 L H2O for 1 h at 37 C. The proper ligation of the target
sequence into pDR274 eliminates BsaI cut sites.
13. Run the digests on 0.8 % agarose gel in TAE. Failed ligations
produce a single linearized band, while correct products will
produce multiple undigested bands migrating at different speeds.
14. Submit one or two plasmids for sequencing with the forward
m13 primer (5-GTAAAACGACGGCCAGT-3, see Note 2).
Two minipreps of these constructs should provide template to
synthesize enough RNA to inject thousands of embryos.
15. Upon confirmation that the construct contains the correct targeting sequence, linearize the DNA. Digest 20 L of the miniprepped plasmid DNA with 5 L of DraI in 10 L of CutSmart
buffer and 65 L H2O for 1 h at 37 C.
16. Add 100 L of RNase-free H2O and 200 L of phenolchloroformisoamyl alcohol. Vortex.
17. Spin at top speed (<15,000 g) on a benchtop centrifuge for
5 min.
18. Collect just under 200 L from the upper aqueous phase,
being very careful to avoid collecting any of the lower phase.
Add 200 L of chloroform and vortex.
3 min.
20. Collect just under 200 L from the upper aqueous phase, being
very careful to avoid collecting any of the lower phase (steps 18
through 20 may be repeated for optimal purification).
21. Add 75 L of 3 M Sodium Acetate pH 5.2 and 500 L 100 %
ethanol. Adding 1 L of GlycoBlue can facilitate the precipitation and visualization of the pellet, but is not necessary. Store
at 20 C for at least 1 h.
22. Spin at top speed (<15,000 g) in centrifuge for 15 min.
23. Remove ethanol and wash pellet with 500 L of chilled 70 %
ethanol. Spin at top speed (<15,000 g) in centrifuge for 5 min.
285
24. Remove as much ethanol as possible without dislodging pellet

and air-dry to remove residual ethanol.
25. Resuspend in 10 L of RNase-free H2O.
26. Quantify DNA concentration by spectrophotometry.
3.2
sgRNA Synthesis
1. Using linearized DNA and T7 MaxiScript kit, mix 1 g DNA,

2 L 10 Transcription Buffer, 1 L each of 10 mM ATP,
CTP, GTP, and UTP, 2 L T7 Enzyme mix, and bring to
20 L with RNase-free H2O. Incubate for 12 h at 37 C.
2. Add 1 L of Turbo DNase and incubate for 15 min 37 C.
3. Mix 20 L sgRNA transcription reaction with 15 L ammonium acetate, 115 L water, and 150 L of phenolchloroform
isoamyl alcohol. Vortex.
5 min.
6. Add 150 L of chloroform and vortex.
3 min.
9. Add 150 L of 100 % isopropanol and 1 L of GlycoBlue.
Freeze at 20 C for 1 h.
15 min.
11. Remove all liquid, being careful not to dislodge the pellet. Let
air-dry at room temperature.
12. Resuspend in 20 L of RNase-free H2O. Mix well and make
4 L aliquots to store at 80 C.
13. Retain 1 L for analysis using agarose gel and spectrophotometry.
14. Wipe electrophoresis equipment and gel combs with RNase
Away. Prepare 1 % agarose gel in 1 SB buffer.
15. Mix 0.5 L of sgRNA with 4.5 L H2O and 5 L of RNA
loading dye. Prepare 0.5 L of ssRNA ladder with 4.5 L H2O
and 5 L of RNA loading dye. Denature both samples at 70 C
for 10 min.
16. Run ladder and sample for 2030 min at 150 V. A single distinct band of approximately 100 bp indicates correct sgRNA
synthesis.
17. Assess sgRNA concentration by spectrophotometry.
286
3.3 Cas9 mRNA

Synthesis (See Note 3)
1. Linearize 20 L of pMLM3613 miniprepped DNA with 5 L

of PmeI in 10 L of Cutsmart Buffer and 65 L of H2O for 1 h
at 37 C.
2. Purify linearized DNA using phenolchloroform extraction
followed by ethanol precipitation as above (Subheading 3.2,
steps 1624) and resuspend air-dried pellet after 70 % ethanol
wash in 20 L H2O.
3. Assess DNA concentration by spectrophotometry.
4. Using linearized pMLM3613 DNA and T7 mMessage mMachine kit, mix 1 g DNA, 10 L of 2 NTP mix , 2 L of 10
Transcription buffer, 2 L of T7 polymerase 1 L each and
bring to 20 L with RNase-free H2O. Incubate for 12 h at
37 C.
5. Add 1 L of TurboDNase and incubate for 15 min 37 C.
6. Mix 20 L pMLM3613 transcription reaction with 15 L
ammonium acetate, 115 L water, and 150 L of phenol
chloroformisoamyl alcohol. Vortex to mix.
5 min.
Add 150 L of chloroform and vortex.
3 min.
Add 150 L of 100 % isopropanol and 1 L of GlycoBlue.
Freeze at 20 C for 1 h.
15 min.
12. Remove all liquid, being careful not to dislodge the pellet. Let
air-dry at room temperature.
13. Resuspend in 20 L of RNase-free H2O. Mix well and make
4 L aliquots to store at 80 C. Retain 1 L for analysis using
agarose gel and spectrophotometry.
14. Wipe electrophoresis equipment and gel combs with RNase
away. Prepare 1 % agarose gel in 1 SB buffer.
15. Run ladder and sample for 2030 min at 150 V. Correct
sgRNA synthesis will be indicated by a single distinct band of
approximately 5 kb.
3.4 Obtaining
and Microinjecting
Embryos (See Note 4)
1. Before injection, prepare ramps by melting 1 g of agarose in

100 mL of 1 MMR. Pour this hot agarose mixture into three
petri dishes. Place a 25 75 1 mm microscope slide diagonally
in the petri dish, propping the edge of the slide at a shallow
287
angle along the edge of the dish, to make a ramp in the agarose.
Let the agarose solidify, remove the slide, and cut away any
overhanging agarose with a razor blade.
2. Prepare injection needles. Using a P-87 Flaming/Brown
Needle Puller we use Pressure = 200, Pull = 90, Velocity = 70;
however, these parameters must be optimized for the filament
being used. This produces a needle with a very long, thin tip.
3. 4836 h before start of injection, fill lidded plastic tank with
10 L of 40 % Modified Holtfreters solution.
4. Line bottom of tank with rounded stones to prevent spermatophores from sticking to surface of tank.
5. Place plastic foliage such as leaves and plants in tank (optional).
6. Place two small freezer bags in sealed plastic bags in tank to
reduce water temperature.
7. Place sexually mature female and male in tank (see Note 5).
8. The following morning, check for successful spermatophore
deposition (see Note 6).
9. Remove the male.
10. Place the female in a fresh tub in 40 % Modified Holtfreters
solution. It will typically begin to lay eggs that evening or the
following morning.
11. Remove the tip of a 3 mL transfer pipette with scissors to create an opening larger than an axolotl egg. Collect eggs by placing the female in a fresh tub of 40 % Modified Holtfreters
solution. Scrape eggs from surface and transfer to new container with transfer pipette (see Note 7).
12. Remove excess liquid from collected eggs and place in container of 1 MMR with pen-strep on ice.
13. Transfer a few eggs to a petri dish at a time, leaving the
remaining eggs to soak in 1 MMR.
14. Under a dissecting microscope, use two very sharp forceps to
remove jelly and membrane. Take care to not damage the eggs
with your forceps.
15. Discard damaged eggs, load the dejellied eggs onto the ramp,
and remove all fluid using a transfer pipette. Cover the embryos
with several milliliters of 20 % Ficoll in 1 MMR with PenStrep (see Note 8).
16. Prepare RNA injection mix. As a starting concentration, we
mix together the RNAs to a final concentration of approximately 150 ng/L of cas9 mRNA, 30 ng/L sgRNA, and
1050 ng/L of nls-GFP mRNA just prior to injecting. Store
on ice. Using microloader tips, load an injection needle with
23 L of this mixture (see Note 9).
288
17. Using fine forceps, break the tip of your injection needle to
create an opening. Insert the needle into the microinjector
capillary holder and tightly seal.
18. Using a hemocytometer or other scale bar, inject one droplet
of your injection mix over the scale. Adjust the pulse duration
so that a single pump produces a droplet of a diameter of 180
200 m (see Note 10).
19. Orient the injection ramp so that you insert the needle into the
animal pole of the embryos along the sloped side of the ramp.
A micromanipulator is not necessary for these injections.
To confirm that the needle has not become clogged during the
procedure, occasionally inject a droplet outside of the injection
media. If necessary, adjust the pulse duration and/or clip the
needle tip to produce the proper sized droplet.
20. Very carefully place the injected embryos in an incubator at
1618 C.
21. Two to three hours post-injection gently fill the injection
plate with 0.1 MMR with pen-strep. While some leakage is
normal, remove any damaged or excessively leaking embryos
(see Note 11).
22. The following morning, gently transfer the embryos into fresh
0.1 MMR with pen-strep.
23. Continue to monitor the embryos daily, removing abnormal
embryos, and replacing media (see Note 12).
24. Depending upon the concentration of injected tracer mRNA,
the embryos will be translucent enough to assess the uniformity of injection after about 1 week. Using a fluorescence
microscope, separate embryos displaying ubiquitous fluorescent tracer expression from those displaying little or no expression (see Note 13).
3.5
DNA Extraction
1. If numbers of well-injected embryos are sufficiently large, sacrifice at least two whole embryos to assess background mutation frequency. Extract DNA from individual embryos using
QIAgen DNeasy Blood and Tissue kit.
2. After several weeks, a small quantity of tissue can be removed
from the tail of an axolotl larva without deleterious effects.
Anesthetize the larva by placing it in 0.1 g/L Tricaine in 40 %
Modified Holtfreters solution in a small petri dish.
3. When the larva stops responding to touch, using a scalpel, slice
off transparent tissue in the tail fin beyond the posterior end of
the notochord while the embryo is still submerged in Tricaine.
4. Immediately transfer the larva to a fresh container of 40 %
Modified Holtfreters solution without Tricaine.
289
5. Under the microscope, retrieve the tail clip and using forceps,
place in a 50 L PCR tube.
6. Repeat for as many larvae as necessary.
7. Using a fine pipette tip, remove excess liquid from fin clip.
8. Add 50 L of 100 mM NaOH to fin clip. Vortex well, and
centrifuge briefly.
9. In a thermocycler, heat at 95 C for 20 min.
10. Vortex well.
11. Add 15 L of 1 M TrisHCl pH 7.4 to each tube and mix well
by pipetting.
3.6 Fluorescent
PCR to Detect
Somatic Mutations
(See Note 14)
1. Identify primers around target site that produce a band (excluding primer dimers) of the predicted size by PCR (see Note 15).
2. If primary PCR produces a band of the proper size and additional bands, obtain internal nested primers and confirm that
secondary amplification produces single product of the
intended size. The primer pair producing the single, final
nested product must have melting temperatures greater than
55 C (see Note 16).
3. For one of the primers producing the single nested PCR product, obtain a new copy with forward m13 sequence
(5-TCCCAGTCACGACGT-3) attached to the 5 end.
4. Set up each primary PCR as follows:
(a) 2.5 L 10 Taq buffer.
(b) 0.5 L 10 mM dNTPs.
(c) 0.5 L 10 M forward primer.
(d) 0.5 L 10 M reverse primer.
(e) 0.125 L Taq DNA polymerase.
(f) 1 L extracted axolotl genomic DNA.
(g) To 25 L with nuclease-free water.
In each genotyping run, include at least one PCR using
genomic DNA extracted from an uninjected larva or embryo and
one PCR without DNA template to test for contamination.
5. Run the PCR on a thermocycler as follows:
(a) 95 C for 30 s.
(b) 30 cycles of 95 C for 30 s, 55 C for 20 s, 68 C for 15 s.
(c) 68 C for 1 min (see Note 17).
6. Confirm that the PCRs are successful and that there is no contamination by running 5 L of product on 1 % SB gel (see Note 18).
7. If primary PCR is successful, proceed to secondary PCR. First,
prepare 11,000 dilutions of your primary PCR products
(including no DNA control) in nuclease-free water.
290
8. Set up each secondary PCR as follows:

(a) 2.5 L 10 Taq buffer.
(b) 0.5 L 10 mM dNTPs.
(c) 0.5 L 100 nM nested m13-tailed forward primer.
(d) 0.5 L 10 M nested reverse primer.
(e) 0.5 L 10 M 6-FAM m13 primer.
(f) 0.125 L Taq DNA polymerase.
(g) 1 L 1:1,000 dilution of primary PCR (see Note 19).
9. Run the PCR on a thermocycler as follows:
(a) 95 C for 30 s.
(b) 10 cycles of 95 C for 30 s, 55 C for 20 s, 68 C for 15 s.
(c) 20 cycles of 95 C for 30 s, 53 C for 20 s, 68 C for 15 s.
(d) 68 C for 1 min.
10. Confirm that the PCRs are successful and that there is no contamination by running 5 L of product on 1 % SB gel.
11. Prepare PCR products for fragment analysis by mixing with
HiDI formamide and, if necessary, an appropriate size standard. Liz-500 is compatible with 6-FAM-labeled products
and leads to accurate size prediction of products under 300 bp
(see Note 20).
12. Using appropriate analysis software, such as Gene Marker,
identify peaks. Proper amplification from control DNA
should result in single peak of appropriate size. Mutagenized
animals usually display multiple peaks of differing sizes (Fig. 2)
(see Note 21).
13. To develop homozygous mutant lines, raise candidate mutagenized animals to sexual maturity (see Note 22).
Fig. 2 Analysis of fluorescent fragment sizes after PCR of targeted gene from uninjected (a) and RGN-injected
(b) animals. While a PCR of the region of interest from DNA from a control animal produces a single peak of the
expected size (a), PCR of DNA extracted from an RGN-injected animal reveals multiple products indicating a
high deletion frequency in the target site
291
Notes
1. Several online sources provide useful EST sequencing and
cDNA sequences that can be used to identify potential target
sites. These include GenBank, Sal-site (www.ambystoma.org),
and Axolomics (www.axolomics.org). There are several constraints on the selection of genomic targets in the axolotl. First,
the CRISPR-derived RGN system can be used to target any
sequence preceding an NGG protoadaptor motif (PAM); however, the in vitro synthesis of sgRNAs using the T7 polymerase
will result in the attachment of GG to the 5 end of the
sgRNA. Thus, the method described here will allow one to
target any sequence that conforms to the structure of
5GG(N1N18)NGG (Fig. 1a). Such targets occur once in
every 128 bases of random sequence, and they can be identified in a sequence using the online resource http://zifit.partners.
org/ZiFiT/ . If such constraints do not permit the identification of targets, alternative strategies may be used, including,
but not limited to, synthesizing sgRNAs using Sp6 polymerase
which attaches GA to the 5 end of sgRNAs, synthesizing
sgRNAs with shorter targeting sequences [15], or permitting
mismatches between the 5 end of the sgRNA and the target
sequence [16]. Second, RGN targets should be capable of
being amplified for genotyping with available genomic information. Intron-exon boundaries are not clearly delineated in
cDNA-derived sequences and the average intron size in the
axolotl genome is larger than 10 kb [17]; thus, one should first
confirm that a target can be amplified with available sequence
data before proceeding to subsequent steps. Furthermore, targets should be spaced sufficiently far from primers used for
genotyping to detect deletions that may extend beyond the
targeted site.
2. Samples that are not digested by BsaI almost always contain
the correct product.
3. We strongly recommend assessing the quality of injection by
coinjecting an mRNA encoding a fluorescent protein with
Cas9 mRNA and the sgRNA to confirm that injected RNAs do
not undergo degradation and are uniformly distributed
throughout the embryo. A number of plasmids are publically
available from which such mRNAs encoding fluorescent proteins can be easily synthesized. Assuming such plasmids contain a polyadenylation signal sequence, synthesis of such
mRNAs should follow the same protocol as below. Linearize
the plasmid with an enzyme that cuts after the signal sequence
and use a mMessage mMachine kit with the proper polymerase
for synthesis.
292
4. Alternative, more detailed methods describing microinjection

of axolotl embryos can be found elsewhere [18].
5. We find that the probability of successful mating is increased if
the lights of the room are turned off 1 or 2 h in advance of the
normal dark cycle. If females can be easily discerned from one
another (e.g., different pigmentation pattern), we find that
one male can simultaneously be used for matings with two
females without reduction of success.
6. Spermatophores appear as white, jellylike clouds in the tank,
either stuck to rocks or floating in the water. While deposition
of multiple larger spermatophores is most favorable, we have
seen successful matings with very trace evidence of spermatophore deposition. We find that the sperm loses motility within
a couple of hours after deposition and there is no need to leave
the female in the water for an extended period of time. The
female typically will not begin to lay eggs until the evening or
following morning. If a female lays at an inconvenient time,
the rate of laying can be slowed by keeping the female at 12 C
overnight.
7. While storing freshly laid eggs at 48 C delays the first cleavage, we do not recommend storing eggs at this temperature for
more than 2 h as this can lead to chromosomal abnormalities
and reduced viability [19].
8. Ficoll 400 is an expensive reagent but, in our experience, is the
best substance to prevent leakage of yolk from injected
embryos. Ficoll use can be minimized by preparing injection
ramps deep enough so that the eggs can be completely submerged in Ficoll without entirely covering the surface of the
petri dish.
9. These are recommended starting concentrations of sgRNA
and cas9. If subsequent genotyping suggests low mutagenesis
frequency, increase the concentration or volume of injected
sgRNA while maintaining a fixed amount of cas9 [20].
10. A droplet of this diameter has a volume of 34 nL. The diameter of such a droplet is about 1/5th the radius of an axolotl
egg. If a pulse duration less than 100 ms produces a droplet of
this size, consider using a new needle with a finer tip. The ideal
needle must be rigid enough to enter the eggs without breaking, and small enough to not cause excessive yolk leakage.
11. Prolonged storage (more than several hours) in Ficoll and 1
MMR is harmful to the embryos.
12. The viability of different clutches of embryos and larvae varies
greatly after embryonic manipulation, with high rates of abnormalities in some clutches, and almost no abnormalities in
others. Furthermore, the viability of embryos produced at the
beginning of a spawning can differ from those produced at the end.
293
Thus, low viability after a single injection is not necessarily an

indicator of inherent toxicity of the cas9-sgRNA mixture.
13. Our observations of the localization of fluorescent signal after
coinjection of EGFP mRNA with cas9 and sgRNAs suggest
that the uniformity of the distribution of injected RNAs is
highly variable. While some sets of injections produce a high
percentage of animals with uniform distributions of EGFP,
other injections performed under very similar conditions produce a high percentage of animals with unilateral or punctate
EGFP expression. This variability in mRNA distribution likely
explains much of the variability in mutagenesis frequency after
injection, and selecting for uniformly injected animals in the
manner suggested can greatly reduce the labor required for
subsequent genotyping.
14. While there are numerous methods to detect mutation frequency, the axolotl genome possesses particular challenges that
make many methods used in other organisms less practical
than the fragment analysis method described here. Such methods require amplification of large (>300 bp products) which
most often requires obtaining additional sequencing information than currently publically available. Cloning and sequencing PCR products can provide a rough assessment of mutation
frequency, but this is cost-prohibitive and too labor intensive
to do on a large scale. The fragment analysis of fluorescent
PCR products described here provides an affordable means to
screen large numbers of embryos using smaller amplicon sizes.
15. Due to the axolotls large genome size, genomic PCRs from
uninjected embryos often produce unintended products. Even
products of proper size should be confirmed by gel extraction,
TA cloning, and sequencing of several clones. If such PCRs are
found to produce unintended products, the most expedient
way to eliminate such amplifications is to carry out a second
round of amplification of the primary PCR product using
nested, internal primers.
16. If the primary PCR produces a single discrete band of the
appropriate size from genomic DNA, one may obtain a 6-FAM
modified form of one of the primers used for this PCR and skip
genotyping steps 7 through 10. The process described here
utilizes a universal 6-FAM labeled primer for the purpose of
cost reduction. This method is explained in greater detail elsewhere [21].
17. These conditions only provide a loose framework, and PCR
conditions should be individually optimized. A fast, high fidelity polymerase may be substituted for Taq polymerase.
18. Do not proceed with genotyping if there is any evidence of
PCR contamination, as any contamination makes subsequent
mutation frequency determination impossible.
294
19. Note that the ratio of the concentration of the nested, m13tailed primer to the reverse gene specific primer is 1:1,000.
Higher concentrations of the nested, m13-tailed primer can
result in failure of production of sufficient quantities of 6-FAMlabeled product for analysis.
20. Numerous academic research facilities provide fragment analysis for a low cost compared to standard sequencing methods.
These include the DNA Analysis Facility at Yale University
(http://dna-analysis.research.yale.edu).
21. While this method provides a rapid and inexpensive assessment
of successful mutagenesis, definitive confirmation of mutagenesis can only be achieved through cloning and sequencing of
individual PCR products.
22. Several considerations should be made in the development of
mutant lines. As RGNs may have sequence-specific off-target
effects, crossing animals that have been mutagenized using
the same sgRNA may result in illusory, off-target genotype
phenotype associations. When possible, several distinct sgRNAs
should be used to produce mutants for each gene of interest.
References
1. Malacinski GM (1989) Developmental
Genetics. In: Malacinski GM, Armstrong JB
(eds) Dev. Biol. Axolotl. Oxford University
Press, New York, NY, pp 103109
amphibian model for regeneration, development,
and evolution studies. Cold Spring Harb Protoc
2009:pdb.emo128. doi:10.1101/pdb.emo128
3. Monaghan JR, Athippozhy A, Seifert AW,
Putta S, Stromberg AJ, Maden M, Gardiner
DM, Voss SR (2012) Gene expression patterns
specific to the regenerating limb of the Mexican
axolotl. Biol Open 1:937948. doi:10.1242/
bio.20121594
4. Campbell LJ, Surez-Castillo EC, OrtizZuazaga H, Knapp D, Tanaka EM, Crews CM
(2011) Gene expression profile of the regeneration epithelium during axolotl limb regeneration. Dev Dyn 240:18261840
5. Knapp D, Schulz H, Rascon CA, Volkmer M,
Scholz J, Nacu E, Le M, Novozhilov S, Tazaki
A, Protze S, Jacob T, Hubner N, Habermann
B, Tanaka EM (2013) Comparative transcriptional profiling of the axolotl limb identifies a
tripartite regeneration-specific gene program.
pone.0061352
6. Holman EC, Campbell LJ, Hines J, Crews CM
(2012) Microarray analysis of microRNA
7.
8.
9.
10.
11.
expression during axolotl limb regeneration.

pone.0041804
Stewart R, Rascn CA, Tian S, Nie J, Barry C,
Chu L-F, Ardalani H, Wagner RJ, Probasco
Dewey CN (2013) Comparative RNA-seq
analysis in the unsequenced axolotl: the oncogene burst highlights early gene expression in
the blastema. PLoS Comput Biol 9:e1002936.
Wu C-H, Tsai M-H, Ho C-C, Chen C-Y, Lee
H-S (2013) De novo transcriptome sequencing of axolotl blastema for identification of differentially expressed genes during limb
regeneration. BMC Genomics 14:434.
doi:10.1186/1471-2164-14-434
Monaghan JR, Epp LG, Putta S, Page RB,
Walker JA, Beachy CK, Zhu W, Pao GM,
Verma IM, Hunter T, Bryant SV, Gardiner
DM, Harkins TT, Voss SR (2009) Microarray
and cDNA sequence analysis of transcription
during nerve-dependent limb regeneration.
BMC Biol 7:1. doi:10.1186/1741-7007-7-1
Porteus MH, Carroll D (2005) Gene targeting
using zinc finger nucleases. Nat Biotechnol
23:967973
Wood AJ, Lo T-W, Zeitler B, Pickle CS, Ralston
EJ, Lee AH, Amora R, Miller JC, Leung E,
12.
13.
14.
15.
16.
Meng X, Zhang L, Rebar EJ, Gregory PD,

Urnov FD, Meyer BJ (2011) Targeted genome
editing across species using ZFNs and TALENs.
Science 333:307
Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai
SQ, Sander JD, Peterson RT, Yeh J-RJ, Joung
JK (2013) Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol
31:227229
Flowers GP, Timberlake AT, McLean KC,
Monaghan JR, Crews CM (2014) Highly efficient targeted mutagenesis in axolotl using
Cas9 RNA-guided nuclease. Development
141:21652171
Smith JJ, Putta S, Walker JA, Kump DK, Samuels
AK, Monaghan JR, Weisrock DW, Staben C,
Voss SR (2005) Sal-Site: Integrating new and
existing ambystomatid salamander research and
informational resources. BMC Genomics 6:181.
doi:10.1186/1471-2164-6-181
Fu Y, Sander JD, Reyon D, Cascio VM, Joung
JK (2014) Improving CRISPR-Cas nuclease
specificity using truncated guide RNAs. Nat
Biotechnol 32:279284
Hwang WY, Fu Y, Reyon D, Maeder ML,
Kaini P, Sander JD, Joung JK, Peterson RT,
Yeh J-RJ (2013) Heritable and precise
zebrafish genome editing using a CRISPR-Cas
17.
18.
19.
20.
21.
295
system. PLoS One 8:e68708. doi:10.1371/

journal.pone.0068708
Smith JJ, Putta S, Zhu W, Pao GM, Verma IM,
Hunter T, Bryant SV, Gardiner DM, Harkins
TT, Voss SR (2009) Genic regions of a large
salamander genome contain long introns and
novel genes. BMC Genomics 10:19.
doi:10.1186/1471-2164-10-19
metamorphosis, transgenesis and tamoxifenmediated recombination. Nat Protoc 9:
529540
Humphrey RR, Fankhauser G (1957) The
origin of spontaneous and experimental haploids in the Mexican axolotl (Siredonor
AmbystomaMexicanum). J Exp Zool 134:
427447
Guo X, Zhang T, Hu Z, Zhang Y, Shi Z, Wang
Q, Cui Y, Wang F, Zhao H, Chen Y (2014)
Efficient RNA/Cas9-mediated genome editing in Xenopus tropicalis. Development 141:
707714
Schuelke M (2000) An economic method for
the fluorescent labeling of PCR fragments. Nat
Biotechnol 18:233234
Chapter 23
Gene Manipulation for Regenerative Studies Using
the Iberian Ribbed Newt, Pleurodeles waltl
Abstract
Newts provide a unique model animal for regenerative studies. An experimental model system for molecular
genetics in newts is needed in order to clarify the mechanisms of regeneration from the perspective of gene
functions. We have identified that Iberian ribbed newt (Pleurodeles waltl) is a suitable model animal for such
studies. Here we describe protocols for gene manipulation using Pleurodeles waltl.
Key words Newt, Salamander, Molecular genetics, Regeneration, Transgenesis, TALENs, Genome
editing
Introduction
Regeneration of a lost tissue in an animal is an important issue.
Urodele amphibians, such as newts have the remarkable capability
to regenerate organs, and various body parts, such as limbs, ocular
tissues, brain, spinal cord, intestine, and these animals have been
used for regeneration studies for centuries [1, 2]. However, the
identities of the genes that regulate regeneration are still unclear.
To elucidate gene function during newt regeneration, it is particularly important to establish transgenic and knockout lines, and
systematically cross these lines to study the functions of genes. For
this purpose, we chose the Iberian ribbed newt (Pleurodeles waltl)
as a model animal. Previously we have shown that P. waltl can
spawn fertilized eggs all year around in the laboratory [3]. Each
female can lay more than 150 eggs per spawning and they spawn
every 24 weeks (Table 1). In this chapter we describe methods for
artificial insemination, I-SceI mediated transgenesis, and genome
editing using P. waltl.
297
298
Table 1
Comparison of the breeding properties of P. waltl is comparable
to X. tropicalis
P. waltl
X. tropicalis
6 months ~
5 months ~
9 months ~
6 months ~
12 cm ~
44.5 cm
14 cm ~
56 cm
Egg size
1.21.5 mm
0.70.8 mm
Eggs per spawning
150600
(5,000~/year)
1,0009,000
Maturation
Adult size
Modified from Hayashi et al. 2013
2
2.1
Materials
Reagents
1. 10 Holtfreters solution (HF): Dissolve 35 g NaCl (600 mM),

0.5 g KCl (7 mM), and 2 g NaHCO3 (24 mM) in 1 L of distilled water (see Note 1).
2. 1 HF solution: Add 100 mL 10 HF solution to 900 mL
distilled water. Sterilize by autoclaving and allow it to cool at
room temperature. Add 5 mL of 1 M HEPES (5 mM), 1.7 mL
of 1 M CaCl2 (1.7 mM), and 1.7 mL 1 M MgSO4 solution
(1.7 mM) to this solution. Store at room temperature
(see Note 2).
3. 0.25 HF solution: Add 25 mL 10 HF solution to 900 mL
distilled water and sterilize by autoclaving. Allow the solution
to cool at room temperature and add 5 mL of 1 M HEPES,
1.7 mL of 1 M CaCl2, 1.7 mL 1 M MgSO4, and 5 mL of
(50 mg/mL) gentamicin sulfate. Make up the solution to 1 L
and store at 4 C (see Note 2).
4. 0.1 % MS222 (for anesthesia): Add 0.4 g to 400 mL 0.25 HF
solution (see Note 3).
5. Human chorionic gonadotropin (hCG): Dissolve 1,000 units
in 1 mL 1 HF solution (see Note 4).
6. Injection medium: Dissolve 4 g of Ficoll in 100 mL 0.25 HF
solution containing gentamicin (see Note 5).
7. De-jellying solution (2 % Cysteine solution or 2 % Sodium
thioglycolate): Dissolve 1 g of cysteine or sodium thioglycolate
in 50 m L 25 HF solution, adjust to pH 7.6 (pH 7.9 for
sodium thioglycolate) with 5 N NaOH (see Note 3).
8. PCR reagents and primers for genotyping (optional).
Gene Manipulation for Regenerative Studies Using the Iberian Ribbed Newt
2.2 Vectors/
Plasmids
299
1. Expression vectors for transgenesis: use I-SceI site-containing

vector (see Note 6).
2. Plasmids cording TALENs, which recognize the target gene
(see Note 7).
2.3
Equipment
1. Microinjector (see Note 8).

2. Micromanipulator (see Note 9).
3. Stereomicroscope with flexible lighting (in common with frog
and newt).
4. Low-temperature incubator (temperature range; 816 C).
5. Puller and glass capillaries (for making micro needles)
(see Note 10).
6. Injection dish (Nunc mini tray, 60 wells) (see Note 11).
7. Transfer pipettes/3 mL soft plastic pipettes (see Note 12).
8. l mL disposable syringes. 27-gauge needles.
Methods
3.1 Maintenance
of a Newt Colony
1. Housing: Iberian ribbed newts (Pleurodeles waltl) should be

kept in a tap-water aquarium at 2526 C under natural light
cycles (see Note 13).
2. Feeding: Animals should be fed at least five times per week
with hatched brine shrimp for larvae and compound feeds for
juvenile/adult newts (see Note 14).
3.2 Artificial
Insemination
1. For egg collection, inject 1418 h prior to egg collection,

inject 100200 units hCG subcutaneously into the lower jaw
of mature females using 1 mL syringe and 27-gauge needle.
2. The next day, when the female starts laying eggs, transfer her
into 0.1 % MS-222.
3. When the animal is anesthetized, wipe the animal lightly to
remove water drops.
4. Push the abdomens gently and collect the eggs in a dry petri
dish (Fig. 1a) (see Note 15).
5. For sperm collection, anesthetize sexually mature males (older
than 6 months post fertilization) with 0.1 % MS222. When the
animal is anesthetized, wipe the animal lightly to remove water
drops.
6. Squeeze out the sperm by pressing the abdomen of mature
males (Fig. 1b) and place it into 1 HF solution to 2,000
5,000 sperm/L (see Notes 16 and 17). The sperm suspensions can be stored for up to 8 h at room temperature.
300
Fig. 1 Egg (a) and sperm (b) collection for the artificial insemination. (c and d) De-jellied fertilized eggs.
(c) Good quality eggs with (left )/ without (right ) an eggshell. Arrows indicate white spots on the animal pole.
(d) Examples of low quality eggs. Arrows indicate leak of cytoplasm
7. Mix eggs with diluted sperm (approximately 520 L per 20

eggs) gently using pipette tips.
8. Incubate inseminated eggs at room temperature for 15 min
(see Note 18).
9. Pour 0.25 HF solution into the dish and incubate eggs for a
further 15 min to allow water absorption by the jelly.
10. Soak the fertilized eggs (single-cell stage embryos) in de-jelly
solution for 5 min with gentle shaking (see Note 19).
11. Rinse de-jellied eggs 35 times in 25 % HF solution.
12. Sort good eggs (Fig. 1c, d) under the stereomicroscope and
discard low quality eggs (see Note 20).
13. Transfer the eggs into an injection tray filled with injection
medium (see Note 21).
14. Remove eggshells using fine forceps and store at 8 C until the
microinjection (see Note 22).
3.3 Preparation
of Plasmid Vectors
1. Prepare the plasmid vectors using an ion exchange column

from E. coli culture (see Note 23).
2. Dissolve the plasmid in water (100200 ng/L) (see Note 4).
3. Linearize 200 ng of plasmid vectors with 25 units of I-SceI in
20 L total volume of 1 I-SceI buffer at 37 C for 40 min
(see Notes 24 and 25).
3.4 Preparation
of TALEN mRNAs
(See Note 26)
301
1. Linearize 210 g of plasmid vectors with appropriate

restriction enzymes.
2. Extract the plasmids by phenol/chloroform. Precipitate the
plasmids by ethanol precipitation, then dissolve in RNAse-free
water (500 ng/L).
3. Synthesize TALEN mRNAs by in vitro transcription using
RNA polymerase (see Note 27).
4. Purify the mRNAs by ethanol precipitation, and dissolved in
nuclease-free water (100500 ng/L). Stored at 80 C.
5. Just before use, dilute RNAs with RNAse-free water to
10400 ng/L (see Note 28).
3.5 Microinjection
(See Note 29)
1. Prepare micro needles (diameter of outer tip: 1020 m)

(see Note 30).
2. Set up the microinjector and micromanipulator (Fig. 2). Refer
to the operating instructions.
3. Load the I-SceI digested plasmid solution or TALEN mRNAs
into a micro needle.
4. Set the injection volume between 9 and 20 nL (see Note 31).
5. Support the egg with the forceps and prick the animal pole side
with the micro needle.
6. Push the Inject button and then pull out the needle.
7. Leave the injected eggs and move to the next one.
8. After injection of plasmid DNA, incubate the eggs (embryos)
at 810 C for 48 h to delay the first cleavage, and then keep
at 16 C overnight (see Note 32).
Fig. 2 Setting up the equipment for the microinjection
302
3.6 Sorting
the Embryos
and Rearing
1. Return the temperature to 2526 C (see Note 33).

2. Transfer the embryos into petri dishes or plastic cups
(see Note 21).
3. Rinse the embryos three times in 0.25 HF solution to remove
Ficoll (see Note 34).
4. Incubate the embryos in 0.25 HF solution for 57 days
(hatching-stage) and then transfer them into tap water. Start
feeding with brine shrimps after 1012 days of post
fertilization.
5. Sort intended transgenic or knockout animals by expression of
the reporter gene or genotyping (see Note 35).
6. Raise these animals to sexual maturation. Inter cross the
animals to establish the transgenic/knockout lines.
Notes
1. Sterilize by autoclaving and store at room temperature.
2. After autoclaving, add HEPES, CaCl2, MgSO4, and gentamicin sulfate.
3. Prepare this solution just before use.
4. Store at 20 C. It should be stable after several times of
freeze-thawing.
5. Sterilize by filtration using membrane filter and store in a clean
bottle at 4 C.
6. For efficient integration into the newt genome, sub-clone the
construct between 2 I-SceI recognition sites [4, 5]. The plasmid DNA should be prepared using an ion exchange column
(e.g., NucleoBond, TAKARA Bio or Plasmid Midi kit,
QIAGEN). Do not use silica membrane columns since they
cannot remove endotoxins. The digested plasmids should be
stored on ice and used as soon as possible.
7. Obtain or construct TALEN plasmids for your targeting genes.
Many laboratories and companies provide various types of
TALEN scaffolds. We recommend Platinum Gate TALENs
[6], as high activity had been confirmed in the new embryos
[7]. In order to synthesize the mRNAs by in vitro transcription, the plasmids must contain T7, T3, or SP6 RNA polymerase binding site.
8. We prefer to use a NANOJECT II microinjector (Drummond,
Broomall, PA). As this injector is driven not by compressed air
but by an electric motor, it is compact and easy to operate.
9. The injector head should be mounted in a suitable micromanipulator. Although MM33 would be suitable for NANOJECT
303
II, products from other companies can also be used (such as

M-152, NARISHIGE, Japan) with an attachment supplied
with the injector.
10. A puller is a device for pulling a glass capillary under heating to
make glass micro needles. Select appropriate type of capillary for
your microinjector according to manufacturers instruction.
11. As the de-chorionized eggs settle in the well at the bottom, it
helps to hold the egg during the injection.
12. For handling the eggs and embryos, cut the tip to adjust the
opening to egg size (35 mm diameter).
13. To increase the growth rate of the animals, the optimal temperature range is 2526 C. However, the animals can be
maintained in a healthy state at 1624 C. Brief filtering helps
to reduce the frequency of changing the water. Mature males
and females should be housed separately in order to avoid natural mating.
14. P. waltl newts eat compound feeds available for Xenopus, catfish, and trout. We prefer to use feeds for aquarium fishes
rather than for hatchery fishes. Aquarium feeds are less likely to
soil the water in the tank.
15. Pushing lightly. After squeezing the eggs, start the insemination immediately. You may collect the eggs 23 times from the
same animal at 23 h intervals.
16. By pushing lightly, urine is pressed out first. If you push too
strongly, the bladder will be crushed and the newt will die.
Sperm can be collected from the same animals every 24 weeks.
17. Mix the sperm suspension by gentle pipetting.
18. The lid of the petri dish should be shut to maintain humidity.
19. Keep 5 min or less, as de-jerry solution is toxic. And then rinse
well at the next step. The eggshells (Fig. 1c arrowheads) still
remained on the most eggs.
20. White spot on the animal pole is a sign for good eggs (arrows
in Fig. 1c). The animal pole side are clearly pigmented. There
is no leak of cytoplasm. On the other hand, it is difficult to see
the white spot on the low quality eggs. They also show leak of
cytoplasm (Fig. 1d, arrows).
21. Use the transfer pipet. De-jerried eggs and embryos are
fragile.
22. To obtain full transgenic or full knockout animals, it is important to perform the microinjection at single-cell stage. The fertilized eggs of P. waltl require 56 h for the first cleavage at
25 C. You can delay the timing of the first cleavage at 8 C;
however, a good result will be obtained if injection is performed as quickly as possible after fertilization.
304
23. The ion exchange columns are available as a kit (e.g.,

NucleoBond, TAKARA Bio or Plasmid Midi kit, QIAGEN).
Do not use silica membrane columns since they cannot remove
endotoxins.
24. Keep 40 min, and then transfer the tube on ice until use.
25. In most cases, we obtained a good result by injection of
100 pg/egg plasmid DNA. When you inject two vectors at the
same time, mix them (100 ng each, total 200 ng in 20 L
reaction).
26. Keep the working area and reagents RNAse-free.
27. As the 5 ends of RNAs must be caped, it is easy to use a kit for
caped-mRNA synthesize (e.g., mMESSAGE mMACHINE T7
Ultra Kit, Life Technologies).
28. Optimize the appropriate amounts of TALENs, because it
depends completely on their levels of activity. The mRNA
should be tested between total 12400 pg/egg. Use equal
amounts of the Right- and Left-TALENs.
29. This injection protocol is modified from I-SceI methods for
Xenopus [4]. You may also refer to [8, 9] that were developed
for urodeles.
30. Pull the glass capillaries using a Puller according to manufactures instruction. The micro needle tips should not be ground.
Prepared spear needles and stocked for future use.
31. We obtained a good result with injection volume in this range.
Refer to the operating instructions of your microinjector for
calibration of the injection volume.
32. To increase the ratio of the full transgenic animals, integration
of the transgene into the newt genome should be occur at single-cell stage. Therefore, it is important to delay cell cleavage
by keeping them at low temperature. After injection of TALEN
mRNAs, this stem is not required. 25 C is the optimal temperature for TALENs.
33. The embryos should be at morula stage. The criteria for the
developing stages were defined by Shi and Boucaut [10].
34. Ficoll prevents gastrulation. Rinse out completely.
35. For genotyping, collect the tail tips or limb tips under anesthesia. 0.01 % MS222 is suitable for the larvae.
Acknowledgments
We would like to thank Prof. Takashi Yamamoto and Dr. Tetsushi
Sakuma (Hiroshima University) for providing the TALENs.
We also thank Profs. Andras Simon and Anoop Kumar for their
305
valuable help and advice. Kyorin Corporation (Hyogo, Japan)

kindly provided the feed for the newts. This research was supported by MEXT/JSPS KAKENHI (grant numbers, 26650082,
25124706, and 25840086).
References
1. Brockes JP, Kumar A (2002) Plasticity and
reprogramming of differentiated cells in
amphibian regeneration. Nat Rev Mol Cell
Biol 3:566574
2. Agata K, Inoue T (2012) Survey of the differences between regenerative and nonregenerative animals. Dev Growth Differ 54:
143152
3. Hayashi T, Yokotani N, Tane S, Matsumoto A,
Myouga A, Okamoto M, Takeuchi T (2013)
Molecular genetic system for regenerative
studies using newts. Dev Growth Differ 55:
229236
4. Ogino H, McConnell WB, Grainger RM
(2006) High-throughput transgenesis in
Xenopus using I-SceI meganuclease. Nat
Protoc 1:17031710
5. Pan FC, Chen Y, Loeber J, Henningfeld K,
Pieler T (2006) I-SceI meganuclease-mediated
transgenesis in Xenopus. Dev Dyn 235:
247252
6. Sakuma T, Ochiai H, Kaneko T, Mashimo T,
Tokumasu D, Sakane Y, Suzuki K, Miyamoto
T, Sakamoto N, Matsuura S, Yamamoto T
7.
8.
9.
10.
(2013) Repeating pattern of non-RVD variations in DNA-binding modules enhances

TALEN activity. Sci Rep 3:3379
Hayashi T, Sakamoto K, Sakuma T, Inoue T,
Kawaguchi E, Agata K, Yamamoto T, Takeuchi
T (2014) Molecular genetic system for regenerative studies using newts. Dev Growth Differ
56:115121
Casco-Robles MM, Yamada S, Miura T,
Nakamura K, Haynes T, Maki N, Del RioTsonis K, Tsonis PA, Chiba C (2011)
Expressing exogenous genes in newts by transgenesis. Nat Protoc 6:600608
(Ambystoma
mexicanum)
husbandry,
breeding, metamorphosis, transgenesis and
tamoxifen-mediated recombination. Nat
Protoc 9:529540
Shi DL, Boucaut JC (1995) The chronological
development of the urodele amphibian
Pleurodeles waltl (Michah). Int J Dev Biol
39:427441
Part V
Gene Expression
Chapter 24
Transcriptomics Using Axolotls
S. Randal Voss, Antony Athippozhy, and M. Ryan Woodcock
Abstract
Microarray and RNA-sequencing technology now exists for the characterization of the Ambystoma mexicanum
transcriptome. With sufficient replication, these tools give the opportunity to truly investigate gene expression in a variety of experimental paradigms. Analysis of data from the Amby002 array and RNA-sequencing
technology can identify genes that change expression levels in concert with each other, which in turn may
reveal mechanisms associated with biological processes and molecular functions.
Key words Microarray, RNA sequencing, Transcriptomics, Statistics, RNA
Introduction
Transcription is a fundamental molecular process that is common to
all organisms. During transcription, an RNA molecule is synthesized from a template DNA sequence (gene). The synthesis of RNA
molecules differs in time, type, and amount across cells. The RNAs
that derive from transcription directly or indirectly orchestrate
development and maintain cellular structures and functions.
At higher levels of biological organization, RNAs regulate physiology
and behavior. Thus, the analysis of transcription is relevant to all life
scientists, and it can be studied in any organism using common
molecular methods, analytical techniques, and instrumentation.
In model genetic organisms, transcription methodologies are
routinely used to explore the functions of genes and phenotypes,
to monitor experiments, and to classify and define biological processes. Such applications will expand as costs decline, and new
approaches are developed to allow greater flexibility of experimental design and greater accuracy of RNA measurement.
In reality, transcription studies are in their infancy, and relatively
few temporal and spatial analyses of gene expression have been
accomplished in model organisms. At the same time, it is now
possible with next-generation nucleotide sequencing technology
to obtain the complete genome or transcriptome of any organism.
309
310
S. Randal Voss et al.
With such information, the same gene expression techniques

that are used in genetic models can be applied to any organism.
It therefore seems likely that the next 10 years will see a renaissance of the comparative experimental approach that dominated
biological research in the twentieth century. A focus of this
approach will be gene expression.
Therefore, it is critical that researchers have access to equipment and methods that can enable gene expression studies. Here,
we present methods for applying Affymetrix microarray and
RNA-sequencing approaches for the Mexican axolotl (Ambystoma
mexicanum). The axolotl has been the subject of genome resource
development for over a decade. In 2005, a first generation
Affymetrix GeneChip with relatively few probesets (~5,000) was
developed and used to profile gene expression during thyroid
hormone-induced metamorphosis and spinal cord regeneration [1].
In 2012, a higher content (~20,000 probesets) second-generation
Affymetrix GeneChip (Amby_002) was made available to the
community [2]. The Amby_002 GeneChip has been used to
quantify mRNAs sampled from several regenerating tissues,
including brain, iris, dorsal root ganglia, and limb. Notably, a
recent study yielded a very detailed readout of the first 28 days of
limb regeneration, and these data can be accessed from a gene
expression database at Sal-Site (www.ambystoma.org) (Fig. 1).
Several groups have also begun to use RNA sequencing to
estimate gene expression in the axolotl [3, 4]. Unfortunately, all
studies to date have not replicated samples, and thus the reliability
of the expression estimates is unclear. We recently completed a
study that sequenced biological replicates that were technically
replicated using Amby_002. We describe here methods for obtaining
RNA-sequencing estimates from replicate samples and how also
to compare these estimates to annotated probesets from Amby_002.
Materials
2.1
Animals
2.2
RNA Extraction
Genetically homogeneous axolotls are available from the

Ambystoma Genetic Stock Center, University of Kentucky.
1. Homogenization equipment: Pestles and 1.5 mL nuclease-free
microtubes or 1 mL syringes and 1826-G needles.
2. Triazol (Life Technologies, #15596018).
3. RNeasy Mini Kit (QIAGEN, Cat no. 74104) with RNase-free
DNase Set (QIAGEN, Cat no. 79254).
4. Nanodrop ND-1000 or 2100 Bioanalyzer (Agilent Technologies).
2.3 Affymetrix
Microarray Analysis
1. GeneChips are available from Affymetrix (Part No. 520748).

2. GeneChips are processed and normalized estimates of gene
expression are provided by the University of Kentucky
Microarray Core Facility.
311
Fig. 1 (a) Query tool within Sal-Site used to search for microarray data for an individual probeset. Probesets
may be queried by Affymetrix probeset ID or gene name. (b) Display of expression profile of a sample probeset.
Data are transformed so that measurements approximate a normal distribution and thus can be analyzed by
parametric analysis. Log2 intensity values from the microarray are plotted as a function of time for probeset
axo05645, which has been annotated as matrix metalloproteinase 2
2.4 RNA-Sequencing
Analysis
Total RNA samples are submitted to a genome sequencing center

for Illumina paired-end sequencing.
312
2.5 Software
for Microarray
and RNA-Sequencing
Analysis
1. Affymetrix Expression Console (Affymetrix, Santa Clara, CA).

2. JMP Genomics (SAS, Cary, NC) [5] or R statistical software [6].
3. Microsoft Excel or JMP Genomics spreadsheet management
software.
4. Access to the Trinity server for processing and analyzing data.
5. MySQL database management software (Oracle Corporation) [7].
Methods
3.1 Microarray
Sample Preparation
1. Animals: Careful attention should be paid to the size and age

of axolotls used in experiments. Genetically homogeneous
axolotls of the same approximate age and size should be used
to reduce interindividual variation. This is especially important
when tissues are collected over an extended period of time as
small variations in temperature and food provisioning can alter
developmental schedules.
2. Tissue collection: All instruments should be sterile and free of
RNase. RNase AWAY (Sigma Aldritch, St. Louis MO) can be
used to remove RNase, but instruments should be dry before use.
Place the microtube immediately in liquid nitrogen. The samples can be stored at 80 C until ready for RNA extraction.
3. RNA extraction: RNA extraction should be done in groups of
515 samples because processing more samples lengthens tissue
preparation and may result in excessive RNA degradation.
Since the time of extraction is potentially a source of variability,
one should plan to extract in groups made up of one sample
from each temporal timepoint. A similar approach should be
followed for microarray preparation.
4. Preparation of tissue homogenate: Add 500 L Triazol to each
tube containing tissue. Using a sterile, nuclease-free pestle, tissue is ground into small pieces, and then syringes are used to
homogenize tissues. Once tissue flows easily through the 18-G
needle, eject full volume from syringe. Replace the 18-G needle with a 22-G needle. Aspirate and eject until tissue is easily
taken up. Repeat with 26-G needle if necessary. Continue
homogenizing until there are no visible pieces of tissue floating
in Triazol. Homogenization can be lengthy, so to help prevent
RNA degradation, tubes should be kept on ice.
5. Pellet nonhomogenized tissue: Spin tubes at 9,280 g for 10 min
at 4 C. Check tubes for tissue pellets. Thoroughly homogenized tissue should not produce pellets as a result of this centrifugation. Move supernatant to a new labeled tube if a pellet
is present.
6. Add 100 L chloroform per 500 L Triazol to each tube.
Some Triazol may have been lost during tissue homogeniza-
313
tion. If the volume is less than 500 L, fresh Triazol can be

added to reach 500 L. Invert and flick tube 20 times or until
solution is a consistent light-pink color. Incubate at room temperature for 10 min.
7. Centrifuge at 15,680 g for 10 min at 4 C.
8. Transfer the aqueous phase (top layer) to a new labeled 1.5 mL
tube. Do not disturb the white precipitate at the immiscible layer.
3.2 Purification
of RNA Using
the QIAGEN RNeasy
Mini Kit
1. Add 700 L of RLT buffer and 500 L of 200 proof ethanol

to the tubes containing supernatant. Mix by pipetting.
2. Label RNeasy spin columns. Transfer 700 L of sample to
RNeasy spin column placed in a 2 mL collection tube.
3. Centrifuge at 9,280 g for 15 s. Discard the flow-through in
the collection tube, and then add remaining sample to the spin
column.
4. Centrifuge again at 9,280 g for 15 s and discard the
flow-through.
5. Wash each column with 350 L of RW1 wash buffer. The spin
column can be turned on its side and rotated to wash sides
of column.
6. Centrifuge at 9,280 g for 15 s. Discard the flow-through.
7. Aliquot 80 L of DNase and RDD buffer mix to each column.
Incubate at room temperature for 15 min.
8. Prepare the DNase and RDD buffer as a master mix containing
11 L DNase and 77 L RDD buffer per sample.
9. Centrifuge at 9,280 g for 15 s. Discard the flow-through.
10. Add 500 L of RPE to each spin column. Discard flow-through.
11. Place the column in a new collection tube. Add 500 L of RPE
to each spin column. Centrifuge for 2 min to remove excess RPE.
Discard flow-through. Label new, nuclease-free 1.5 mL tubes.
12. Transfer column to 1.5 mL tube. Add 30 L of RNase-free
water to the center of the column. Incubate for 1 min at room
temperature, and then spin for 1.5 min at 9,280 g. Discard
the column.
13. Use 1.5 L aliquot of the eluted RNA sample for spectrophotometric analysis by a Nanodrop spectrophotometer. The
ratios A260/A280 and A260/A230 should be higher than
1.8. Lower A260/A230 ratios may indicate incomplete RLT
removal but should not affect RNA integrity or microarray
analysis.
14. To evaluate RNA integrity, an Agilent 2100 Bioanalyzer may
be used. The RNA integrity number (RIN) should ideally be
greater than 8.
314
15. The standard procedure for the Affymetrix 3 IVT Express kit
is used for microarray analysis. A minimum of 50 ng total RNA
is needed per GeneChip.
3.3 Basic Statistical
Analysis
1. Upon finishing the microarray assays, data are made available

in the form of .CEL files. These files contain intensity values
for the analyzed probes sorted by an X/Y coordinate system.
Intensity values are on a scale that ranges from 0 to several
thousands. A CLF file and a CDF file are then used to map the
location of the intensity measures to specific probes and probesets. More information about Affymetrix file formats can be
found at (http://media.affymetrix.com/support/developer/
powertools/changelog/FILE-FORMATS.html). Microarrays
can be analyzed and processed according to standard Affymetrix
procedures. Affymetrix software is utilized for generating and
extracting data from Affymetrix CEL files, such as Affymetrix
GeneChip Command Console and Affymetrix Expression
Console. The necessary Affymetrix library files are available
through www.ambystoma.org. We have found that using the
RMA algorithm [8] for data preparation works well. The RMA
algorithm consists of three steps. First, microarrays are quantile
normalized, which fixes the distribution of measurements so
that measurements are comparable across all arrays. Second,
the samples are summarized by means of Tukeys median
polish [9] so that all probes associated with the same probeset
are combined into a single expression measure. Finally, data are
transformed so that measurements can approximate a normal
distribution, and the data can be analyzed by means of parametric analysis.
2. Once the raw hybridization data has been extracted into a text
file, any software capable of handling spreadsheets, such as
Microsoft Excel or JMP Genomics can be used for further
analyses. Alternatively, the researcher can program tools in languages such as R if finer control over methodology is desired.
3. To increase statistical power, researchers may wish to remove
gene expression estimates that are low across all samples, as
such detected changes in gene expression are likely to be biologically insignificant. Although the Ambystoma GeneChip
does not have mismatch probes present, researchers can determine presence/absence calls based on the magnitude of expression estimates. A histogram can be generated to view the
distribution of expression profiles to identify a value where
estimates below that value are unlikely to be expressed (Fig. 2).
One commonly used method is to remove all probesets that
express values below a given quartile [1012].
4. Statistical treatment of the data remains at the discretion of the
researcher and is fully dependent on experimental design.
315
Fig. 2 Representative frequency distribution of Log2 transformed intensity values for a single Affymetrix
GeneChip generated in JMP Genomics version 5.0. The bottom quartile is identified at 4.12. The distribution
can be used to define unexpressed and poorly expressed probesets
Typically, in studies with high replication, parametric analyses

such as ANOVA work well and provide statistical power. These
tests can be done in a JMP Genomics workflow or by means of
manually defining the formulas in Excel or in R. To determine
the magnitude of an effect, fold changes should be calculated
remembering that values extracted from the RMA algorithm
are log 2 transformed. Thus, a difference of 1 equates to a
twofold change in signal intensity.
5. A number of multiple testing procedures are available for analyzing microarray data sets, although the false discovery rate
(FDR) [13] is the most commonly used. These calculations
can be automated in JMP Genomics or R or calculated by formulas in Microsoft Excel. An FDR of 0.05 is often used to
determine statistical significance, but in practice this value can
often be overly stringent.
6. Upon retrieving a list of differentially expressed genes based on
defined statistical criteria (such as p-values from ANOVAs and
fold changes), a variety of tools exists to explore the relationships
between gene expression profiles. Gene lists can be uploaded
into gene ontology analysis software such as DAVID [14]
to identify ontologies and pathways that are overrepresented.
In turn, the groupings of genes identified by overrepresentation
analysis can then be used to generate new hypotheses regarding the previous experiment. In addition, Pearsons correlation
can be used to group genes with similar expression profiles.
Average linkage clustering using Pearsons correlation as a distance metric has been a commonly applied tool in microarray
data analysis [15], and branches on the resulting dendrogram
can be used to identify groups of genes with highly similar
expression profiles.
316
3.4 RNA Sequencing

of the Mexican Axolotl
3.4.1 Use of the Trinity
Platform for Processing
and Analyzing Data
Assembly
Given the current unfinished state of the Ambystoma mexicanum

genome, many alignment tools are not yet usable. In such cases
where a reference genome is unavailable, transcriptomics necessitates generation of a de novo transcriptome, where a set of highquality sequences can be assembled without the aid of mapping to
an existing reference genome. The authors of Trinity have recently
published a workflow [16] that is directly applicable to RNAsequencing experiments without a reference genome. The method
involves de novo transcriptome assembly, wherein reads are aligned
and merged in order to reconstruct original sequences. Notably,
this de novo transcriptome production accounts for the presence
of structural variations among transcripts, such as those that originate from alternative splicing (isoforms), and also resolves recently
duplicated (paralogous) genes. In its initial step, Trinity assembles
reads into contigs recovering only a single (best) representative for
a set of alternative variants that share a sequence of a fixed length
of k nucleotides (k-mer, with k considerably shorter than the
read length) due to alternative splicing, gene duplication, or allelic
variation. Often the full-length transcripts recovered represent the
dominant isoform. Thereafter, Trinity groups related contigs into
clusters and constructs a de Bruijn graph for each cluster with each
graph reflecting the complexity of overlap between variant contigs.
Lastly, Trinity processes each clusters individual graph in parallel
and reports full-length transcripts for all plausible transcript
sequences. Ultimately, the researcher recovers a sizeable set of
components (putative genes) and their associated transcript forms.
The Trinity platform will accommodate RNA-sequencing data
in the form of either single or paired-end reads. In our most recent
studies, we have utilized Illumina paired-end sequencing data for
gene expression analyses given that paired-end sequencing increases
the depth of sequencing, improves de novo assembly efficiency,
and offers the advantages for gene discovery and characterization
of novel splice isoforms [17]. Additionally, Trinity de novo
sequence assembly may be supplemented with a long read set such
as an A. mexicanum transcriptome of deep sequenced contigs
(V4.0 currently available through Sal-Site). Separate sequencing
runs may not be directly comparable prior to normalization. For
example, one run may have more total reads than another, meaning that a higher number of counts for a given transcript could be
associated with the increased total number of reads instead of a
relative increase in the presence of that particular transcript [18,
19]. Additionally, correction may be necessary to accommodate
for analytical and methodological biases due to transcript length
variation [20, 21]. Therefore, prior to sequence assembly, paired
reads may be processed through the Trinity in silico normalization
algorithm according to user-defined settings for k-mer size (25
default).
317
3.4.2 Transcript
Expression Analysis Using
RSEM/EBSeq
Transcript and isoform abundance estimation (expression values)

for a de novo transcriptome may be computed using RSEM software (version 1.2.9) [22]. Typically, a run of RSEM is a two-step
process. Initially, a set of reference transcript sequences are generated and preprocessed for secondary use in the RSEM workflow.
Thereafter, a set of RNA-sequencing reads are aligned to the reference transcripts, and the resulting alignments are used to estimate
abundances and their credibility intervals. Notably, RSEM software is most suitable for de novo transcriptome expression analysis
as RSEM does not require a reference genome for transcript mapping; rather, a de novo transcriptome may be used as its own set of
reference transcripts. However, RSEM requires that all alignments
of the same read group be grouped together, and in the case of
paired-end reads, the two mates of any alignment must be input
adjacently. Each RSEM result file recovers an expression value for
both transcripts per million (TPM) and fragments per kilobase of
exon per million fragments mapped (FPKM). Both of these are
normalized values that attempt to correct for total number of
reads, but TPM is preferred [22].
Differential expression analyses across two or more biological
conditions in an RNA-sequencing experiment may be conducted
using EBSeq, which is packaged within RSEM [23]. In practice,
EBSeq identifies statistically significant expression changes of genes
and isoforms by assigning each identified transcript a pattern
and a posterior probability. In addition, as part of the EBSeq
analysis, expected counts from the RSEM output are median normalized [23].
3.4.3 Sequence
Annotation Aided by
Nucleotide BLAST
It is not straightforward to annotate transcripts from RNAsequencing data because transcripts/isoforms and genes may not
show a 1:1 relationship. To principally address this complexity in
the absence of a sequenced genome, we suggest selecting a representative reference transcript for each component (gene). Reference
transcripts may be identified from either the isoform of greatest
length or from the isoform with highest average expression values
(TPM or FPKM) across all experimental conditions. In practice,
RSEM expression values from the transcriptome assembly may be
imported into a database (such as MySQL) and then queried to
determine the average isoform values across all experimental
conditions.
Reference transcriptome annotation may be facilitated by
means of nucleotide BLAST [24], where the reference transcriptome is queried against a BLAST database of known annotation
(such as sequences corresponding to genes on the Ambystoma
microarray probeset). Annotation can be easily assigned for BLAST
results with perfect 1:1 query-target relationships. However, deviations from this later pattern with redundant query hits may require
manual curation and sorting to determine the best BLAST match.
318
The most likely annotation can be determined where target

matches have relatively long alignments with high percent identity.
RNA-sequence annotation enables interface and cross-comparison
to data from different experimental platforms (e.g., microarrays).
3.5 Downstream
Analyses of Gene Lists
3.5.1 Overrepresentation
Analysis of Ontologies
3.5.2 Clustering Analysis

of RNA-Sequencing Data
Once gene lists have been generated from statistical analysis of normalized data (e.g., using EBSeq), overrepresentation analysis of
gene lists can be performed in the same manner as in microarray
data analysis. These tools typically perform Fishers exact tests to
identify groups of genes (by assigning them based on involvement
with a specific biological term known as an ontology) that appear
in a list more often than expected by chance if a random selection
of genes of the same size as the gene list was tested. Detection of
changes in large numbers of genes all associated with the same
process can suggest a change in the process itself, which can be
further tested with downstream experiments. Recommended sites
for performing this type of analysis include DAVID [14] and
Panther [2527].
Clustering analysis can be performed on RNA-sequencing data
once care has been taken to normalize the data. A number of packages in R exist for the purpose of investigating RNA-sequencing
data, for example, DESeq [28] and edgeR [29]. The authors of
Trinity have utilized the edgeR package to analyze RNA-sequencing
data and prepare the data for clustering analysis. Note that the
default parameters within Trinity utilize Euclidean distance and
complete linkage clustering [30]. We recommend changing the
parameters to Pearson and average to detect similarities
between expression patterns while overlooking differences in magnitude of expression.
References
1. Page RB et al (2007) Microarray analysis identifies keratin loci as sensitive biomarkers for
thyroid hormone disruption in the salamander
Ambystoma mexicanum. Comp Biochem
Physiol C Toxicol Pharmacol 145:1527
2. Huggins P et al (2012) Identification of differentially expressed thyroid hormone responsive genes from the brain of the Mexican
Axolotl (Ambystoma mexicanum). Comp
Biochem Physiol C Toxicol Pharmacol 155:
128135
3. Stewart R et al (2013) Comparative RNA-seq
analysis in the unsequenced axolotl: the oncogene burst highlights early gene expression in
the blastema. PLoS Comput Biol 9:e1002936.
4. Wu CH, Tsai MH, Ho CC, Chen CY, Lee HS
(2013) De novo transcriptome sequencing of
axolotl blastema for identification of differentially expressed genes during limb regeneration. BMC Genomics 14:434. doi:10.1186/
1471-2164-14-434
5. JMP Genomics Version 5.0. (19892007) SAS
Institute, Cary, NC
6. R: a language and environment for statistical
computing. (2012) R Foundation for Statistical
Computing, Vienna, Austria
7. MySQL AB (20082009) Sun Microsystems Inc
8. Irizarry RA et al (2003) Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics
4:249264
9. Holder D, Raubertas RF, Pikounis VB, Svetnik
B, Soper K (2001). Statistical analysis of
high density oligonucleotide arrays: a SAFER
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
approach. In GeneLogic Workshop on Low

Level Analysis of Affymetrix GeneChip Data.
Proceedings of the ASA annual meeting August
5-9, 2001.
Page RB et al (2008) Effect of thyroid hormone
concentration on the transcriptional response
underlying induced metamorphosis in the
Mexican axolotl (Ambystoma). BMC Genomics
9:78. doi:10.1186/1471-2164-9-78
Fleet JC, Wang L, Vitek O, Craig BA, Edenberg
HJ (2003) Gene expression profiling of Caco-2
BBe cells suggests a role for specific signaling
pathways during intestinal differentiation.
Physiol Genomics 13:5768
Shah SH, Pallas JA (2009) Identifying differential exon splicing using linear models and correlation coefficients. BMC Bioinformatics
10:26. doi:10.1186/1471-2105-10-26
Benjamini Y, Hochberg Y (1995) Controlling
the false discovery rate: a practical and powerful
approach to multiple testing. J R Stat Soc Series
B 57:289300
Dennis G Jr et al (2003) DAVID: database for
annotation, visualization, and integrated discovery. Genome Biol 4:P3
Eisen MB, Spellman PT, Brown PO, Botstein
D (1998) Cluster analysis and display of
genome-wide expression patterns. Proc Natl
Acad Sci U S A 95:1486314868
Haas BJ et al (2013) De novo transcript
sequence reconstruction from RNA-seq using
the Trinity platform for reference generation
and analysis. Nat Protoc 8:14941512
Maher CA et al (2009) Chimeric transcript
discovery by paired-end transcriptome
sequencing. Proc Natl Acad Sci U S A 106:
1235312358
Robinson MD, Oshlack A (2010) A scaling
normalization method for differential expression analysis of RNA-seq data. Genome Biol
11:R25. doi:10.1186/gb-2010-11-3-r25
Mortazavi A, Williams BA, McCue K, Schaeffer
L, Wold B (2008) Mapping and quantifying
mammalian transcriptomes by RNA-Seq. Nat
Methods 5:621628
319
20. Oshlack A, Wakefield MJ (2009) Transcript

length bias in RNA-seq data confounds systems
biology. Biol Direct 4:14. doi:10.1186/
1745-6150-4-14
21. Bullard JH, Purdom E, Hansen KD, Dudoit S
(2010) Evaluation of statistical methods for
normalization and differential expression in
mRNA-Seq experiments. BMC Bioinformatics
11:94. doi:10.1186/1471-2105-11-94
22. Li B, Dewey CN (2011) RSEM: accurate
transcript quantification from RNA-Seq data
with or without a reference genome. BMC
Bioinformatics 12:323. doi:10.1186/14712105-12-323
23. Leng N et al (2013) EBSeq: an empirical Bayes
hierarchical model for inference in RNA-seq
experiments. Bioinformatics 29:10351043
24. Altschul SF, Gish W, Miller W, Myers EW,
Lipman DJ (1990) Basic local alignment search
tool. J Mol Biol 215:403410
25. Thomas PD et al (2006) Applications for protein
sequence-function evolution data: mRNA/protein expression analysis and coding SNP scoring
tools. Nucleic Acids Res 34:W645W650
26. Mi H, Muruganujan A, Casagrande JT,
Thomas PD (2013) Large-scale gene function
analysis with the PANTHER classification system. Nat Protoc 8:15511566
27. Mi H, Muruganujan A, Thomas PD (2013)
PANTHER in 2013: modeling the evolution
of gene function, and other gene attributes, in
the context of phylogenetic trees. Nucleic
Acids Res 41:D377D386
28. Anders S, Huber W (2010) Differential
expression analysis for sequence count data.
Genome Biol 11:R106. doi:10.1186/gb-201011-10-r106
29. Robinson MD, McCarthy DJ, Smyth GK
(2010) edgeR: a Bioconductor package for differential expression analysis of digital gene
expression data. Bioinformatics 26:139140
30. Grabherr MG et al (2011) Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol 29:
644652
Chapter 25
Sal-Site: Research Resources for the Mexican Axolotl
Nour W. Al Haj Baddar, M. Ryan Woodcock, Shivam Khatri,
D. Kevin Kump, and S. Randal Voss
Abstract
Sal-Site serves axolotl research efforts by providing Web access to genomic data and information, and
living stocks that are reared and made available by the Ambystoma Genetic Stock Center (AGSC). In this
chapter, we detail how investigators can search for genes of interest among Sal-Site resources to identify
orthologous nucleotide and protein-coding sequences, determine genome positions within the Ambystoma
meiotic map, and obtain estimates of gene expression. In the near future, additional genomic resources will
be made available for the axolotl, including a listing of genes that are partially or wholly contained within
Bacterial Artificial Chromosome (BAC) vectors, a prioritized collection of deeply sequenced BAC clones,
chromosome-specific assemblies of genomic DNA, and transgenic axolotls that are engineered using
TALENs and CRISPRs. Also, services provided by the AGSC will be expanded to include microinjection
of user constructs into single cell embryos and distribution of axolotl tissues, DNA, and RNA. In conclusion, Sal-Site is a useful resource that generates, shares, and evolves Ambystoma associated information and
databases to serve research and education.
Key words Salamander, Limb regeneration, Transcriptome, Analysis, Genomic resources
Introduction
Salamanders are important models in basic and biomedical research.
Over the last 100 years, salamanders have figured prominently in
studies of development, neurophysiology, ecology, evolution, and
tissue regeneration. To enhance efforts in these and other research
areas, genome resource development is underway for the primary
salamander modelthe Mexican axolotl (Ambystoma mexicanum).
A bioinformatics Web-baseSal-Sitewas created to make axolotl
genomic data and information available to the community. Here
we describe Sal-Site content and best practices for extracting useful
information.
321
322
2
2.1
Nour W. Al Haj Baddar et al.
Sal-Site Website
Homepage
The Sal-Site homepage provides hyperlinks to access axolotl

genome resources and information (Fig. 1). The header tab
(Fig. 1A) indexes major sections of the website: axolotl research,
genome resources, Ambystoma Genetic Stock Center (AGSC),
education, about, and photo gallery. In addition, an orientation
video (Fig. 1B) introduces the Mexican axolotl (Ambystoma mexicanum) and highlights its remarkable ability to regenerate complex
tissues and organs. The video also details general functions of the
AGSC. This unique facility houses, breeds, and maintains a large
inbred axolotl population, providing axolotls nationally and internationally. The homepage also displays additional summary information regarding the axolotls type location (Lake Xochimilco,
Mexico), general phenotypic characteristics, and Sal-Site support
mechanisms (Fig. 1C). The Fun Facts section (Fig. 1D) provides
quick informational statements regarding axolotls that periodically
change. Finally, the home page provides quick links for the most
highly accessed Sal-Site links (Fig. 1E).
Fig. 1 The Sal-Site homepage. This hompage (A) has hyperlinks to orientation video (B ) that introduces
Ambystoma mexicanum, general information about Sal-Site funding mechanisms (C ), salamander fun facts
(D ), and the most highly accessed links of Sal-Site (E )
2.2
Axolotl Research
323
The significance of the axolotl model will grow with genome

resource development and further advances in the field. The axolotl research section of Sal-Site (Fig. 2) details projects and publications associated with axolotl resource development. Over the last
10 years, the axolotl transcriptome has been deeply sequenced,
microarrays have been developed and used to study regeneration
and metamorphosis, and a meiotic map was constructed. Current
projects include transgenic axolotl development, sequencing of
whole axolotl chromosomes, and creation of large insert DNA
libraries using Bacterial Artificial Chromosome (BAC) vectors.
With respect to the BAC project, a workflow is in place to screen
BAC super pools by next generation sequencing to create an inventory of potential candidate genes for isolation. This initiative is
developing regulatory sequence information for key developmental genes, information that is useful for developing reporter constructs for transgenic development (Fig. 3). This and the other
initiatives will enable sequence-based methods of inquiry that are
Fig. 2 Axolotl research webpage provides hyperlinks to axolotl research projects and selected publications. The
axolotl research projects include the salamander genome project, axolotl Bacterial Artificial Chromosome
(BAC) project, axolotl chromosome sequencing project, and axolotl transgenic project
324
Fig. 3 Axolotl BAC project. Alignment of genomic sequences from frog (Xenopus tropicalus), chick (Gallus
gallus), and human (Homo sapiens) to an axolotl BAC that contains early growth response 1 (egr1). The horizontal black bars show regions of sequence similarity where nucleotide alignments are greater than 50 %
identical. The white and gray bars at the top show untranslated regions and exons (Ex), respectively
typical of genetic model organisms. The axolotl research section of

Sal-Site will continually evolve to keep the community abreast of
new resources as they become available.
2.3 Genome
Resources
The Genome Resources section of Sal-Site (Fig. 4) organizes

resources into four main subsections: gene and EST databases
(Fig. 4A), genetic map and marker information (Fig. 4B), BLAST
(Fig. 4C), and limb regeneration microarray databases (Fig. 4D).
Each subsection is discussed below.
2.3.1 Gene and EST

Database
An EST represents a partial sequence of a complementary DNA

(cDNA) synthesized from a messenger RNA (mRNA). ESTs enable
multiple lines of research, including transcript assembly, protein
sequence annotation, genome mapping, and design of oligonucleotide probes for PCR and microarrays. Sal-Site presents transcriptome data for the Mexican axolotl and eastern tiger salamander
(A. tigrinum tigrinum) (Fig. 5), and in the future, for additional
ambystomatid species. The A. mexicanum transcriptome includes
transcripts sampled from a variety of tissues and exists as two separate transcript assemblies (Version 3.0 and 4.0; [13]).
When a sufficient number of ESTs are generated for a specific
mRNA, it is possible to assemble these into a contiguous nucleotide sequence that provides a model of the protein-coding
sequence. However, if EST depth is not sufficient to build a contiguous sequence (contig), which is problematic in working with
expanded genic regions of the axolotl genome [4], a contig may
only partially cover an mRNA, or independent contigs may map to
325
Fig. 4 Genome resources main webpage. This webpage provides hyperlinks to resources and tools. (A) Gene
and EST Database, (B ) Genetic Map and Marker Information, (C ) NCBI-BLAST tool, and (D ) Gene Expression
nonoverlapping portions of the same mRNA. ESTs may also

assemble into multiple overlapping reads that are suggestive of
splice variants. When there is sequence contiguity among a group
of contigs, they are classified into a common isogroup. For a given
isogroup, any inferred splice variants (which would putatively represent individual transcripts) are reported as isotigs. The Sal-Site
genome resources webpage enables visitors to search for genes of
interest in A. mexicanum or A. t. tigrinum salamander transcriptome databases. The search for genes in assembly V3.0 and V4.0
(Fig. 5) can be conducted by typing a specific contig (Fig. 5A),
isotig (Fig. 5B), or gene symbol identifier (Fig. 5C) in the appropriate field, and by selecting a reference database from the dropdown menu (Fig. 5D).
Figure 6 shows steps that an investigator would follow to identify a gene of interest in the gene and EST database. For example,
if a user is interested in searching the A. mexicanum V4.0 database
for early growth response 1, the official gene symbol (egr1) is typed
in the appropriate field (Fig. 6A) using one of the reference databases (Fig. 6B). After clicking the submit button, a results page
appears to show axolotl contigs (hits) that are annotated for egr1
326
Fig. 5 Gene and EST database. Genes of interest can be searched using the axolotl V4.0 and V3.0 transcriptome assemblies as reference databases. Searches can be conducted by typing a specific contig (A), isotig (B ),
or gene symbol identifier (C ) in the appropriate field, followed by selecting a reference database from the
drop-down menu (D )
(Fig. 6C). It is important to note that more than one contig hit
may be reported for a query; these may represent split or nonoverlapping contigs for the same gene model, or incomplete transcript
models with low quality sequence. Moreover, when more than one
contig shows sequence identity to the same region of a query, it is
possible that the contigs are paralogous genes. In this example,
two contigs have been assembled for egr1. By clicking on the
hyperlink provided for the first contig (contig316872), a gene card
appears (Fig. 7A). The gene card offers an additional hyperlink to
open a NCBI page for the corresponding orthologous human protein (Fig. 7B). The gene card page also includes a hyperlink to
PubMed that reports some of the scientific articles that are related
to the gene of interest (Fig. 7C). Clicking the contig ID hyperlink
opens a sequence annotation page that provides detailed information about the contig, including the number of ESTs in the contig
(Fig. 7D), contig nucleotide sequence (Fig. 7E), and the longest
computer predicted open reading frame (ORF) with protein
327
Fig. 6 An example search of the Gene and EST database. The gene symbol for early growth responseegr1
is typed in the appropriate field (A) and a reference database is selected; Ambystoma mexicanum V4.0 contigs
in this example (B ). After clicking the submit button, a result webpage appears showing axolotl hits (contigs)
annotated for egr1 (C )
translation (Fig. 7F). Additionally, this sequence annotation page

contains data for BLAST hits linked to human sequences curated
by NCBI, including sequence similarity and alignment statistics
(Fig. 7G). In this example, EST depth, sequence similarity, and
sequence coverage provide very good evidence that contig316872
corresponds to egr1.
2.3.2 Genetic Map
and Marker Information
Although the Mexican axolotl genome is large, it has been possible

to order genes into linkage groups and identify conserved gene
orders in comparison to other vertebrate models [35]. Sal-Site
provides information about the ordering of 917 genetic markers
among 17 linkage groups (LG)as an example, part of LG3 is
shown(Fig. 8A). The number of linkage groups approaches the
Ambystoma haploid chromosome number (N = 14) and is comprised mostly of EST-based markers. A conserved synteny table
provides the positions of orthologous loci from human, axolotl,
chicken, and Xenopus tropicalis genomes (Fig. 8B). Continuing
with the example above, the genome position of egr1 has not been
determined, however it is possible to determine the most likely
position by comparing conserved synteny blocks between the axolotl and chicken gene maps. In the chicken genome, egr1 is found
on chromosome 13. Because all but two of the chicken chromosome 13 genes that have been mapped in the axolotl locate to
axolotl LG3, the location of these genes within LG3 provide the
most likely position for egr1. The Ambystoma linkage map has been
used to establish orthology of key developmental genes [6, 7] and
identify quantitative trait loci [811].
328
Fig. 7 An example gene card for Ambystoma mexicanum erg1. (A) The Sal-Site gene card for egr1 provides a
hyperlink to human EGR1 at NCBI (B ). The gene card page also includes a hyperlink to access related PubMed
scientific articles (C ). The gene card also provides links of the axolotl contigs annotated for erg1. Clicking the
first link (contig316872) accesses an annotation webpage that details the number of ESTs associated with the
contig (D ), contig nucleotide sequence (E ), and the longest computer predicted open reading frame (ORF) with
protein translation (F ). Additionally, this sequence annotation webpage contains data for BLAST hits linked to
human sequences curated by NCBI, including sequence similarity and alignment statistics (G ). In this example,
EST depth and sequence coverage provide very good evidence that contig316872 corresponds to egr1
2.3.3
BLAST
The Basic Local Alignment Tool (BLAST) is a powerful tool to

identify sequence similarities among nucleotide sequences [12].
Sal-Site provides NCBI-BLAST tools to allow sequence similarity
searches of A. mexicanum and A. t. tigrinum nucleotide databases
(Fig. 9). To illustrate, we will use human egr1 (gi|31317226) as a
query sequence to identify the axolotl sequences that share nucleotide similarity with it. The input sequence (query) can be pasted as
a FASTA formatted sequence, (Fig. 9A) or uploaded from a file
(Fig. 9B). The BLAST search can be conducted using a userselected algorithm (available options include: blastn, blastp, blastx,
tblastx, tblastn; Fig. 9C) against a chosen Ambystoma database from
the drop-down menu (Fig. 9D). Clicking the search button submits the sequence data and opens a BLAST results report. Example
portions of BLAST reports are displayed in Figs. 10 and 11.
329
Fig. 8 Axolotl genetic map and marker information. This webpage details information about the ordering of
917 genetic markers among 17 linkage groups (LG). A part of LG3 is shown as an example (A ). A conserved
synteny table provides the positions of orthologous loci from human, axolotl, chicken, and Xenopus tropicalis
genomes (B )
The first portion of BLAST output contains header information (Fig. 10 I) that reports the algorithm used for the BLAST
search task (e.g., blastn) and the database that has been searched.
The second portion of BLAST output (Fig. 10 II) displays the
length of the query input sequence and a graphical representation
of the BLAST results summarizing the top hits (i.e., a sequence
330
Fig. 9 The Sal-Site NCBI-BLAST tool is used to identify axolotl contigs that share sequence identity with query
sequences. As an example, the human egr1 (gi|31317226) nucleotide sequence is used as a query and pasted
into the appropriate field (A ). Alternatively, the query sequence can be uploaded from a file (B ). The BLAST can
be performed using one of several algorithms (C ); the BLASTN algorithm is selected here. The reference database is chosen through a drop-down menu (D )
that shows nucleotide similarity to the query) found in the database.

The third portion of the BLAST output report includes a one-line
description of the best hits found (Fig. 11 III). Herein, every line
summarizes the information about the contig ID, its length, score,
and E-value (Fig. 11AD). The sequences are ordered in this section from greatest to least similar, relative to the query sequence.
The score (Fig. 11C) measures similarity between the query and
the hit sequences: the greater the value, the greater the similarity
between hit sequence and query. The E-value (Fig. 11D) is an
index of the statistical significance of the hit reported: the lower
the number, the greater the similarity between sequence and query.
Note that the best axolotl hit recovered for human egr1 is contig316872 (Fig. 11A), as it has the highest score and the lowest
E-value. Clicking on the score hyperlink (Fig. 11C) of a selected
contig takes the user to the final portion of the BLAST output
(Fig. 11 IV). This part gives a detailed pairwise alignment of the
query to each of the recovered hits. The header (Fig. 11E) is a
repetition of the header information in the previous output section
331
Fig. 10 BLAST output. The human egr1 nucleotide sequence (gi|31317226) was used as a query to identify the
most likely axolotl orthologous sequence in the V4 transcript assembly. (I) The report shows the algorithm that
was used for the BLAST search and the database that was searched. (II) A graphical representation of results
that summarizes the top hits to the query sequence. The color bar shows the alignment score. Each of the bars
below the query corresponds to a hit. By moving the cursor over these hit bars, it is possible to display a short
summary of the sequence ID and alignment
(Fig. 11 III). In this example identities (89 %) represent the

percentage of nucleotide positions that is fully identical between
contig316872 and human egr1 sequence in the region of alignment. The pairwise alignment (Fig. 11G) provides the coordinates
of the query and subject (or hit) sequences that are aligned (i.e.,
nucleotides positions) in addition to a vertical line series that represent identical nucleotides shared between both sequences.
2.3.4 Gene Expression
Gene expression technologies have advanced nearly all areas of biological research, providing, for example, greater insight into molecular pathways underlying biological processes. A number of
advanced molecular tools for gene expression analysis (including
microarray, quantitative-pcr, RNA-seq, and Nanostring) are being
used in axolotl studies. Sal-Site provides information that is useful
for conducting microarray analyses using a custom Affymetrix
GeneChip that is available for purchase from Affymetrix (part
332
Fig. 11 Continuation of BLAST output from Fig. 10. (III) Summary of information for each hit (contig), including
length, score, and E-value (AD ). The score (C) measures similarity between the query and the hit sequence.
The E-value (D ) is an index of the statistical significance of the hit reported. (IV) A detailed pairwise alignment
of the query to each of the recovered hits. The header (E ) is a repetition of the header information in the previous output section. This final output also provides the identities and the strand directionality of both sequences
for which the alignment was performed (F ). Identities refer to the number and percentage of identical nucleotides in the alignment. The pairwise alignment (G ) provides the coordinates of the query and hit sequences
that are aligned (i.e., nucleotides positions) in addition to a vertical line series that represent identical nucleotides shared between both sequences. As shown, the best hit recovered for human egr1 is contig316872
number520748) [13] (Fig. 12). These microarrays provide a

standard platform for conducting gene expression experiments.
Data from published microarray experiments are available for
download as CEL files. Additional files that are needed to analyze
and annotate microarray data are available from Sal-Site, as are
instructions for normalizing microarray data using Affymetrix
Expression Console or Partek Genomics Suite to implement
the Robust Multiarray Average (RMA) approach [14].
Given growing interest in axolotl regeneration, Sal-Site provides a
searchable database (Fig. 13) of temporal gene expression profiles for
the first 28 days of limb regeneration. This study is exemplary in scope
and experimental design. The experiment used ten replicate axolotl
GeneChips to estimate gene expression for two different amputation
injuries and 20 different post-amputation time points (Fig. 13 I).
333
Fig. 12 Gene expression during axolotl limb regeneration. This webpage provides a searchable database of
gene expression profiles during axolotl limb regeneration using gene symbol or Affymetrix probe ID. In addition,
axolotl microarray library, probe annotation, and raw microarray data files are provided
Overall, the database reports 8,000,000 estimates of gene expression.

These data can be queried using gene names, gene acronyms, or Affy
probe IDs. For example, by typing the gene symbol egr1 in the appropriate field and clicking the submit button, a gene expression profile is
shown with log2 intensity on the Y-axis and post-amputation time
points along the X-axis (Fig. 13 II). Additional experimental details
about the microarray probe ID, contig sequence ID, and gene name
are included in the output.
2.4 Ambystoma
Genetic Stock Center
Approximately 150 years ago, Mexican axolotls (Ambystoma mexicanum) were collected from their ancestral aquatic habitats near
present day Mexico City to establish laboratory populations in
Europe and subsequently the US. The AGSC at University of
Kentucky houses a historically significant population of axolotls
that was founded by Rufus R. Humphrey in 1936, and successfully
propagated by the University of Indiana through 2005. Over time,
domestication created homogeneous wild type and mutant stocks
that are amendable to laboratory culture and breeding. These
stocks provide a sustainable resource for research and educational
efforts around the world. The AGSC operates as a premier animal
334
Fig. 13 Comprehensive microarray analysis of gene expression during axolotl limb regeneration is available on
the Sal-Site genome resources page. (I) The cartoon shows regeneration stages after axolotl limb amputation
(A). The stages include pre-bud (PB), early bud (EB), medium bud (MB), late bud (LB), palette (P), digital outgrowth (DO), and completed (C). The vertical line shows the plane of amputation. The DPA (days postamputation) numbers shows when individuals were observed for each regeneration stage. (II) Temporal gene
expression profile for egr1 during the first 28 days of limb regeneration
resource center providing A. mexicanum embryos, larvae, juveniles, adults to laboratories and classrooms nationally and internationally. Essentially all laboratory axolotls in the USA, and the
majority if not all axolotls in labs around the world, descend from
the AGSC collection. The AGSC also supplies animals and display
aquaria to museums, zoos, workshops, and aquariums. Sal-Site
provides contact information for AGSC personnel, pricing for axolotl stocks (embryos, larvae, juveniles, adults, and transgenics),
axolotl care supplies, information about animal care and use, ordering, and answers to frequently asked questions (Fig. 14).
2.5
Education
Sal-Site provides educational materials about axolotls that are

useful to researchers and teachers (Fig. 15). Education kits are
available to involve students in axolotl experiments. Further, SalSite provides descriptions and illustrations for axolotl embryo
stages, limb bud stages, and limb regeneration stages. AGSC staffers provide advice in setting up exhibit aquaria. Locally, the AGSC
provides tours for high school and college students.
Fig. 14 The Ambystoma Genetic Stock Center (AGSC). Sal-Site provides a portal to the AGSC, where researchers and educators can purchase axolotls and supplies
Fig. 15 The Education hyperlink. Sal-Site provides useful information for working with axolotls, including information about axolotl care, use, and development
336
References
1. Putta S, Smith JJ, Walker JA, Rondet M,
Weisrock DW, Monaghan JR, Kump DK, King
DC, Maness NJ, Habermann B, Tanaka EM,
Bryant SV, Gardiner DM, Parichy DM, Voss
SR (2004) From biomedicine to natural history research: EST resources for ambystomatid
salamanders. BMC Genomics 5:54
2. Smith JJ, Putta S, Walker JA, Kump DK,
Samuels AK, Monaghan JR, Weisrock DW,
Staben C, Voss SR (2005) Sal-Site: integrating
new and existing ambystomatid salamander
research and informational resources. BMC
Genomics 6:181
3. Voss SR, Kump DK, Putta S, Pauly N, Reynolds
A, Henry RJ, Smith JJ et al (2011) Origin of
amphibian and avian chromosomes by fission,
fusion, and retention of ancestral chromosomes. Genome Res 21:13061312
4. Smith JJ, Putta S, Zhu W, Pao GM, Verma IM,
Hunter T, Bryant SV, Gardiner DM, Harkins
TT, Voss SR (2009) Genic regions of a large
salamander genome contain long introns and
novel genes. BMC Genomics 10:19
5. Voss SR, Prudic KL, Oliver JC, Shaffer HB
(2003) Candidate gene analysis of metamorphic timing in ambystomatid salamanders. Mol
Ecol 12:12171223
6. Dixon JE, Allegrucci C, Redwood C, Kump
DC, Bian Y, Chatfield J, Chen Y-S, Sottile V,
Voss SR, Alberio R, Johnson AD (2010)
Axolotl Nanog activity in mouse embryonic
stem cells demonstrates that ground state
pluripotency is conserved from urodele
amphibians to mammals. Development 137:
29732980
7. Tapia N, Reinhardt P, Duemmler A, Wu G,
Arazo-Bravo MJ, Esch D, Greber B, Cojocaru
V, Rascon CA, Tazaki A, Kump K, Voss R,
8.
9.
10.
11.
12.
13.
14.
Tanaka
EM,
Schler
HR
(2012)
Reprogramming to pluripotency is an ancient
trait of vertebrate Oct4 and Pou2 proteins. Nat
Commun 3:1279
Voss SR, Shaffer HB (1997) Adaptive evolution via a major gene effect: paedomorphosis in
the Mexican axolotl. Proc Natl Acad Sci USA
94:1418514189
Voss SR, Smith JJ (2005) Evolution of salamander life cycles: a major-effect quantitative
trait locus contributes to discrete and continuous variation for metamorphic timing. Genetics
170:275281
Johnson CK, Voss SR (2013) Salamander paedomorphosis: linking thyroid hormone to life
history and life cycle evolution. Curr Top Dev
Biol 103:229258
Page RB, Boley MA, Kump DK, Voss SR
(2013) Genomics of a metamorphic timing
QTL: met1 maps to a unique genomic position
and regulates morph and species-specific patterns of brain transcription. Genome Biol Evol
5:17161730
Altschul SF, Gish W, Miller W, Myers EW,
Lipman DJ (1990) Basic local alignment search
tool. J Mol Biol 215:403410
Huggins P, Johnson CK, Schoergendorfer A,
Putta S, Bathke AC, Stromberg AJ, Voss SR
(2012) Identification of differentially expressed
thyroid hormone responsive genes from the
brain of the Mexican Axolotl (Ambystoma mexicanum). Comp Biochem Physiol C Toxicol
Pharmacol 155:128135
Irizarry RA, Hobbs B, Collin F, Beazer Barclay
YD, Antonellis KJ, Scherf U, Speed TP (2003)
Exploration, normalization, and summaries of
high-density oligonucleotide array probe level
data. Biostatistics 4:249264
Chapter 26
Data Mining in Newt-Omics, the Repository
for Omics Data from the Newt
Abstract
Salamanders are an excellent model organism to study regenerative processes due to their unique ability to
regenerate lost appendages or organs. Straightforward bioinformatics tools to analyze and take advantage
of the growing number of omics studies performed in salamanders were lacking so far. To overcome this
limitation, we have generated a comprehensive data repository for the red-spotted newt Notophthalmus
viridescens, named newt-omics, merging omics style datasets on the transcriptome and proteome level
including expression values and annotations. The resource is freely available via a user-friendly Web-based
graphical user interface (http://newt-omics.mpi-bn.mpg.de) that allows access and queries to the database
without prior bioinformatical expertise. The repository is updated regularly, incorporating new published
datasets from omics technologies.
Key words Newt, Salamander, Database, Transcriptomics, Proteomics
Introduction
1.1 The Newt-omics

Repository
Currently, a small panel of model organisms such as the mouse,

zebra fish, or C. elegans dominates biomedical research. Analysis of
these standard model organisms is facilitated by large public repositories providing genome, transcriptome, and proteome information. Detailed information for single genes usually includes facts
about intron and exon regions, splicing signals as well as the
sequence itself and functional annotations. Available repositories
allow easy querying of datasets, often without the need of specialized bioinformatical expertise. Access is usually granted by Web
services. Salamanders do not belong to the group of wellinvestigated organisms rather than to the group of niche model
organisms [1]. In the past, genome sequence data or comprehensive transcriptome or expression data were not available for such
niche models. In newts, the first large-scale expression data were
obtained using custom-made microarrays generated from lens [2]
and other tissues [3], which yielded valuable but incomplete insights.
337
338
This situation dramatically changed within the past 5 years. New

sequencing methods were developed for analysis of smaller
genomes, transcriptomes, and proteomes. Analysis of niche model
organisms has profited considerably from these new techniques,
which are continuously evolving and becoming more and more
affordable and easier to use. The most important techniques in this
context are probably high-throughput mass spectrometry and
next-generation sequencing, which enable de novo proteome,
genome, or transcriptome analysis of niche models even in small
labs. So far several studies on regenerative processes in niche models have been published [49], which in the newt have focused on
the heart and the lens [1014].
The vast amount of data generated by modern sequencing and
mass spectrometry analysis creates new challenges. Datasets in raw
format as they are are rather difficult to handle for nonspecialists
and not very intuitive to use. Data formats are difficult to read by
eye and the large volume of files sometimes makes even trivial tasks
as, e.g., opening of a file cumbersome, further adding to problems
with data storage and exchange. One potential solution for such
problem is the exchange of processed and analyzed datasets (often
excel files) but at the cost of transparency and comparability.
To overcome such limitations and to give access to datasets generated on different platforms and in different labs, we established the
newt-omics repository [15] for the red-spotted newt Notophthalmus
viridescens. As the estimated genome size of the newt is up to ten
times larger than that of humans, a genome project has not been
initiated yet, despite the increasing speed and capacities of modern
sequencing machines and assembly algorithms. Therefore, we
decided to focus on the transcriptome instead of the genome as the
central element for our database. All information stored in the
database is linked directly to this central element. Newt-omics
includes a de novo-assembled transcriptome based on a set of
sequencing approaches on different sequencing platforms. In addition, expression data from multiple high-density microarrays as
well as RNA-seq experiments were included. The transcriptome
was translated to open reading frames and utilized for mass
spectrometry-based protein identification. Newt-omics stores and
interlinks all available datasets and provides a user-friendly gateway,
which should help to make molecular data for Notophthalmus viridescens more accessible for researchers with limited experience in
bioinformatics.
The Newt-omics hosts sequence data from transcriptomics and
proteomics approaches, experimental expression data, primary
sequence annotations, and functional annotations. In terms of the
transcriptome, a de novo transcriptome was generated and
annotated. Expression data from microarray and RNA-seq experiments are linked to the de novo transcriptome. Further, protein
expression data derived from mass spectrometry experiments are
Data Mining in Newt-Omics, the Repository for Omics Data from the Newt
339
included. The design of the Newt-omics is based on an entity

relationship model (ERM) connecting various datasets to avoid
compartmentalization. Connection of datasets is realized by selection of biological entities such as transcripts or peptides.
Experimental settings are used as attributes of biological entities.
The core object of our model is the transcript (due to the lack of a
genome) that links queries from distinct experiments to general
data such as annotations and vice versa. Individual sections of the
model can be updated separately (Fig. 1). This is crucial, as, e.g.,
annotations or functional annotations like ontologies change more
often than associated peptide sequences. To facilitate access to the
database, we implemented a Web-based user interface using PHP/
HTML/JS scripts. The only prerequisite to browse and query the
database is a Web browser like Firefox or IE. The database is freely
available via http://newt-omics.mpi-bn.mpg.de and bioinformatics.
mpi-bn.mpg.de.
Fig. 1 Flow chart of information processing in the newt data repository. The newt repository is generated by
automated pipelines for multiple raw data formats that perform an extracttransformload (ETL) process to fill
the database. Each part of the database is updated independently of other parts facilitating the update process
to include new datasets
340
The database is updated once a year, incorporating further

datasets from the red-spotted newt generated by the authors
group as well as other published transcriptome and proteome
datasets.
Published datasets included in the current version 1.0:
1. Sousounis K. et al. 2013: Transcriptome analysis of newt lens
regeneration reveals distinct gradients in gene expression
patterns.
2. Looso M. et al. 2013: A de novo assembly of the newt transcriptome combined with proteomic validation identifies new
protein families expressed during tissue regeneration.
3. Sousounis K et al. 2013: A microarray analysis of gene expression patterns during early phases of newt lens regeneration.
4. Looso et al. 2012: Spiked-in pulsed in vivo labeling identifies a
new member of the CCN family in regenerating newt hearts.
5. Looso et al. 2010: Advanced identification of proteins in
uncharacterized proteomes by pulsed in vivo stable isotope
labeling-based mass spectrometry.
Datasets that will be included in the database version 2.0
(end of 2014):
1. Abdullayev I. et al. 2013: A reference transcriptome and inferred
proteome for the salamander Notophthalmus viridescens.
2. In vivo lens proteomics data, three time points of regeneration,
dorsal and ventral origin.
3. In vitro lens proteomics data, dorsal and ventral origin.
4. Phosphoproteomics data, multiple tissues, uninjured.
5. Expression data from cartilage regeneration, multiple time
points.
1.2 Processing
of Proteome Data
To obtain a comprehensive set of proteins that are present during

organ regeneration, we performed mass spectrometry (reversephase nano-LC-MS/MS) experiments on several newt hearts during regeneration, regenerating lens, and tail samples. We used
stable isotope labeling with amino acids in cell culture (SILAC)
labeled proteins in vivo [12, 11] and label-free approaches to
quantify protein expressions in different biological samples. The de
novo-generated transcriptome was reverse translated into open
reading frames (ORF) to generate a protein search database. The
used maximum false discovery rate was set <1 % for peptide and
protein identifications using decoy target databases [15].
1.3 Assignment
of Annotations
to Sequence Data
BLAST homology searches were performed using blastn, blastx,

and tblastx tools on NCBIs NR (protein), NR (Nucleotide), EST,
and UniProt databases. All hits were stored according to their taxa.
For each single taxon (>90), a quality rating based on regular
341
expressions was performed. Keywords providing a robust quality

level were preferred. To achieve a maximum quality with a minimum number of annotations per taxon, we prioritize hits in the
NCBI NR or UniProt database over an EST hit. Based on this
assumption, we computed a quality rank based on a dictionary of
keywords (e.g., cDNA, clone, mRNA, predicted) reflecting hits of
limited information. Database entries containing one or more such
keywords were marked as low-quality hits (see Ref. 16 for details).
Remarkably a substantial number of sequenced and assembled
transcripts did not share any reliable sequence similarity to known
database entries.
1.4 Assignment
of Functional
Annotations
Subsequent to transcript annotation, we assigned transcripts to different functional groups. Since Gene Ontology (GO) annotations
for amphibians are limited [17], we used the UniProt BLAST
results from mouse, zebra fish, cow, human, and chicken. GO
annotations for each transcript were stored in a taxon-dependent
manner. We stored the best hit for each taxon having at least one
GO annotation. Further, we used functional domains, interaction
partners, protein families, and pathways from the UniProt entries.
Materials
To provide access to the freely accessible newtomics resource, we
implemented a PhP Web-based graphical user interface (GUI).
This can be used by any user by pointing any browser (GUI optimized for Firefox) to newtomics.mpi-bn.mpg.de.
Methods
3.1 General
Considerations
For searching newt-related data, you will need a Web browser

(database front end is optimized for Firefox) to connect to www.
newtomics.mpi-bn.mpg.de. Based on the point of interest, the
users need to choose one of the main sections of the database to
generate a query. The database is grouped into the sections
sequence data, annotation, functional annotation, expression data
(including RNA-seq and microarrays), and proteome (Fig. 2).
Since a genome is missing as central entity, you will find the transcript entity defined as core element that links additional entities.
Any query that you formulate in the graphical user interface (GUI)
to one of the mentioned sections will eventually utilize this central
transcript element for presentation of results.
3.2 Guided Tour

on the Graphical
User Interface
The GUI of the newtomics database is accessible by pointing your

browser to newtomics.mpi-bn.mpg.de. The Firefox browser is recommended for optimal display. On top of the GUI, you will find
five main windows. Beginning from the left you find the Home
342
Fig. 2 Design of the database. The database is divided into five main parts, namely, the sequence part, the
annotation part, the functional annotation part, the expression part, and the proteome part. The central element
is the transcript that interlinks all other sections. Queries on multiple parts of the database utilize the central
table. The scheme can get upgraded easily by adding new tables with transcript IDs as foreign key
window, which is the starting window giving general information

about the amount of data stored in the database (details can be
found above in the database section). To perform database searches
in one of the data sections mentioned above, the users need to start
from either of the four panels Transcripts, Blast, Peptides,
or Expression (Fig. 3). The Tutorial window will give some
examples on the search forms; the About window on the right
gives general information on the database development and linked
publications.
Once you have chosen a single transcript of interest in any of
the four main search windows mentioned above, you are directed
to the Single Transcript view module. The transcript is the core
object of the model due to the lack of a genome. The central view
343
Newt-omics
BLAST
Server
Transcripts
Peptides
Expression
Search Module
- GO terms / Interpro
- Uniprot / GeneSymbol
- Pathway / keywords
- BLAST / eValues
- eValue
- different Blast dbs
- wordsize
Transcript result
Result / Alignment
- modifications
- length of seq
- mass
- mascot score
Result
- time-points
- pValue
- Fold Change
- Time-course
Result heatmap
Single Transcript View
Fig. 3 Modes of database assessment. The database can be accessed by the graphical user interface (GUI) via
the main search forms, focusing on the transcript itself, the sequence similarity (BLAST), the proteome
(Peptides), or the expression values. Each search form offers specific search parameters in the corresponding
search module. Each search module generates a specific result table or visualization. The single entities of the
result structure are linked to the single transcript view, presenting all available information for a single database entry
enables you to access any information stored in relation to a single

transcript in the database. The direct link http://newtomics.
mpi-bn.mpg.de/contig5.php?line=Contig5389 provides an example. You will see that the view contains five main tabs on the top:
Transcript, Annotation, Functional Annotation, Expression,
and Peptide (from left to right).
1. The Transcript panel is activated by default and displays the
transcript sequence of a selected transcript. Furthermore, you
will get a list of the IDs and coordinates of individual reads that
were assembled to generate the transcript (Fig. 4a). In the general overview you will find all IDs that are used in the database
to reference the selected transcript. You will find these IDs useful when you want to reference a specific entry or want to
access a specific entry by the ID search form explained below.
To download the transcript assembly or the single ESTs that
were used for the assembly in FASTA format, you can use the
dedicated links (see Note 1).
344
Fig. 4 Transcript view of the Web-based GUI of the newt-omics repository. Section (a) gives detailed information about the sequence, sequence download options, and information about the subsequences used in an
alignment step. Section (b) gives an overview on detected sequence similarities. The view can be filtered for
single taxa, and a mouse-sensitive graph gives positional information on single alignments. Section (c) represents identified functional annotations such as Gene Ontology terms or known pathways. Section (d) illustrates
all quantitative measurements that were performed for the chosen transcript. The expression values are visualized by heat maps and line plots. Section (e) visualizes the coding potential of transcripts under investigation.
The complete sequence as well as detected open reading frames are visualized; detected peptides are marked
on the corresponding position
345
2. In the Annotation panel you will find all information derived

from similarity searches for the selected transcript (Fig. 4b).
It provides positional information via a graphical alignment
overview as well as a tabular format. The view is further divided
into two subsections:
(a) In the upper part you will find a graphical overview on
detected sequence similarities. You activate the graphic by
selecting one single taxa of interest in the Please choose
organism field (left). Once selected you will receive an
overview about all sequences with a significant similarity to
the selected transcript and the position of the alignments.
Simultaneously you will get a filtered table (lower part of
the view) to the hits that are visualized in the graphical
overview. You can use the link Show annotation overview to
estimate the general taxa distribution in respect to similarity (see Note 2).
(b) In the lower part of the page, you get a tabular form that
lists all detected significant similarities to other species.
As indicated above, selection of a specific organism filters
the list. You can estimate the quality of each hit by the
attributes of the similarity search such as e-value and corresponding alignment parameters. By clicking on the entry
hit description or hit name, you are redirected to the corresponding NCBI database entry. You can sort the complete tabular for each column, extremely useful in respect
to e-value or organism (see Note 3).
3. By changing to the Functional Annotation panel, you get a
list of Gene Ontology terms affiliated with a selected transcript
(Fig. 4c, upper table) and a list of corresponding protein families and InterPro domains (lower table). The assignments are
derived from UniProt similarity searches. To estimate the quality of the assignment, further attributes are listed, such as the
origin of the organism, e-value, and UniProt ID. The upper
table provides a versatile tool to check your candidate of interest for associated GO terms. The table can be sorted by clicking on the column header. Each entry is linked to the
corresponding source database (see Note 4). In the lower table
you can obtain further information about detected protein
families and InterPro domains. Tables can also be sorted by
columns and provide links to iHOP (25) and WikiGenes (24).
4. By highlighting the Expression panel, you will receive information about expression values that are available for your transcript of interest (including individual sequences that were
used for the transcript assembly, Fig. 4d). A set of timeline
graphs and heat maps visualizes expression experiments on the
regenerating heart and dorsal/ventral lens. First, you will find
the calculated mean and median fold changes with standard
346
deviation (upper left line plot), representing a time course of

regenerating hearts with ten sampling points. Furthermore,
you can inspect the expression changes for single on-array replicates comprising the transcript of interest on the second line
plot on the right. By using the visualization, you can evaluate
the uniformity and thereby the reliability of the replicate set. If
you click on the Show FC of ESTS link, you will get a heat map
on calculated log2-based changes for individual transcripts.
Furthermore, all single reads are displayed in separate tables
giving you detailed fold changes and p values calculated from
biological replicates. On the lower heat map, you will find the
expression values of regenerating dorsal and ventral lens tissue,
based on the identical array platform (see Note 5).
5. In the Peptide panel, you will get an overview about the coding potential of your transcript of interest. The panel provides
details about experimentally validated peptides for selected
transcripts (Fig. 4e). Since transcripts are assembled from single ESTs, the coding potential of transcripts is based on individual ESTs, which are displayed separately. For each EST one
or more open reading frames are listed (column 1). Identified
peptides are highlighted in yellow within the complete translated EST sequence (column 2). Furthermore, you can go
back to the peptide sequence as well as its score and m/z ratio.
The EST and peptide information can be used to identify frame
shifts in the sequence (see Note 6).
3.3
Protocols
The protocol section describes how to use the search modules.

Search can be initiated at different points of view, starting with a
keyword or ID, a sequence of interest, peptide attributes such as
mass, or queries for specific expression patterns.
Protocol: Identification of your candidate of interest and
retrieval of corresponding information by IDs or keywords. After
opening the Transcript window in your browser, you will find
three search options (Fig. 5a).
1. The first option is a transcript assembly based search form. You
can directly access the database by internal IDs, the transcript
length, or name. Use of this interface is recommended if you
want to browse for general information available in the database for a limited number of already known candidates. This
search form is also important to retrieve information about
single known candidates after a database update. Search terms
are selected from the drop-down list and search parameters are
added to the appearing search field. You can further modify the
queries including larger/smaller than operators. Multifactor
searches are initiated by adding search fields, which might be
linked using AND or OR operators.
347
Fig. 5 Web-based GUI of the newt-omics repository. The GUI presents the main entrance panels available for
queries of the repository. Screenshot (a) presents the search form based on single transcripts, screenshot (b)
presents the BLAST interface for homology searches, screenshot (c) presents the expression based search
form, and screenshot (d) illustrates the peptide search form. All search results will link to single transcripts
matching the search query, visualized by the central transcript view (Fig. 4)
2. The second option is annotation-centered enabling queries to

the annotation section of the database. It is required to specify
the annotation algorithm, the database that will be used for
similarity searches, keywords such as protein symbols or database identifiers, and finally a significance threshold. In general,
this search option is used to query the database for single candidates/groups of candidates of interest for which a gene symbol or key words are available. Searches might be filtered by
additional AND or OR operators.
3. The third option is annotation centered as well but focuses on
functional annotations such as GO terms and GO identifiers,
UniProt identifiers, protein family names, pathways, and
domains. Furthermore, results might be filtered for expression
changes on transcript level or coding potential. The search
option should be employed if you are interested in a set of
transcripts that are related to a specific term of interest, e.g., a
specific molecular function.
348
Once a search query is formulated and submitted by clicking

the submit button, the search result is displayed in a table, listing
all transcripts matching the query. The table is sortable by columns
such as ID, length, or functional annotations (click to the column
header). Furthermore, a detailed list reports similarities for each
transcript, featuring a mouse-over function that presents each
alignment. The view is helpful to learn whether searches detect
specific transcripts by one or multiple hits (in different taxa).
Selecting a single transcript candidate will lead to the transcriptcentered view (see above), containing all information about a single
transcript that are stored in the database.
3.4 Protocol:
Identification of Your
Candidate of Interest
and Retrieval
of Corresponding
Information
by Sequence
The BLAST window provides a typical BLAST alignment search

form (as it is provided by large repositories such as NCBI) to query
the assembled transcriptome of the newt (Fig. 5b). Selecting the
searchable sequence databases from the drop-down list, you can
search the latest assembly as well as earlier assemblies. The database
can be searched with nucleotide or protein sequence depending on
the BLAST algorithm (blastn or tblastn) used. Results can be filtered by significance (e-value cutoff). Once started, you will find
the results of your BLAST search displayed graphically and in text
format. By checking the alignment position in the graphical overview, you get information about the relative position and length of
the alignment. The lower hit table provides information about statistical significance linked directly to the corresponding transcripts
(transcript entered view see above). Additionally, each sequence
alignment is reported at the end of the page in text format.
3.5 Protocol: Search

for Expression
Patterns of Interest
Selection of the Expression window enables access to the dataset

by general expression patterns. Expression data are based on microarray and RNA-seq experiments from the regenerating heart and
lens (Fig. 5d). Initially, a tissue of interest is chosen. Next you specify the general conditions you are interested in. For instance, if you
are interested in a set of transcripts that is significantly upregulated
in the heart within the first day of regeneration:
1. Select the heart tissue.
2. Select greater than in the drop-down menu for 2, 6, and 24 h.
3. Type 1.5 (log2) into the expression value field.
4. Type 0.05 into the p value field.
5. Check AND als logical operator on top and start the search.
The result table is organized as a heat map. Each column represents an array spot, whereas a transcript (second column) comprises
one or more array spots. Expression values are color coded. Red
indicates higher expression compared to undamaged tissue, and
green indicates lower expression compared to undamaged tissue.
349
Statistical significance can be assessed at the right part of the table,

showing corrected p values for all expression changes. Direct links
in column two provide access to the transcript-centered view
(see above).
3.6 Protocol:
Investigation
of the Coding
Potential
of Transcripts
The Peptides window allows searches for experimentally validated

transcript sequences (Fig. 5c). The database can be queried for peptide attributes such as length, score, or mass. Further, searches can
be filtered for single experiments in distinct tissues. Multiple search
forms can be combined by selecting the AND or OR operator from
the drop-down menu as in the other main windows. After a result
list is obtained (for instance search for peptide length more than 25),
the provided links provide access to an overview list for the peptide.
Following such a link (in this example with the ID 1000), a summary of annotations and functional annotations (has to be enlarged
by clicking either on Show contig results or Show functional annotation results) is provided. Within the enlarged result tables, the transcript-centered view (see above) can be selected by clicking on one of
the transcripts of interest (column 2).
Notes
1. The transcriptome assembly presented in the database is based
on an EST sequencing approach. Each assembled transcript is
derived from one or more EST sequences. The OVERVIEW
OF ESTS table gives information about the number of ESTs
that contributed to a transcript as wells as the number of spots/
replicates that are represented in the microarray study, since all
ESTs were used as spots on the custom-made arrays. You might
use the number of spots representing an individual sequence
but were not included in the array analysis (panel expression)
to estimate the quality/expression level of these spots. If a
large proportion of sequences is missing, low-level expression
of the EST can be assumed.
2. The Show annotation overview view is useful to analyze similarity hits provided for a transcript of interest. First, you should
check the taxa distribution for widely explored mammalians
such as human and mouse. Next, you compare this percentage
to the percentile for close relatives of the newt such as
Xenopus and axolotl. If you see a large proportion of hits for
mammalians, you will obtain sequences with high similarity
and robust annotation. In case you receive a high percentage
of close relatives, you will also see closely related sequences,
but the quality of annotations will be low.
3. Multiple BLAST hits for multiple taxa are stored in the
database. These hits are presented in the annotation panel of
350
the transcript-centered view. Sorting this table for organism

and e-value will provide important insights in the robustness of
sequence similarities. For instance, a key word search for
BMPR2 is performed on all BLAST hit descriptions stored in
the database. The result list will name all transcripts having at
least one similar counterpart in another organism with the
description line harboring BMPR2. To estimate the robustness
of that assignment, the number of different organisms in the
HSP group and the relative size of the corresponding e-value
should be used.
4. Evaluating the impact of Gene Ontology assignments can be
done by sorting the GO table by the GO ID column. There
will be GO terms with the same protein assignment for multiple organisms as well as assignments only for single taxa. You
can use this information to classify multiple taxa-based assignments as more reliable or highly conserved.
5. If you compare single EST IDs from heart and lens experiments, you will find an overlap but not congruence of the IDs.
This is due to quality assessment during array analysis. A small
overlap between heart and lens or within dorsal and ventral
lens gives you a hint whether a transcript is highly or lowly
expressed in the corresponding tissue.
6. In the peptide view, each corresponding EST is listed with the
ORF ID and all peptides identified within an ORF. In case one
ORF yields multiple peptide identifications, the probability for
identification of a correct ORF is high. Browsing of the transcriptome might provide sequences that have two or even
more ORFs with peptide identifications. Usually such a result
indicates false-positive peptides due to sequencing errors. Such
information might be used to correct the single EST sequence
or even the assembled transcript.
Acknowledgment
This work was supported by the Max-Planck-Society, the Excellence
Cluster Cardiopulmonary System (ECCPS), the University of
Giessen-Marburg Lung Center (UGMLC), the Cell and Gene
Therapy Center (CGT) of the University of Frankfurt, the DFG
(SFB TRR81), and the German Center for Cardiovascular Research
(DZHK). The authors would like to thank Marc Bruckskotten for
his invaluable input for creating newt-omics and for preparation of
the figures.
351
References
1. Looso M (2014) Opening the genetic toolbox
of niche model organisms with high throughput techniques: novel proteins in regeneration
as a case study. Bioessays 36(4):407418
2. Sousounis K, Michel CS, Bruckskotten M,
Maki N, Borchardt T, Braun T, Looso M,
Tsonis PA (2013) A microarray analysis of gene
expression patterns during early phases of newt
lens regeneration. Mol Vis 19:135145
3. Mercer SE, Cheng CH, Atkinson DL, Krcmery
J, Guzman CE, Kent DT, Zukor K, Marx KA,
Odelberg SJ, Simon HG (2012) Multi-tissue
microarray analysis identifies a molecular signature of regeneration. PLoS One 7(12):e52375.
doi:10.1371/journal.pone.0052375
4. Wu CH, Tsai MH, Ho CC, Chen CY, Lee HS
(2013) De novo transcriptome sequencing of
axolotl blastema for identification of differentially expressed genes during limb regeneration. BMC Genomics 14:434. doi:10.1186/
1471-2164-14-434
5. Rao N, Jhamb D, Milner DJ, Li B, Song F,
Wang M, Voss SR, Palakal M, King MW,
Saranjami B, Nye HL, Cameron JA, Stocum
DL (2009) Proteomic analysis of blastema formation in regenerating axolotl limbs. BMC
Biol 7:83. doi:10.1186/1741-7007-7-83
6. Stewart R, Rascon CA, Tian S, Nie J, Barry C,
Chu LF, Ardalani H, Wagner RJ, Probasco
Dewey CN (2013) Comparative RNA-seq analysis in the unsequenced axolotl: the oncogene
burst highlights early gene expression in the
blastema. PLoS Comput Biol 9(3):e1002936.
7. Boser A, Drexler HC, Reuter H, Schmitz H,
Wu G, Scholer HR, Gentile L, Bartscherer K
(2013) SILAC proteomics of planarians
identifies Ncoa5 as a conserved component
of pluripotent stem cells. Cell Rep 5(4):
11421155
8. Sandmann T, Vogg MC, Owlarn S, Boutros
M, Bartscherer K (2011) The head-regeneration transcriptome of the planarian Schmidtea
9.
10.
11.
12.
13.
14.
15.
16.
17.
mediterranea.
Genome
Biol
12:R76.
doi:10.1186/gb-2011-12-8-r76
Chapman JA et al (2010) The dynamic genome
of Hydra. Nature 464:592596
Borchardt T, Looso M, Bruckskotten M, Weis P,
Kruse J, Braun T (2010) Analysis of newly established EST databases reveals similarities between
heart regeneration in newt and fish. BMC
Genomics 11:4. doi:10.1186/1471-2164-11-4
Looso M, Borchardt T, Kruger M, Braun T
(2010) Advanced identification of proteins in
uncharacterized proteomes by pulsed in vivo
stable isotope labeling-based mass spectrometry. Mol Cell Proteomics 9:11571166
Spiked-in pulsed in vivo labeling identifies a new
member of the CCN family in regenerating
newt hearts. J Proteome Res 11:46934704
Looso M et al (2013) A de novo assembly of
the newt transcriptome combined with proteomic validation identifies new protein families
expressed during tissue regeneration. Genome
Biol 14:R16. doi:10.1186/gb-2013-14-2-r16
Sousounis K, Looso M, Maki N, Ivester CJ,
Braun T, Tsonis PA (2013) Transcriptome
analysis of newt lens regeneration reveals distinct gradients in gene expression patterns.
PLoS One 8(4):e61445. doi:10.1371/journal.
pone.0061445
Elias JE, Gygi SP (2007) Target-decoy search
strategy for increased confidence in large-scale
protein identifications by mass spectrometry.
Nat Methods 4:207214
Bruckskotten M, Looso M, Reinhardt R,
Braun T, Borchardt T (2012) Newt-omics: a
comprehensive repository for omics data from
the newt Notophthalmus viridescens. Nucleic
Acids Res 40:D895900
Barrell D, Dimmer E, Huntley RP, Binns D,
ODonovan C, Apweiler R (2009) The GOA
database in 2009an integrated Gene Ontology
Annotation resource. Nucleic Acids Res 37:
D396403
INDEX
A
Accessory limb model (ALM) ..................................101113
A1 cells .....................................................................173, 182
Adaptive immune cells .....................................................205
AEC. See Apical epithelial cap (AEC)
Aeromonas ............................................................................ 40
Affymetrix Expression Console ................................312, 314
Affymetrix GeneChip .............................. 310, 314, 315, 331
Affymetrix microarray ..............................................310311
AGP. See Anterior gradient protein (AGP)
AGSC. See Ambystoma Genetic Stock Center (AGSC)
AL-1 cells ................................................. 187, 188, 190195
ALM. See Accessory limb model (ALM)
Alvegesic................................................... 175, 243, 247, 249
Ambystoma
A. maculatum ....................................... 149, 151, 152, 154
A. mexicanum .............................................. 2743, 49, 50,
116, 141145, 206, 209, 269277, 310, 316, 321,
322, 324, 325, 327, 328, 333, 334
A. tigrinum..........................................28, 30, 33, 141, 324
Ambystoma Genetic Stock Center (AGSC) ................. 28, 42,
103, 270, 310, 322, 333335
Ambystomatidae...........................................................27, 71
AMEM. See Amphibian minimal essential medium
(AMEM)
Amikacin ......................................................................38, 40
3-Aminobenzoic acid ethyl ester (MS-222) ............. 254, 257
Aminoglycosides.......................................................254, 255
Ammonium chloride ................................................230, 235
Amniotes ............................................................ 7, 9, 12, 148
Amphibian minimal essential medium
(AMEM) ......................................176, 177, 179181,
189191, 193, 254, 255
Amphibian papilla ....................................................253, 264
Amphiumids.........................................................................9
Amplexus.......................................................... 18, 24, 48, 64
Ampullae .......................................................... 253, 259, 260
Amquel ............................................................... 41, 142, 281
Aneurogenic .............................................................147155
Animal pole ......................... 64, 275, 277, 288, 300, 301, 303
Anterior gradient protein (AGP) ............................. 148, 149
Aortic arches.......................................................................31
Apateon .......................................................................... 10, 11
Apical epithelial cap (AEC) ..................................... 102, 103
Apomorphy ....................................................................8, 11
Artemia ............................. 38, 39, 41, 51, 52, 56, 60, 66, 270
Ascorbic acid ...................................................... 95, 230, 235
Autopodial elements .........................................................148
Autotomy ............................................................... 71, 73, 76
Axolomics .........................................................................291
Axolotl genome ................. 159, 280, 291, 293, 322, 324, 327
Azide .................................................230, 231, 235, 237, 239
B
Bacterial Artificial Chromosome (BAC) .......... 269, 323, 324
Basale commune ............................................................ 7, 9, 12
Basic Local Alignment Tool (BLAST) ................... 317318,
324, 325, 327332, 340, 341, 343, 347350
Benzocaine ........................................117, 119, 272, 276, 277
B1H1 cells ........................................................................182
Bicistronic.........................................................................160
Bioanalyzer ...............................................................310, 313
Biofilters .............................................................................52
Biotin-16-dUTP ..........................................................85, 87
Blackworms .................................22, 24, 38, 39, 42, 142145
BLAST. See Basic Local Alignment Tool (BLAST)
Blastema cells ........................................... 101, 102, 171, 213
Bolitoglossa ............................................................... 71, 72, 76
Brachial ...................................................... 36, 102, 106, 148
Brachial nerves .........................................................102, 148
Brine shrimps .......................... 38, 39, 41, 154, 270, 299, 302
C
Cacodylate buffer ..................................... 255, 256, 258, 261
Caecilians ...........................................................................10
Calretinin .................................................................257, 263
Capillary electrophoresis...................................................280
Cardiac troponins .............................................................228
Cardiomyocytes ........... 19, 227239, 242, 243, 245, 248249
Cas9 RNA-guided nuclease .....................................279294
Catecholaminergic neurons ................................................92
cDNA sequencing ............................................................280
Centricon .................................................................130, 132
Chromatophores .................................................................33
Chytridiomycosis ................................................................74
Ciprofloxacin ............................................................244, 254
Clodronate liposome delivery ...........................................206
Clonal density...................................................................172
Clustered Regularly Interspersed Short Palindromic Repeats
(CRISPR) ..................................................... 280, 291
Biology, vol. 1290, DOI 10.1007/978-1-4939-2495-0, Springer Science+Business Media New York 2015
353
SALAMANDERS IN REGENERATION RESEARCH: METHODS AND PROTOCOLS

354 Index
CMV promoter .......................................93, 94, 97, 135, 192
Collagen .................................................... 33, 173, 176, 177,
179, 180, 183, 217, 227, 241, 242
Columellar bone ...............................................................258
Contig ID .................................................................326, 330
Contigs .............................. 316, 324328, 330, 332, 333, 349
CRISPR. See Clustered Regularly Interspersed Short
Palindromic Repeats (CRISPR)
Cryogenic .................................................................177, 181
Cryopreservation ......................................................181, 192
Cryptobranchoidea ...............................................................5
Cutsmart buffer ................................................ 283, 284, 286
Cynops pyrrhogaster ........................................................ 29, 83
Cysteine ................................................................ 53, 59, 298
Cytospin centrifuge ..................................................207, 214
D
Daphnia ........................................................................22, 23
DAPI. See 4,6-diamino-2-phenylindole
(DAPI) ...........................................93, 200, 202, 207,
213, 219, 220, 231, 243, 245, 246, 248249, 257, 263
de Bruijn graph.................................................................316
Demembranation...............................256, 259, 261, 263, 264
Dextran-rhodamine ...........................207, 210, 211, 213, 220
4,6-Diamino-2-phenylindole (DAPI).......93, 200, 202, 207,
213, 219, 220, 231, 243, 245, 246, 248249, 257, 263
Dimethyl sulfoxide (DMSO) ................... 177, 181, 190, 192
Diploid genome ..................................................................31
Direct development .................................................... 5, 8, 71
Dissorophoidea ...................................................................10
DMSO. See Dimethyl sulfoxide (DMSO) .............. 177, 181,
190, 192
Dopaminergic neurons .................................................92, 93
E
EasySep magnet .................................... 208, 209, 218220
ECM. See Extracellular matrix (ECM)
Ectopic ..............................................102, 105, 116, 148, 149
transplantation ............................................................149
edgeR package ..................................................................318
EDTA. See Ethylene diaminetetraacetic acid (EDTA)
EdU. See 5-Ethynyl-2-deoxyuridine (EdU)
Electrode ..................................................... 95, 96, 118121,
123, 150, 151, 154, 161, 162, 165
Electron microscope .................................................260, 262
Electroporation....... 92, 9498, 115124, 127, 128, 148, 149,
160, 162, 165, 178, 182, 184, 188, 190, 192, 194196
Entity relationship model (ERM) ....................................339
Ependymoglial cells ................................................9294, 97
Epimorphic ................................................................19, 187
EST ........................... 291, 324328, 340, 341, 346, 349, 350
Ethylene diaminetetraacetic acid (EDTA) .............. 177, 179,
189, 206208, 211, 212, 217219, 225, 256, 264,
272, 281
5-Ethynyl-2-deoxyuridine (EdU) ........................... 230, 231,

235, 237239, 244246, 248250
labeling ...............................................................245, 248
Euthanasia ..........................................................................62
Extracellular matrix (ECM) ............................ 220, 228230,
232, 237, 239, 241, 258
F
False discovery rate (FDR) ....................................... 315, 340
Fast Green ................................................117, 119, 121, 123,
130, 134, 138, 139, 161, 162, 165
Fibrosis .......................................................................34, 206
Ficoll PM 400 ..................................................................282
FIMO clay................................................................150, 154
Flow cytometer ................................. 207, 208, 213, 220222
Fossils ......................................................................... 3, 913
G
Gelatin..................................................... 103, 104, 108112,
154, 173, 176, 177, 179181, 183, 184
bead ............................................................ 103, 109112
Gene Ontology (GO)........................315, 341, 344, 345, 350
Genome .................................... 313, 31, 47, 83, 92, 94, 116,
128, 159, 172, 269, 270, 279, 280, 291, 293, 297, 302,
304, 309311, 316, 317, 321334, 337339, 341, 342
resources ..................................................... 310, 321334
Genotyping ....................... 282, 289, 291293, 298, 302, 304
Gentamicin sulfate ....................149, 151, 175, 255, 298, 302
GentleMacs apparatus ..................................................212
Germplasm .........................................................................37
Gerobatrachus ..............................................................10, 12
GFAP. See Glial fibrillary acidic protein (GFAP)
Giemsa Stain .................................................... 208, 214, 215
Gigantism .............................................................................6
Glial fibrillary acidic protein (GFAP) ......................... 93, 94,
199, 200, 202
Glutaraldehyde .......... 105, 108, 109, 112, 255, 256, 258, 261
GPI-anchored protein ......................................................148
Green fluorescent protein (GFP) .......................... 32, 33, 93,
94, 116, 160165, 174, 192, 287
Grindal worm ................................................... 52, 56, 60, 66
H
Hanks balanced salt solution (HBSS) ..................... 206208,
211, 212, 217219, 225
Heart cultures ...................................................................247
Hematopoiesis ....................................................................31
Hemocytometer........................................ 191, 237, 282, 288
HiDI formamide ..............................................................290
Histoacryl ......................................................... 243, 247, 249
Holtfreters solution ..................................... 38, 53, 104, 117,
142, 144, 207, 209, 211, 218, 272, 281, 287, 288, 298
Human chorionic gonadotropin ..................... 37, 53, 59, 298
Hyaluronic acid ........................................................230, 239

355
Index
6-Hydroxydopamine...........................................................92
Hynobiidae ...........................................................................5
Hypomethylation .............................................................173
I
Iberian ribbed newts .................................................297304
Illumina paired-end sequencing ...............................311, 316
Image J .....................................................................161, 163
Immuno-FISH .............................................................8189
Immunoglobulin .........................................................32, 222
Immunogold labelling ...................................... 256, 260, 264
Inflammatory response .....................................................205
Inflammatory signals ................................................206, 222
Ingenio .....................................................................178, 190
Inner ear ...................................................................253265
Insulin ...................................................................... 176, 189
Insulin-transferrin-selenium (ITS)........................... 189, 194
Intraventricular injection ..............................................9397
I-SceI meganuclease ......................................... 270, 272, 273
I-SceI transgenesis............................................................275
Isogroup............................................................................325
Isolectin B4 ............................... 207, 212, 213, 219, 220, 222
Isopentane ................................................................230, 234
J
JMP Genomics ................................................. 312, 314, 315
K
Keratins ............................................................................173
L
Lagena ..............................................................................253
Lateral line system ........................................................31, 51
Lentectomy ..................................................................8189
Leucistic larvae ...................................................................33
Leydig cells ...................................................................34, 35
L-15 Leibovitz medium ...........................................244, 249
Lobectomy..........................................................................36
Lymphocytes ..............................................................33, 205
Lysine ........... 85, 129, 136, 198, 200, 206, 214, 230, 235, 257
M
Macrophages ............... 33, 205, 206, 209, 215, 220223, 241
Macropinocytosis .............................................................220
Marcs modified ringers ....................................................282
Mass spectrometry....................................................338, 340
May-Grunwald stain ................................................208, 214
Membranous labyrinth .....................................................260
Mesencephalon ...................................................................34
Messenger RNA (mRNA) synthesis ................ 281, 286, 304
Microarray ....................................................... 310315, 317,
318, 323, 324, 331, 332, 334, 337, 340, 341, 348, 349
Microcapillary needle ...............................................130, 134
Microdissection ..................................................................94
Microinjection ................................................. 116124, 130,
160, 165, 282, 292, 300, 301, 303
Microloader tips ............................................ 94, 95, 97, 117,
119, 123, 130, 161, 162, 282, 287
Micromanipulator ........................................... 118120, 123,
124, 161163, 165, 271, 275, 288, 299, 301, 302
Micropipette puller .................. 94, 95, 97, 119, 271, 274, 282
MicroRNA ...............................................................159165
Microtome ..................................................................85, 248
Moloney murine leukemia virus (MMLV), 128
Monoclonal antibody ...............................................173, 219
Morpholinos .............................................................116, 280
Mutagenized animals ...............................................280, 290
Myeloid cells .................................... 206, 212215, 220223
Myofibrils .........................................................................242
Myotubes .......................................................... 172, 173, 229
MySQL database..............................................................312
N
Nanodrop spectrophotometer ...........................................313
Neotenic ............................................................. 5, 10, 27, 34
Nerve dependence ....................................................147, 148
Neural plasticity..................................................................35
Neural stem cells ................................................................91
Neurogenesis ................................................ 91, 92, 115, 197
Neuromast ..........................................................................31
Neurospheres ............................................................197203
Neurotransmission............................................................147
Neutrophils..........................................33, 205, 215, 217, 221
Newt-Omics .............................................................337350
Notophthalmus viridescens ................................. 1724, 29, 49,
50, 91, 93, 171, 253, 254, 338, 340
Novaqua ............................................................. 41, 142, 281
Novel splice isoforms ........................................................316
Nucleofection ............................178, 181184, 190, 193196
O
Olfactory epithelium ..........................................................31
Oligonucleotides .............................................. 281, 283, 324
Ontogenic transition ..........................................................71
Open reading frames ......... 129, 326, 328, 338, 340, 344, 346
Orthotopic transplantation ...............................................149
Osmium tetroxide............................................. 255, 256, 263
Osmolarity.................................173, 175, 176, 189, 198, 202
Otoconia ...................................................................258, 260
Ototoxic ...................................................................253, 254
Ovomucoid .......................................................................199
P
Pacific giant salamander .......................................................8
Paedomorphosis .........................................................10, 141
Paleozoic...................................................................4, 1013
Parabiosis ..................................................................147155

356 Index
Paraformaldehyde (PFA) ................................... 89, 224, 230,
245, 256, 257, 261, 262
Paralogous gene ........................................................316, 326
Paraplast .............................................................................85
PBS. See Phosphate buffered saline (PBS)
pDR274 expression vector ................................................281
Pearsons correlation..........................................................315
Perennibranchiate .................................................................5
Permian ........................................................................1012
Phagocytic cells ................................................................205
Phallacidin ........................................................................256
Phosphate buffered saline (PBS) ........................... 84, 85, 87,
117, 118, 121, 123, 124, 161163, 175, 189, 191, 192,
200, 202, 230, 232, 235, 236, 239, 245, 254, 256, 257,
261263
Pigmented epithelial cells (PECs) .................... 8183, 87, 89
Placode .........................................................................31, 49
Platinum Gate TALENs ..................................................302
Plethodontidae ......................................................... 5, 71, 72
Pleurodeles waltl ............................... 29, 4767, 149, 297304
Pluripotency .........................................................................6
pMLM3613 Cas9 expression vector ................................281
Polyadenylation signal ......................................................291
Poly-D-lysine ........................................... 129, 136, 198, 200
Polyethylenimine ..............................................................129
Poly-l-Lysine ..................................................... 85, 206, 214
Povidone-iodine ............................................... 229, 232, 236
Preaxial dominance ......................................... 7, 8, 10, 12, 13
Proteids.................................................................................9
Proteomes ................................................. 337, 338, 340343
Pseudogenes .........................................................................7
Pseudotyped retrovirus ..................................... 127139, 188
R
Red efts .................................................................. 18, 19, 23
Red fluorescent protein ............................................160, 161
Red spotted newt.......................................... 17, 19, 338, 340
Retinoid............................................................................173
Retroelements.......................................................................6
Retrotransposition ................................................................6
Retroviral .............................................. 6, 128131, 133, 136
infections ....................................................................128
Retrovirus ..................................................... 6, 127139, 188
Rhombencephalon..............................................................34
Robust Multiarray Average (RMA) algorithm .........314, 315
RNA-guided nucleases (RGNs) ........280, 283, 290, 291, 294
RNeasy Mini Kit .............................................. 310, 313314
RSEM software ................................................................317
S
Saccule ...................................................... 253, 259261, 264
Salamander embryos.................................................147155
Salamander-specific novelties .............................................12
Salamandrella keyserlingii....................................................... 8
Sal-site.......................................291, 310, 311, 316, 321335

Saponin .............................................................. 85, 256, 261
Schwann cells ...................................................................148
Semi-circular canals ..................................................253, 260
Sensory epithelia ......................................................253265
Short guide RNAs (sgRNAs) .................................. 280, 281,
285287, 291294
Silicone elastomer .............................................................117
Silver paint .......................................................................256
Sirenids .............................................................................5, 9
Sodium thioglycolate ........................................................298
Sorensons buffer.......................................................207, 208
Spanish ribbed newt .....................................................4767
Spermatophore .............5, 18, 24, 36, 37, 40, 42, 48, 287, 292
S-phase entry .................................................... 229, 242, 245
Spinal cord................................................... 19, 92, 115124,
162, 164, 205, 269, 297, 310
Stable isotope labeling with amino acids in cell culture
(SILAC) ...............................................................340
Steinberg .......................................................... 149, 151155
Stratum corneum ................................................................34
Streptavidin ...............................207, 212, 213, 219, 231, 264
Styrofoam ....................................................... 40, 52, 63, 192
Sulfamerazine ......................................75, 175, 243, 247, 249
SYBR green ..............................................................208, 216
Sytox Blue ................................................ 244, 246, 248, 250
T
TALEN. See Transcription activator-like effector nucleases
(TALEN)
293T cells ................................................. 128133, 136, 138
TCH. See Thiocarbohydrazide (TCH)
Telencephalon...............................................................34, 35
Temnospondyls...................................................................10
Tetrapods ...................................................... 712, 30, 31, 36
Tetrodotoxin .......................................................................23
TH4B cells .......................................................................173
Thiocarbohydrazide (TCH) ............................. 255, 260, 261
Thymidine ................................................................230, 235
Thyroid hormone ............................................... 29, 141, 310
Thyroid stimulating hormone (TSH) ..............................141
Thyroxine .................................................................141145
Tissue primordia ................................................................32
T7 mMessage mMachine kit ...................................281, 286
Tol2 transposase ..................................94, 270, 272, 273, 276
Tol2 transposon ..........................................................94, 116
Trabeculation ....................................................................242
Transcript .....................................................6, 135, 279, 316,
317, 324326, 331, 339, 341350
Transcription activator-like effector nucleases
(TALEN)...............................280, 299, 301, 302, 304
Transcriptome ............................................. 6, 280, 309, 316,
317, 323326, 337, 338, 340, 348350
Transdifferentiation ..............................................8189, 254

357
Index
Transgenesis ........................ 47, 116, 127, 269277, 297, 299
Triazol .............................................................. 310, 312, 313
Tricaine............53, 62, 64, 104, 134, 139, 149, 175, 178, 207,
209211, 217, 223, 229, 232, 243, 247, 249, 282, 288
Triiodothyronine (T3) .......................................................141
Trinity platform ................................................................316
Tropomyosin.......................................................................32
Trypsin .............................. 177, 179, 180, 189, 191, 232, 236
Tubifex ..............................................22, 23, 52, 56, 60, 66, 67
Tungsten .............................. 94, 104, 110, 111, 149153, 155
TurboDNase .....................................................................286
Tweezer electrode .....................................................118, 121
3 Untranslated region ......................................................159

Uranyl acetate ................................................... 257, 262, 264
Urodeles..................................................... 12, 17, 29, 3133,
47, 49, 67, 101, 141, 171, 187, 205, 254, 297, 304
V
Vimentin .......................................................... 243, 245248
Viral vectors...................................................... 116, 128, 188
W
Winged infusion set ..........................208, 209, 217, 218, 225
Ultracentrifuge ................................................. 130, 132, 137

UniProt..................................................... 340, 341, 345, 347
Zeugopodial elements ........................................................11

Zinc finger nucleases (ZFNs) ...........................................280

(Methods in Molecular Biology 1290) Anoop Kumar, András Simon (Eds.) - Salamanders in Regeneration Research - Methods and Protocols

Uploaded by

Copyright:

Available Formats

(Methods in Molecular Biology 1290) Anoop Kumar, András Simon (Eds.) - Salamanders in Regeneration Research - Methods and Protocols

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

(Methods in Molecular Biology 1290) Anoop Kumar, András Simon (Eds.) - Salamanders in Regeneration Research - Methods and Protocols

Uploaded by

Copyright:

Available Formats

Methods in

Molecular Biology 1290

For further volumes:

1 Variation in Salamanders: An Essay on Genomes, Development,

EXPERIMENTAL MANIPULATION IN SALAMANDERS

6 Newt Lens Transdifferentiation: From Lentectomy to Immuno-FISH . . . . . . .

13 In Vivo Modulation and Quantification of microRNAs

SALAMANDER CELLS IN CULTURE

14 Derivation and Long-Term Culture of Cells from Newt Adult Limbs

21 Transgenesis in Axolotl (Ambystoma mexicanum) . . . . . . . . . . . . . . . . . . . . . .

24 Transcriptomics Using Axolotls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

(total 27,834 bp)

Variation in Salamanders: An Essay on Genomes, Development, and Evolution

According to this analysis, the first group to diverge from the

Variation in the Salamander Genome

Variation in Salamanders: An Essay on Genomes, Development, and Evolution

conversion to ES cells in culture. In this and other contexts [24,

Variation in Limb Development

Variation in Salamanders: An Essay on Genomes, Development, and Evolution

Origin of Salamanders and Salamander Phenotypes in Deep Time

Fig. 3 Schematic outline of salamander evolution and paleontology. Note that

salamanders and so do not provide much evidence about origins

Variation in Salamanders: An Essay on Genomes, Development, and Evolution

directly available by inspection of more than a hundred examples

Variation in Salamanders: An Essay on Genomes, Development, and Evolution

an ancestral component in order to confer regeneration on the

6. Wake DB, Marks SB (1993) Development and

13. Hayden JH, Bowser SS, Rieder CL (1990)

Trono D, Pfaff SL (2012) Embryonic stem cell

Variation in Salamanders: An Essay on Genomes, Development, and Evolution

Sire JY, Szczerbinska D, Richardson MK

old amphibian. Proc R Soc B 281:20141550.

Hans-Georg Simon and Shannon Odelberg

range as far north as the Canadian provinces Ontario and Quebec;

Fig. 1 Newt life cycle

Hans-Georg Simon and Shannon Odelberg

This chapter focuses on the maintenance of Eastern newts in a

Notophthalmus viridescens can be purchased from Connecticut

Deionized and dechlorinated water supplemented with 0.0375 %

2.3 Aquarium Setup

1. In a dedicated room with controlled temperature of 2022 C

dirt and debris) plus a magnetic impeller module that pumps

Hans-Georg Simon and Shannon Odelberg

1. Beef heart (local butcher). Mince in food processor and keep

1. Environmental enrichment for breeding: In addition to the

3.1 Animal Housing

1. Keep groups of approximately 30 adult newts in a 20 C

We have experienced that females caught in the wild during spring

4. Carefully transfer the larvae to a separate clear plastic container

Hans-Georg Simon and Shannon Odelberg

12. Lo DC, Allen F, Brockes JP (1993) Reversal of

A. mexicanum, commonly named the axolotl (Fig. 1), are

Johanna E. Farkas and James R. Monaghan

Housing and Maintenance of Ambystoma mexicanum, the Mexican Axolotl

Axolotls have classically been used in developmental biological

Unlike the majority of urodeles, axolotls are obligate paedomorphs

Johanna E. Farkas and James R. Monaghan

maintain the feathery external gills characteristic of ambystomatid

Housing and Maintenance of Ambystoma mexicanum, the Mexican Axolotl